 |
Chromosomal
DNA Variation in Pakistan
Raheel
Qamar,1,2 Qasim Ayub,1,2
Aisha Mohyuddin,1,2 Agnar
Helgason,3 Kehkashan Mazhar,1
Atika Mansoor,1 Tatiana
Zerjal,2 Chris Tyler-Smith,2
and S. Qasim Mehdi1
1Biomedical
and Genetic Engineering
Division, Dr. A. Q. Khan
Research Laboratories, Islamabad;
2Cancer Research Campaign,
Chromosome Molecular Biology
Group, Department of Biochemistry,
and 3Institute of Biological
Anthropology, University
of Oxford, Oxford, United
Kingdom; and deCODE Genetics,
Reykjavik.
Abstract
Eighteen
binary polymorphisms and
16 multiallelic, short-tandem-repeat
(STR) loci from the nonrecombining
portion of the human Y chromosome
were typed in 718 male subjects
belonging to 12 ethnic groups
of Pakistan. These identified
11 stable haplogroups and
503 combination binary marker/STR
haplotypes. Haplogroup frequencies
were generally similar to
those in neighboring geographical
areas, and the Pakistani
populations speaking a language
isolate (the Burushos),
a Dravidian language (the
Brahui), or a Sino-Tibetan
language (the Balti) resembled
the Indo-European–speaking
majority. Nevertheless,
median-joining networks
of haplotypes revealed considerable
substructuring of Y variation
within Pakistan, with many
populations showing distinct
clusters of haplotypes.
These patterns can be accounted
for by a common pool of
Y lineages, with substantial
isolation between populations
and drift in the smaller
ones. Few comparative genetic
or historical data are available
for most populations, but
the results can be compared
with oral traditions about
origins. The Y data support
the well-established origin
of the Parsis in Iran, the
suggested descent of the
Hazaras from Genghis Khan’s
army, and the origin of
the Negroid Makrani in Africa,
but do not support traditions
of Tibetan, Syrian, Greek,
or Jewish origins for other
populations.
Introduction
The earliest evidence of
Paleolithic human presence
in the South Asia consists
of stone implements found
scattered around the Soan
River Valley in northern
Pakistan (Hussain 1997).
Despite the lack of fossil
evidence, these tools appear
to indicate the presence
of hominids in the South
Asia as early as 200,000–400,000
years ago (Wolpert 2000)
and thus are likely to have
been associated with archaic
Homo species. Pakistan lies
on the postulated southern
coastal route followed by
anatomically modern Homo
Sapiens out of Africa, and
so may have been inhabited
by modern humans as early
as 60,000–70,000 years ago.
There is evidence of cave
dwellers in Pakistan’s northwest
frontier, but fossil evidence
from the Paleolithic has
been fragmentary (Hussain
1997). Evidence has been
uncovered at Mehrghar, in
southwestern Pakistan, indicating
Neolithic settlements from
as long ago as 7,000 b.c.
(Jarrige 1991), which were
followed by the Indus Valley
civilizations (including
the cities of Harappa and
Mohenjodaro) that flourished
in the 3d and 2d millennia
b.c. (Dales 1991). Around
1500 b.c., the Indo-European–speaking
nomadic pastoral tribes
from further north—often
called the Aryans—crossed
the Karakorum Mountains
into the South Asia. Subsequent
historical events include
the invasion of Alexander
the Great (327–325 b.c.)
and the Arab and Muslim
conquest from 711 a.d. onwards
(Wolpert 2000).
The
present population of Pakistan
consists of more than 160
million individuals (according
to 2005 WHO figures) who
belong to at least 18 ethnic
groups and speak more than
60 languages (Grimes 1992).
Most of these languages
are Indo-European, but they
also include an isolate,
Burushaski; a Dravidian
language, Brahui; and a
Sino-Tibetan language, Balti.
Punjabi-speaking individuals
form the majority population
of Pakistan, but they represent
a complex admixture of ethnic
groups (Ibbetson 1883) and
are not analyzed here; 12
ethnic groups are included
in the present survey. The
information available about
them is summarized in table
1, together with hypotheses
about their origins (Mehdi
et al. 1999). Although some
of these hypotheses are
well-supported (e.g., the
origin of the Parsis in
Iran), most are based on
oral traditions and have
not been tested against
other sources of evidence.
Scanty
genetic data are available
for these Pakistani ethnic
groups. Early studies of
the ABO blood groups and
classical protein markers
did not include all groups
and mostly classified them
according to their place
of residence. A population
tree based on 54 classical
enzyme markers places the
Hazara and Pathans in the
West Asian cluster containing
the northern Caucasoids
(Cavalli-Sforza et al. 1994).
In another population tree,
based on 47 classical protein
polymorphisms, the Pakistani
samples form a small subcluster
within the Indo-European
speakers from India (Cavalli-Sforza
et al. 1994).
The
Y chromosome provides a
unique source of genetic
evidence (Tyler-Smith 1999;
Jobling and Tyler-Smith
2000). It carries the largest
nonrecombining segment in
the genome and contains
numerous stable binary markers,
including base substitutions
(see, e.g., Underhill et
al. 1997) and retroposon
insertions (Hammer 1994;
Santos et al. 2000), which
can be used in combination
with more-rapidly evolving
markers, such as microsatellites
(see, e.g., Ayub et al.
2000). Consequently, very
detailed Y phylogenies can
be constructed that allow
male-specific aspects of
genetic history to be investigated.
These are strongly influenced
by the small effective population
size of the Y chromosome,
leading to rapid genetic
drift, and by the practice
of patrilocality in many
societies, leading to high
levels of geographical differentiation
of Y haplotypes. Notwithstanding
the work of Qamar et al.
(1999) on the analysis of
YAP+ chromosomes (comprising
~2.6% of the total) and
analyses of STR variation
(Ayub et al. 2000; Mohyuddin
et al. 2001), little work
has been carried out on
Pakistani Y chromosomes.
Therefore, we have now performed
an extensive analysis of
Pakistani Y lineages, to
determine what light they
can shed on the origins
and genetic history of the
subgroups that make up the
Pakistani population.
Material
and Methods
Samples
The Y chromosomes of 718
unrelated male subjects,
belonging to 12 ethnic groups
of Pakistan, were analyzed
(tables 1 and 2; fig. 1).
Informed consent was obtained
from all participants in
this study. An Epstein Barr
virus–transformed lymphoblastoid
cell line was established
from each individual, and
DNA was extracted from these
cell lines for analysis.
Binary Polymorphism
Typing
We typed 15 SNPs, an Alu
insertion (Hammer 1994;
Hammer and Horai 1995),
a LINE1 insertion (Santos
et al. 2000), and the 12f2
deletion (Casanova et al.
1985). The base substitutions
were: 92R7 C?T (Mathias
et al. 1994); M9 C?G (Underhill
et al. 1997); SRY-2627 C?T
(Bianchi et al. 1997); SRY-1532
A?G?A (Whitfield et al.
1995; Kwok et al. 1996;
Santos et al. 1999b); sY81
(DYS271) A?G (Seielstad
et al. 1994); SRY-8299 G?A
(Santos et al. 1999a); Apt
G?A (Pandya et al. 1998);
SRY +465 C?T (Shinka et
al. 1999); LLY22g C?A and
Tat T?C transition (Zerjal
et al. 1997). In addition,
the M17 marker (Underhill
et al. 1997) was typed,
by use of the primers GTGGTTGCTGGTTGTTACGT
and AGCTGACCACAAACTGATGTAGA
followed by AflIII digestion
of the PCR product; the
ancestral allele was not
digested. The M20 marker
(Underhill et al. 1997)
was genotyped, by use of
the primers CACACAACAAGGCACCATC
and GATTGGGTGTCTTCAGTGCT
followed by SspI digestion;
the A?G mutation destroys
the site at position 118
in the 413-bp product. M11
(Underhill et al. 1997)
was typed, using the primers
TTCATCACAAGGAGCATAAACAA
and CCCTCCCTCTCTCCTTGTATTCTACC
followed by digestion with
MspI. The 215-bp product
was digested to 193-bp and
22-bp fragments in the derived
allele. The RPS4Y C?T mutation
(Bergen et al. 1999) was
detected by BslI restriction
digestion of a 528-bp PCR
product obtained by use
of the primers CCACAGAGATGGTGTGGGTA
and GAGTGGGAGGGACTGTGAGA.
The ancestral C allele contains
two sites, and the derived
T allele contains one. M48
(Underhill et al. 1997),
A?G, was typed by allele-specific
PCR using the discriminating
primers TGACAATTAGGATTAAGAATATTATA
and TGACAATTAGGATTAAGAATATTATG
and the common primer AAAATTCCAAGTTTCAGTGTCACATA
to generate specific 145-bp
products. The set of Y binary
marker alleles carried by
a single individual will
be referred to as “the Y
haplogroup.”
Of the 718 samples, 717
fell into haplogroups expected
on the basis of the known
phylogeny, but one Pathan
sample (PKH134) failed to
amplify at the SRY –1532
and M17 loci. He was assigned
to haplogroup 3 on the basis
of alternative SRY –1532
primers (details on request)
and his STR profile.
Y-STR
Typing
Five trinucleotide-repeat
polymorphisms (DYS388, DYS392,
DYS425, DYS426, and DYS436),
ten tetranucleotide-repeat
polymorphisms (DYS19, DYS389I,
DYS389b, DYS390, DYS391,
DYS393, DYS434, DYS435,
DYS437, and DYS439) and
one pentanucleotide microsatellite
(DYS438) were typed in all
Y chromosomes. Three multiplex
PCR reactions were performed
for all Y-STRs, in a10-µl
final reaction volume containing
20 ng genomic DNA, as described
elsewhere (Thomas et al.
1999; Ayub et al. 2000).
PCR products were run on
an ABI 377 sequencer. ABIGS350
TAMRA was used as the internal
lane standard. The GENESCAN
and GENOTYPER software packages
were used to collect the
data and to analyze fragment
sizes. Y-STR alleles were
named according to the number
of repeat units they contain.The
number of repeat units was
established through the
use of sequenced reference
DNA samples. Allele lengths
for DYS389b were obtained
by subtraction of the DYS389II
allele length from DYS389I.
Y-STR duplications were
found at several loci. DYS393
was duplicated in PKH165
(13 and 15) and DYS437 was
duplicated in SDH181 (8
and 9). A more complex pattern
was found in DYS425, where
two to four alleles were
found in 36 individuals
from haplogroups 8, 9, 13,
and 21.
Data
Analysis
Principal-components analysis
was carried out on haplogroup
frequencies by use of the
ViSta (Visual Statistics)
system software, version
5.0.2 (Young and Bann 1996).
For graphic representation,
the first and second principal
components were plotted
by the Microsoft Office
Suite Excel Package on Windows
2000. Biallelic polymorphism
data for various world populations
used in the analysis were
obtained from Hammer et
al. (2001). Admixture was
estimated by use of three
different measures: Long’s
weighted least-squares (WLS)
measure (Long 1991); mR,
a least-squares estimator
(Roberts and Hiorns 1965);
and m? (Helgason et al.
2000).
Analysis of molecular variance
(AMOVA) was carried out
by use of the Arlequin package
(Schneider et al. 1997).
AMOVA measures the proportions
of mutational divergence
found within and between
populations, respectively.
Although much of the variation
at the rapidly mutating
microsatellite loci is expected
to have been produced in
the different Pakistani
subpopulations, the unique
mutation events at the binary
loci are much older and
have not occurred in the
context of the subdivision
of the Pakistani population.
We devised the following
strategy to exploit the
maximum amount of relevant
mutational information from
the Y-chromosome haplotypes.
STR variation within haplogroups
was used to calculate population
pairwise FST values for
each individual haplogroup.
For each population pair,
a weighted mean FST was
calculated, where the value
obtained for each haplogroup
was weighted according to
the proportion of pairwise
comparisons involving that
haplogroup. In the absence
of a particular haplogroup
from one population, A,
of the pair A and B, FST
was set to 1, and the number
of pairwise comparisons
was taken as the number
of chromosomes carrying
that haplogroup in B. Values
of FST based on STRs alone
or on STRs plus binary markers,
with binary markers given
a 10-fold higher weighting,
were calculated for comparison.
In all of these analyses,
the distance matrix used
consisted of the number
of steps by which each pair
of haplotypes differed.
Mantel tests for the significance
of correlations between
FST values were carried
out in Arlequin, and multidimensional
scaling (MDS) plots were
constructed by use of the
SPSS version 7.0 software
package.
Median-joining
networks were constructed
by Network 2.0b (Bandelt
et al. 1999). A weighting
scheme with a five-fold
range was used in the construction
of the networks. The weights
assigned were specific for
each haplogroup and took
into account the Y-STR variation
across the haplogroup in
the whole Pakistani population.
The following weights were
used: variance 0-0.09, weight
5; variance 0.1-0.19, weight
4; variance 0.2-0.49, weight
3; variance 0.5-0.99, weight
of 2; and variance 1.00,
weight 1. Despite this,
the network for haplogroup
1 contained many high dimensional
cubes and was resolved by
applying the reduced median
and median joining network
methods sequentially. The
reduced median algorithm
(Bandelt et al. 1995) was
used to generate a *.rmf
file and the median joining
network method was applied
to this file.
BATWING
(Wilson and Balding 1998),
Bayesian Analysis of Trees
With Internal Node Generation,
was used to estimate the
time to the most recent
common ancestor (TMRCA)
of a set of chromosomes.
This program uses a Markov
chain Monte Carlo procedure
to generate phylogenetic
trees and associated parameter
values consistent with input
data (a set of Y haplotypes)
and genetic and demographic
models. The genetic model
assumes single-step mutations
of the STRs and the demographic
model chosen was exponential
growth from an initially
constant-sized population,
with or without subdivision
in different runs of the
program. All 16 STR loci
were used; locus-specific
mutation rate prior probabilities
based on the data of Kayser
et al. (Kayser et al. 2000)
were constructed for the
loci available as gamma
distributions of the form
gamma(a, b) where a = (1
+ number of mutations observed
by Kayser et al.), and b
= (1 + number of meioses).
For loci not investigated
by Kayser et al., the distribution
gamma (1,416) was used,
which has a mean of 0.0024.
A generation time of 25
years was assumed. Thus
the 95% confidence intervals
given take into account
uncertainty in mutation
rate, population growth
and (where appropriate)
subdivision, but not generation
time.
Results
Y-Chromosome
Binary Polymorphisms
The 18 binary markers used
identify 20 haplogroups
in worldwide populations
(fig. 1A), but only 11 were
found in Pakistan, and 5
accounted for 92% of the
sample (fig. 1 and table
2). Haplogroups 1 and 9
were present in all Pakistani
populations examined, haplogroup
3 was present in all except
the Hazaras, and haplogroup
28 was present in all except
the Hazaras and the Kashmiris.
Southwestern populations
show higher frequencies
of hg 9 and the YAP+ haplogroups
21 and 8 than northeastern
populations (figs. 1D–E),
but, overall, little geographical
clustering of haplogroup
frequencies is apparent
within the country.
Principal-Components
Analysis
We wished to compare the
Pakistani Y haplogroup data
with data from populations
from the rest of the world.
No suitable data set was
available for the entire
set of 18 markers, but the
data of Hammer et al. (2001)
allowed all but 5 to be
used, because the same or
phylogenetically equivalent
markers were reported. The
principal-components analysis
(fig. 2A) shows some differences
from the original analysis
of Hammer et al., the main
one being the lesser separation
of the African populations.
This is due, to a large
extent, to the subset of
markers used, which does
not include many of the
Africa-specific ones. Most
Pakistani populations cluster
with South Asian and Middle
Eastern populations, and
are close to Northern African,
Central Asian and European
populations, thus showing
a general similarity with
geographically close populations.
The one exception is the
Hazara, who are quite distinct.
A similar analysis of the
Pakistani populations alone,
using all of the binary
markers (fig. 2B), confirms
the difference between the
Hazaras and the other populations
and also more clearly shows
the distinctness of the
Kalash and the Parsis. It
is striking that the language
isolate–speaking Burusho
and the Dravidian-speaking
Brahuis do not stand out
in these analyses.
Admixture Estimates
Hypotheses about population
origins (table 1) can be
considered as quantitative
questions about admixture.
For example, to test the
possibility that the Baluch
Y chromosomes have a Syrian
origin, we can ask what
proportion of the Baluch
Ys are derived from Syria
and what proportion are
from Pakistan (considered
to be the Pakistani sample
minus the Baluch). Data
on suggested source populations
were taken from the literature
and three measures of admixture
were calculated. The three
estimates gave broadly consistent
results, with small systematic
differences: typically m?
> mR > Long’s WLS
for the estimated contribution
from the external source
population (table 3). These
results provide evidence
for an external contribution
to the Hazaras, Kalash,
Negroid Makrani, and Parsis
but not to the other populations.
Y-Chromosome STR
Polymorphisms
Y-STR polymorphisms were
studied to obtain a more
detailed view of Y variation,
among the different Pakistani
ethnic groups, that would
be less biased by the marker-ascertainment
procedure. The diversity
of Y-STR haplotypes (table
4) was lowest for the Hazara
(0.893) as suggested by
previous analyses (Ayub
et al. 2000).
The 16 Y-STRs defined 502
Y haplotypes, the vast majority
being observed in single
individuals. The remaining
haplotypes were shared by
2–18 individuals (details
are given in the online-only
supplementary table). In
all cases but one, the chromosomes
sharing a haplotype belonged
to the same haplogroup (hence,
503 combination haplotypes)
and, in most cases, the
individuals sharing a haplotype
belonged to the same population
(table 5).
The
GST and modal size of the
repeat unit, for all 16
Y-STRs examined in the Pakistani
population, are given in
table 6. The correlation
between marker heterozygosity
and GST was found not to
be significant (r=0.329;
P=.213). The modal size
and variance of the 16 Y-STRs
within haplogroups 1, 2,
3, 8, 9, 10, 21, 26, and
28 is also given in table
6. Certain haplogroups have
a different modal allele
size, and some examples
of this are shown in boldface
italics in table 6. For
instance, DYS388 has 15
repeats in haplogroup 9,
compared with 12 repeats
in most of the other haplogroups
in Pakistan. Similarly,
the modal allele for DYS438
is 9 in haplogroup 9, but
10 or 11 in the other haplogroups.
The modal allele for DYS434
for haplogroup 10 is 11,
which is strikingly different
from the allele size of
this locus in other haplogroups.
The complete lack of variability
for DYS436 in the 233 male
subjects belonging to haplogroup
3 is notable. Haplogroup
10 appears to have the least
variability across most
loci except for DYS390 (table
6). These findings demonstrate
the strong structuring of
Y-STR variability by haplogroup.
We
wanted to calculate
a Y-based measure
of genetic distance
between populations
that would reflect
the differentiation
that had occurred
within Pakistan and
that would not be
disproportionately
dominated by ancient
differences that had
previously accumulated
between haplogroups.
The standard way to
do this would be to
use STR variation,
and table 7 summarizes
population pairwise
values of FST on the
basis of STR variation
alone (A) or of binary-marker
plus STR variation
(B), with binary-marker
differences weighted
10 times higher than
STR differences. These
matrices are highly
correlated (r=0.95;
P<.001), as might
be expected from the
structuring of STR
variation by haplogroup.
However, these measures
are significantly
influenced by ancient
differences, and we
have therefore developed
a modified measure.
We reasoned that much
of the STR variation
within haplogroups
would have originated
recently and could
be used for this purpose.Nous
avons calculé
donc par paires des
valeurs de population
de FST, sur la base
du STR variation dans
des haplogroups, et
utilisé une
moyenne pesée
de ces derniers pour
produire une matrice
simple de distance
de FST (table 7C ;
figue. 3) These distances
are also highly correlated
with distances based
on STRs alone (r=0.76;
P<.001) or on STRs
plus binary markers
(r=0.70; P<.001),
but a greater proportion
of the variation is
seen between populations
(22%, compared with
6% and 7%, respectively).
A comparison of figure
3 with figure 2B (which
was based on binary
marker frequencies
alone) reveals a striking
overall resemblance,
with the Hazaras being
distinct from all
of the other populations.
The other outstanding
populations are the
Kalash and Parsis
(as before), the Kashmiris
(perhaps because of
the small sample),
and the Brahuis, who
are thus more distinct
in their STR profiles
than haplogroup frequencies.
MDS plots of the distances
in tables 7A and 7B
(not shown) lead to
similar conclusions,
but resemble figure
2B more closely in
the way that the Brahuis
do not stand out so
much.
Median-Joining
Networks
The genetic relationships
among the different Pakistani
ethnic groups were explored
further by drawing median-joining
networks (Bandelt et al.
1995), and examples are
shown in figures 4, 5, and
6. The haplogroup 1 network
(fig. 4) reveals considerable
variation, but also a high
degree of population-specific
substructure. For example,
the 24 Parsi haplogroup
1 chromosomes all fall into
one of three clusters (fig.
4, green), 19 of 26 Burusho
haplogroup 1 chromosomes
fall into two clusters (blue),
and 12 of 14 Hazara haplogroup
1 chromosomes fall into
a single cluster, and all
of these clusters are specific
to their respective populations.
The haplogroup 10 network
(fig. 5) is much simpler,
because of the smaller number
of chromosomes, but again
reveals population-specific
clustering for Burusho and
Hazara haplotypes. The haplogroup
28 network (fig. 6) shows
a striking isolated Parsi-specific
cluster, at the end of a
long branch, containing
15 of 16 Parsi haplogroup
28 chromosomes. Clusters
of Kalash, Burusho, and—to
a lesser degree—Baluch chromosomes
are also evident, although
one Baluch haplotype is
shared with Sindhi and Makrani
Baluch individuals from
nearby southern populations.
BATWING TMRCAs were calculated
for the haplogroup 28 network
and for selected lineages
within a number of haplogroups.
The results are summarized
in table 8.
Discussion
We have carried out the
first extensive analysis
of Y diversity within Pakistan,
examining 34 markers in
718 male subjects from 12
populations. This allows
us to compare Pakistani
Y diversity with that previously
reported in world populations,
to investigate differences
within Pakistan, and to
evaluate some of the suggested
population histories from
a Y perspective.
Comparisons with
Worldwide Data
In a worldwide comparison,
Pakistani populations mostly
cluster around a pooled
South Asian sample and lie
close to a Middle Eastern
sample (fig. 2A). This finding
is unsurprising, in part
because the South Asian
sample included 62 Pakistani
individuals (i.e., 32% of
196 total) and in part because
Y variation in many areas
of the world is predominantly
structured by geography,
not by language or ethnic
affiliation (Rosser et al.
2000; Zerjal et al. 2001).
The greater genetic similarity
of Pakistani populations
to those in the west than
to eastern populations is
illustrated by the fact
that four of the five frequent
haplogroups in Pakistan
(haplogroups 1, 2, 3, and
9, which together make up
79% of the total population)
are also frequent in western
Asia and Europe but not
in China or Japan; conversely,
the haplogroups that are
frequent in East Asia (e.g.,
4, 5, 10, 13, and 20) are
rare or absent in Pakistan,
forming only 2.5% of the
total. If, as in some interpretations,
an early exodus from Africa
along the southern coast
of Asia led to the first
anatomically modern human
populations in Pakistan,
and these people carried
the eastern haplogroups
or their precursors, their
Y chromosomes have now been
largely replaced by subsequent
migrations or gene flow;
indeed, the representatives
of the eastern haplogroups
in Pakistan may be derived
from modern back-migration,
not from ancient survivors.
The fifth haplogroup that
is common in Pakistan, haplogroup
28, differs from all the
others in its distribution.
Within Pakistan, it made
up 14% of our sample and
was present in all but two
populations (both of which
had very small sample sizes),
so it is both common and
widespread. Outside Pakistan
and the nearby countries,
however, it is rare. It
has been reported in India
(30%; present in 3/3 populations),
Tajikistan (10%; present
in 5/6 populations), and
Uzbekistan (3%; present
in 10/13 populations), but
it is rare in Russia (0.4%;
present in 1/6 populations)
and the Caucasus (1.4%;
present in 1/6 populations
(Wells et al. 2001) and
has not been found at all
in China or Mongolia (unpublished
observations). BATWING estimates
of the TMRCA of the Pakistani
haplogroup 28 chromosomes
were ~7,000 (4,000–14,000)
years (table 8). Thus, within
this time period, the Pakistani
populations have diverged
from a common ancestral
population or have experienced
considerable male gene flow
between themselves or from
a common source. Since the
estimated age corresponds
to the early Neolithic period,
the spread of this lineage
might be associated with
the local expansion of farmers.
Comparisons
within Pakistan
Haplogroup distributions
in Pakistani populations,
with the exception of the
Hazara (discussed in the
next section), are strikingly
similar to one another (figs.
1 and 2), despite some notable
linguistic differences.
Indeed, the language isolate-speaking
Burusho, the Dravidian-speaking
Brahuis, and the Sino-Tibetan–speaking
Baltis did not stand out
from the other populations
at all in the haplogroup
analyses (table 2 and fig.
2), suggesting either that
the linguistic differences
arose after the common Y
pattern was established
or that there has been sufficient
Y gene flow between populations
to eliminate any initial
differences. Yet a more
detailed analysis of the
Y haplotypes (e.g., figs.
3–6) reveals some distinct
features of the Brahui and
considerable population
specificity; population-specific
clusters of related haplotypes
are commonly found in these
networks. Such clusters
will only be seen if populations
are isolated from one another.
It may be that a low degree
of gene flow between populations
over a long time is sufficient
to result in similar haplogroup
frequencies without producing
many shared clusters.
Population-specific clusters
of haplotypes are particularly
evident in some populations.
In the Hazaras, where the
distinct haplogroup frequencies
noted above are found, most
chromosomes (19/23; 83%)
fall into one of just two
well-isolated clusters (figs.
4 and 5), whereas the Parsis,
the Kalash, and the Burusho
also show prominent clusters.
The Hazaras, Parsis, and
Kalash were the three populations
showing the most significantly
different population pairwise
FST values. The high values
of the Hazaras and Parsis
can partly be accounted
for by migration to Pakistan
from other places, but a
contributing factor is likely
to be drift, either due
to a limited number of founder
lineages or occurring subsequently
within small populations.
Tk values (Ewens 1972) provide
a way of comparing effective
population sizes. Values
based on the STRs for the
Hazaras, Parsis, Kalash,
and Burushos were 8.9, 77.5,
25.8, and 74.2, respectively,
compared with a mean of
181.8 for the other populations
with sample sizes >20.
Effective population size
for Y chromosomes can differ
greatly from census population
size, but it is notable
that the Parsis and Kalash
do have the smallest census
sizes, one-hundredth or
one-thousandth of most of
those of the other populations
(table 1), so these small
census sizes may have been
maintained for a long time.
In summary, many features
of the present Pakistani
Y haplotype distributions
can be accounted for by
a shared ancestral gene
pool, with limited gene
flow between populations
and drift in the smaller
ones.
Insights
into Population Origins
The suggested population
origins (table 1) can now
be considered in the light
of these Y results. Information
is provided by haplogroup
frequencies, which can be
used to produce admixture
estimates, and these are
easy to interpret if populations
are large and isolated and
the source populations have
different frequencies. When
these conditions are not
met, the presence of distinct
Y lineages can still be
informative. The origins
of the Parsis are well-documented
(Nanavutty 1997) and thus
provide a useful test case.
They are followers of the
Iranian prophet Zoroaster,
who migrated to India after
the collapse of the Sassanian
empire in the 7th century
a.d. They settled in 900
a.d. in Gujarat, India,
where they were called the
“Parsi” (meaning “from Iran”).
Eventually they moved to
Mumbai in India and Karachi
in Pakistan, from where
the present population was
sampled (fig. 7). Their
frequencies for haplogroups
3 (8%) and 9 (39%) do indeed
resemble those in Iran more
than those of their current
neighbors in Pakistan. They
show the lowest frequency
for haplogroup 3 in Pakistan
(apart from the Hazaras;
fig. 1C). The mean for eight
Iranian populations was
14% (n=401) (Quintana-Murci
et al. 2001), whereas that
for Pakistan, excluding
the Parsis, was 36%. The
corresponding figures for
haplogroup 9 were 39% in
the Parsis, 40% in Iran,
and 15% in Pakistan excluding
the Parsis. These figures
lead to an admixture estimate
of 100% from Iran (table
3). Given the small effective
population size of the Parsis,
the closeness of their match
to the Iranian data may
be fortuitous, and the presence
of haplogroup 28 chromosomes
at 18% (4% in Iran; Wells
et al. 2001) suggests some
gene flow from the surrounding
populations. The TMRCA for
the Parsi-specific cluster
in the haplogroup 28 networks
was 1,800 (600–4,500) years
(table 8), consistent with
the migration of a small
number of lineages from
Iran. Overall, these results
demonstrate a close match
between the historical records
and the Y data, and thus
suggest that the Y data
will be useful when less
historical information is
available.
The population that is genetically
most distinct, the Hazaras,
claims descent from Genghis
Khan’s army; their name
is derived from the Persian
word “hazar,” meaning “thousand,”
because troops were left
behind in detachments of
a thousand. Toward the end
of the 19th century, some
Hazaras moved from Afghanistan
to the Khurram Valley in
Pakistan, the source of
the samples investigated
here. Thus, their oral history
identifies an origin in
Mongolia and population
bottlenecks ~800 and ~100
years ago. Of the two predominant
Y haplogroups present in
this population, haplogroup
1 is widespread in Pakistan,
much of Asia, Europe, and
the Americas, and so provides
little information about
the place of origin. Haplogroup
10, in contrast, is rare
in most Pakistani populations
(1.4%, when the Hazaras
are excluded) but is common
in East Asia, including
Mongolia, where it makes
up over half of the population
(unpublished results). Admixture
estimates (table 3) are
consistent with a substantial
contribution from Mongolia.
BATWING analysis of the
Hazara-specific haplotype
clusters in haplogroups
1 and 10 suggested TMRCAs
of 400 (120–1,200) and 100
(6–600) years (table 8),
respectively. Thus, the
genetic evidence is consistent
with the oral tradition
and, in view of its independent
nature, provides strong
support for it (fig. 7).
Some
other suggested origins
receive more limited support
from the Y data. The Negroid
Makrani, with a postulated
origin in Africa, carry
the highest frequency of
haplogroup 8 chromosomes
found in any Pakistani population,
as noted elsewhere (Qamar
et al. 1999). This haplogroup
is largely confined to sub-Saharan
Africa, where it constitutes
about half of the population
(Hammer et al. 2001) and
can thus be regarded as
a marker of African Y chromosomes.
Nevertheless, it makes up
only 9% of the Negroid Makrani
sample, and haplogroup 28
(along with other typical
Pakistani haplogroups) is
present in this population.
If the Y chromosomes were
initially African (fig.
7), most have subsequently
been replaced: the overall
estimate of the African
contribution is ~12% (table
3).
The
Balti are thought to have
originated in Tibet, where
the predominant haplogroups
are 4 and 26. Neither was
present in the sample from
this study, providing no
support for a Tibetan origin
of the Y chromosome lineages
and an admixture estimate
of zero (table 3). However,
this result must be interpreted
with caution, because of
the small sample size. Three
populations have possible
origins from the armies
of Alexander the Great:
the Burusho, the Kalash,
and the Pathans. Modern
Greeks show a moderately
high frequency of haplogroup
21 (28%; Rosser et al. 2000),
but this haplogroup was
not seen in either the Burusho
or the Kalash sample and
was found in only 2% of
the Pathans, whereas the
local haplogroup 28 was
present at 17%, 25%, and
13%, respectively. Greek-admixture
estimates of 0% were obtained
for the Burusho and the
Pathans, but figures of
20%–40% were observed for
the Kalash (table 3). In
view of the absence of haplogroup
21, we ascribe this result
either to drift in the frequencies
of the other haplogroups,
particularly haplogroups
2 and 1, or to the poor
resolution of lineages within
these haplogroups, resulting
in distinct lineages being
classified into the same
paraphyletic haplogroups.
Overall, no support for
a Greek origin of their
Y chromosomes was found,
but this conclusion does
require the assumption that
modern Greeks are representative
of Alexander’s armies. Two
populations, the Kashmiris
and the Pathans, also lay
claim to a possible Jewish
origin. Jewish populations
commonly have a moderate
frequency of haplogroup
21 (e.g., 20%) and a high
frequency of haplogroup
9 (e.g., 36%; (Hammer et
al. 2000). The frequencies
of both of these haplogroups
are low in the Kashmiris
and Pathans, and haplogroup
28 is present at 13% in
the Pathans, so no support
for a Jewish origin is found,
and the admixture estimate
was 0% (table 3), although,
again, this conclusion is
limited both by the small
sample size available from
Kashmir and by the assumption
that the modern samples
are representative of ancient
populations.
The
suggested origin of the
Baluch is in Syria. Syrians,
like Iranians, are characterized
by a low frequency of haplogroup
3 and a high frequency of
haplogroup 9 (9% and 57%,
respectively; Hammer et
al. 2000), whereas the corresponding
frequencies in the Baluch
are 29% and 12%. This difference
and the high frequency of
haplogroup 28 in the Baluch
(29%) make a predominantly
Syrian origin for their
Y chromosome unlikely, and
the admixture estimate was
0% (table 3), although the
8% frequency for haplogroup
21, the highest identified
in Pakistan thus far, does
indicate some western contribution
to their Y lineages. The
Brahuis have a possible
origin in West Asia (Hughes-Buller
1991) and it has been suggested
that a spread of haplogroup
9 Y chromosomes was associated
with the expansion of Dravidian-speaking
farmers (Quintana-Murci
et al. 2001). Brahuis have
the highest frequency of
haplogroup 9 chromosomes
in Pakistan (28%) after
the Parsis, providing some
support for this hypothesis,
but their higher frequency
of haplogroup 3 (39%) is
not typical of the Fertile
Crescent (Quintana-Murci
et al. 2001) and suggests
a more complex origin, possibly
with admixture from later
migrations, such as those
of Indo-Iranian speakers
from the steppes of Central
Asia and others from further
east. This possibility is
supported by the detection
of low frequencies of haplogroups
|