Genetics

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Chromosomal DNA değişme miktarı içinde Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 İsa Tyler- demirci vesaire. Qasim Mehdi1

1Biomedical ve gen mühendislik paylaştırma, Dr. A. Q. han araştırma laboratuvar, Islamabad; 2Cancer araştırma kampanya, Chromosome molekül biyoloji topluluk, kısım -in biyokimya, ve 3Institute -in biyolojik antropoloji, üniversite -in Oxford, Oxford, birleşik kirillik; ve şifresini çözmek Genetics, Reykjavik.


Soyut

Onsekizinci çift polymorphisms ve 16 multiallelic, kısa- iki kişilik bisiklet- tekrarlamak (STR) loci --dan belgili tanımlık nonrecombining porsiyon -in belgili tanımlık insana ilişkin Y chromosome were tip içinde 718 erkek kul ait 12 budunsal topluluk -in Pakistan. bunlar identified 11 ahır haplogroups ve 503 birleştirme çift damgalı/STR haplotypes. Haplogroup sık sık oluş were ekseriya benzer -e doğru o içinde neighboring coğrafi alan, ve belgili tanımlık Pakistani nüfus konuşmak a dil ayırmak ( belgili tanımlık Burushos), a Dravidian dil ( belgili tanımlık Brahui), ya da a Sino-Tibetan dil ( belgili tanımlık Balti) benzemek belgili tanımlık Indo-European–speaking çoğunluk bununla birlikte, kitle iletişim araçları- iltihak ağ -in haplotypes kâşif büyük substructuring -in Y değişme miktarı zarfında Pakistan, ile adl nüfus göstermek farklı salkım -in haplotypes. bunlar numune -ebilmek var olmak rapor için yanında a ortak havuz -in Y soy, ile katı izolasyon arada nüfus ve sürükleme içinde belgili tanımlık asgarî kendisi az karşılaştırmalı gen ya da tarihsel veri are elde edilebilir için en nüfus, ama belgili tanımlık -den sonuçlanmak -ebilmek var olmak karşılaştırmak ile sözel gelenek hakkında başlangıç belgili tanımlık Y veri çekmek belgili tanımlık su kuyusu- kurulu başlangıç -in belgili tanımlık Parsis içinde Iran, belgili tanımlık önermek iniş -in belgili tanımlık tehlike --dan Genghis han ordu, ve belgili tanımlık başlangıç -in belgili tanımlık Arap Makrani içinde Afrika, ama yapmak değil çekmek gelenek -in Tibetan, Suriye, Yunanca, ya da Musevî başlangıç için diğer nüfus.


Tanıtma

Belgili tanımlık earliest kanıt -in Paleolithic insana ilişkin hazır bulunma içinde belgili tanımlık güney Asya oluşmak -in taş alet kurmak perişan çevrede belgili tanımlık Soan nehir vadi içinde şimalî Pakistan ( edepsiz 1997). -e rağmen belgili tanımlık -sizlik çekmek -in fosil kanıt, bunlar alet gözükmek -e doğru göstermek belgili tanımlık hazır bulunma -in yolu bulabilen içinde belgili tanımlık güney Asya aynı derecede erken aynı derecede 200,000–400,000 yıl önce (Wolpert 2000) ve böylece are beğenmek -e doğru -si olmak be birleştirmek ile kemer Homo tür. Pakistan lies üstünde belgili tanımlık gerçek olarak kabul etmek cenubî kıyı rota izlemek yanında anatomically Rumca Homo Sapiens dışarı -in Afrika, ve öylesine -ebilmek -si olmak be meskun yanında Rumca insana ilişkin aynı derecede erken aynı derecede 60,000–70,000 yıl önce. var kanıt -in mağara oturmak içinde Pakistan’s kuzeye doğru sinir, ama fosil kanıt --dan belgili tanımlık Paleolithic bkz. have be parça ( edepsiz 1997). kanıt bkz. have be açık vasıl Mehrghar, içinde southwestern Pakistan, belirti Neolithic yeni küçük yerleşim alanı --dan aynı derecede uzun önce aynı derecede 7,000 b.c. (Jarrige 1991), hangi were izlemek yanında belgili tanımlık -e ikna etmek vadi uygarlık ( dahil belgili tanımlık vatandaş -in usandırmak ve Mohenjodaro) adl. şu el sallamak içinde belgili tanımlık 3d ve 2d millennia b.c. (vadi 1991). çevrede 1500 b.c., belgili tanımlık Indo-European–speaking göçebe pastoral kabile --dan daha fazla north—often seslenmek belgili tanımlık Aryans—crossed belgili tanımlık Karakorum dağ içine belgili tanımlık güney Asya. sonradan ortaya çıkan tarihsel vukuat katmak belgili tanımlık akın -in Alexander belgili tanımlık büyük (327–325 b.c.) ve belgili tanımlık Arap ve Müslüman fetih --dan 711 a.d. ileriye doğru (Wolpert 2000).

Belgili tanımlık armağan nüfus -in Pakistan oluşmak -in daha --dan 160 milyon bireysel ( gör -e doğru 2005 kim biçim) kim mensup hiç olmazsa 18 budunsal topluluk ve konuşmak daha --dan 60 dil ( sert 1992). en -in bunlar dil are Indo- Frenk, ama onlar da katmak an ayırmak, Burushaski; a Dravidian dil, Brahui; hem Sino-Tibetan dil, Balti. Punjabi- konuşmak bireysel biçim belgili tanımlık çoğunluk nüfus -in Pakistan, ama onlar göstermek a birçok parçadan oluşmuş karıştırma -in budunsal topluluk (Ibbetson 1883) ve are değil çözümlemek burada; 12 budunsal topluluk are dahil içinde şimdiki bakmak. bilgi elde edilebilir hakkında onları bkz. be özetlemek içinde masa 1, bile hipotez hakkında onların başlangıç (Mehdi et al. 1999). -e karşın biraz -in bunlar hipotez are su kuyusu- taraftar (e.g., belgili tanımlık başlangıç -in belgili tanımlık Parsis içinde Iran), en are müstenit sözel gelenek ve -si olmak değil be sınav -e karşı diğer kaynak -in kanıt.

Inceden inceye gözden geçirmek gen veri are elde edilebilir için bunlar Pakistani budunsal topluluk erken iyice düşünülmüş -in belgili tanımlık ABO kan topluluk ve klasik protein damgalı did değil katmak tüm topluluk ve ekseriya sınıflandırılmış onları gör onların yer -in konut. A nüfus ağaç müstenit 54 klasik enzim damgalı yer belgili tanımlık tehlike ve keçiyolu içinde belgili tanımlık batı Asya`ya ait salkım muhtevi belgili tanımlık şimalî Caucasoids (süvari alayı resmi geçidi-Sforza et al. 1994). içinde başka nüfus ağaç, müstenit 47 klasik protein polymorphisms, belgili tanımlık Pakistani örnek biçim a küçük subcluster zarfında belgili tanımlık Indo- Frenk sözcü --dan Hindistan ( süvari alayı resmi geçidi-Sforza et al. 1994).

Belgili tanımlık Y chromosome sağlamak a yegane kaynak -in gen kanıt (Tyler- demirci 1999; Jobling ve Tyler- demirci 2000). o araba belgili tanımlık büyük nonrecombining parça içinde belgili tanımlık soykırım ve içermek birçok ahır çift damgalı, dahil temel yerine koyma (görmek, e.g., Underhill et al. 1997) ve retroposon insertions ( çekiç 1994; Santos et al. 2000), hangi -ebilmek var olmak kullanılmış içinde birleştirme ile daha- hızla gelişmek damgalı, öyle aynı derecede microsatellites (görmek, e.g., Ayub et al. 2000). sonuç olarak, çok mufassal Y phylogenies -ebilmek yapılmak adl. şu bırakmak erkek- özgül görünüş -in gen tarih -e doğru var olmak araştırmak. bunlar are güçlü müteessir yanında belgili tanımlık küçük etkili nüfus büyüklük -in belgili tanımlık Y chromosome, götürmek -e doğru hızlı gen sürükleme, ve yanında belgili tanımlık pratik -in patrilocality içinde adl toplum, götürmek -e doğru yüksek yüzey -in coğrafi ayırmak -in Y haplotypes. -e rağmen belgili tanımlık iş -in Qamar et al. (1999) üstünde belgili tanımlık çözümleme -in YAP+ chromosomes ( şâmil ~2.6% -in belgili tanımlık toplam) ve halletmek -in STR değişme miktarı (Ayub et al. 2000; Mohyuddin et al. 2001), küçük iş bkz. have be araba dışarı üstünde Pakistani Y chromosomes. bu yüzden, biz -si olmak şimdi kılınmak an geniş çözümleme -in Pakistani Y soy, -e doğru karar vermek ne ışık onlar -ebilmek dökmek üstünde belgili tanımlık başlangıç ve gen tarih -in belgili tanımlık subgroups adl. şu yapmak yukarıya belgili tanımlık Pakistani nüfus.


Maddi ve yöntem

Örnek
Belgili tanımlık Y chromosomes -in 718 unrelated erkek kul, ait 12 budunsal topluluk -in Pakistan, were çözümlemek (masa 1 ve 2; incir. 1). bilgili izin vermek was elde etmek --dan tüm katılan kişi içinde bu çalışma. An Epstein kışla virus–transformed lymphoblastoid hücre içini kaplamak was kurulu --dan her bireysel, ve DNA was hulâsa --dan bunlar hücre yan hakemi için çözümleme.


Çift Polymorphism tipik
Biz tip 15 SNPs, an Alu sokmak ( çekiç 1994; çekiç ve Horai 1995), a içini kaplamak sokmak (Santos et al. 2000), ve belgili tanımlık 12f2 silmek (Casanova et al. 1985). belgili tanımlık temel yerine koyma were: 92R7 C?T ( matematik et al. 1994); M9 C?G (Underhill et al. 1997); SRY-2627 C?T (Bianchi et al. 1997); SRY-1532 A?G?A (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) A?G (Seielstad et al. 1994); SRY-8299 G?A (Santos et al. 1999a); uygun G?A (Pandya et al. 1998); SRY +465 C?T ( incik et al. 1999); LLY22g C?A ve Tat T?C geçiş (Zerjal et al. 1997). üstelik, belgili tanımlık M17 damgalı (Underhill et al. 1997) was tip, yanında kullanma -in belgili tanımlık ilk GTGGTTGCTGGTTGTTACGT ve AGCTGACCACAAACTGATGTAGA izlemek yanında AflIII sindirim -in belgili tanımlık PCR ürün; belgili tanımlık atalara ilişkin allele was değil sindirmek belgili tanımlık M20 damgalı (Underhill et al. 1997) was genotyped, yanında kullanma -in belgili tanımlık ilk CACACAACAAGGCACCATC ve GATTGGGTGTCTTCAGTGCT izlemek yanında SspI sindirim; belgili tanımlık A?G değişme yok etmek belgili tanımlık yer vasıl durum 118 içinde belgili tanımlık 413-bp ürün. M11 (Underhill et al. 1997) was tip, istimal belgili tanımlık ilk TTCATCACAAGGAGCATAAACAA ve CCCTCCCTCTCTCCTTGTATTCTACC izlemek yanında sindirim ile MspI. belgili tanımlık 215-bp ürün was sindirmek -e doğru 193-bp ve 22-bp parça içinde belgili tanımlık müştak allele. belgili tanımlık RPS4Y C?T değişme (Bergen et al. 1999) was bulmak yanında BslI sınırlama sindirim -in a 528-bp PCR ürün elde etmek yanında kullanma -in belgili tanımlık ilk CCACAGAGATGGTGTGGGTA ve GAGTGGGAGGGACTGTGAGA. belgili tanımlık atalara ilişkin C allele içermek iki yer, ve belgili tanımlık müştak T allele içermek bir. M48 (Underhill et al. 1997), A?G, was tip yanında allele- özgül PCR istimal belgili tanımlık ayrım ilk TGACAATTAGGATTAAGAATATTATA ve TGACAATTAGGATTAAGAATATTATG ve belgili tanımlık ortak ilk AAAATTCCAAGTTTCAGTGTCACATA -e doğru oluşturmak özgül 145-bp ürün belgili tanımlık koymak -in Y çift damgalı alleles araba yanında a tek bireysel -ecek var olmak başvurmak -e doğru aynı derecede “the Y haplogroup.”
-in belgili tanımlık 718 örnek, 717 kesmek içine haplogroups beklemek üstünde belgili tanımlık temel -in belgili tanımlık malum phylogeny, ama bir keçiyolu örnek (PKH134) başaramamak -e doğru genişletmek vasıl belgili tanımlık SRY –1532 ve M17 loci. o was pay olarak vermek -e doğru haplogroup 3 üstünde belgili tanımlık temel -in seçimli SRY –1532 ilk ( tafsilât üstünde rica) ve onun STR yandan görünüş.


Y-STR tipik
Beş trinucleotide- tekrarlamak polymorphisms (DYS388, DYS392, DYS425, DYS426, ve DYS436), on tetranucleotide- tekrarlamak polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, ve DYS439) ve bir pentanucleotide microsatellite (DYS438) were tip bilcümle Y chromosomes. üç çok PCR tepki were kılınmak için tüm Y-STRs, içinde a10-µl sonda gelen tepki güç muhtevi 20 ng soykırım DNA, aynı derecede tanımlamak başka yerde (Thomas et al. 1999; Ayub et al. 2000). PCR ürün were koşmak üstünde an ABI 377 ard arda geliş. ABIGS350 TAMRA was kullanılmış aynı derecede belgili tanımlık dahili dar sokak norm. belgili tanımlık türüm ve GENOTYPER bilgisayar yazılımı paket were kullanılmış -e doğru toplamak belgili tanımlık veri ve -e doğru çözümlemek parça büyüklük Y-STR alleles were adli gör belgili tanımlık sayı -in tekrarlamak birim onlar contain.The sayı -in tekrarlamak birim was kurulu -den geçerek belgili tanımlık kullanma -in ard arda geliş bahsetme DNA örnek. Allele uzunluk için DYS389b were elde etmek yanında çıkarma -in belgili tanımlık DYS389II allele uzunluk --dan DYS389I.
Y-STR duplications were kurmak vasıl birkaç loci. DYS393 was diğerinin aynısı içinde PKH165 (13 ve 15) ve DYS437 was diğerinin aynısı içinde SDH181 (8 ve 9). A daha birçok parçadan oluşmuş numune was kurmak içinde DYS425, nereye iki -e doğru dört alleles were kurmak içinde 36 bireysel --dan haplogroups 8, 9, 13, ve 21.


Veri çözümleme
Başlıca- parça çözümleme was araba dışarı üstünde haplogroup sık sık oluş yanında kullanma -in belgili tanımlık uzak manzara ( görsel istatistik) sistem bilgisayar yazılımı, yorum 5.0.2 (genç ve bayrak 1996). için çizge temsil, belgili tanımlık ilk ve ikinci başlıca parça were arsa yanında belgili tanımlık mikroskop yazıhane maiyet çok iyi olmak paket üstünde pencere eşiği 2000. Biallelic polymorphism veri için çeşitli dünya nüfus kullanılmış içinde belgili tanımlık çözümleme were elde etmek --dan çekiç et al. (2001). karıştırma was değer biçmek yanında kullanma -in üç farklı ölçü: uzun ağırlık be. en az- dördül (WLS) ölçü ( uzun 1991); Bay, a be. en az- dördül değer biçmek (cüppe ve Hiorns 1965); ve m? (Helgason et al. 2000).

Çözümleme -in molekül karşıtlık (AMOVA) was araba dışarı yanında kullanma -in belgili tanımlık Arlequin paket (Schneider et al. 1997). AMOVA ölçü belgili tanımlık oran -in değişme divergence kurmak zarfında ve arada nüfus, anılan sıraya göre. -e karşın çok -in belgili tanımlık değişme miktarı vasıl belgili tanımlık hızla değişme microsatellite loci bkz. be beklemek -e doğru -si olmak be üretmek içinde belgili tanımlık farklı Pakistani subpopulations, belgili tanımlık yegane değişme vukuat vasıl belgili tanımlık çift loci are çok geçmiş ve -si olmak değil olay içinde belgili tanımlık bağlam -in belgili tanımlık hane -in belgili tanımlık Pakistani nüfus. biz planlamak ertesi gün strateji -e doğru olağanüstü başarı belgili tanımlık en yüksek derece miktar -in konu ile ilgili değişme bilgi --dan belgili tanımlık Y-chromosome haplotypes. STR değişme miktarı zarfında haplogroups was kullanılmış -e doğru hesaplamak nüfus pairwise FST değer için her bireysel haplogroup. beher nüfus çift, a ağırlık pinti FST was herli, nereye belgili tanımlık değer elde etmek beher haplogroup was ağırlık gör belgili tanımlık oran -in pairwise karşılaştırma karıştırmak adl. şu haplogroup. içinde belgili tanımlık uzakta olma -in a özel haplogroup --dan bir nüfus, A, -in belgili tanımlık çift A ve B, FST was koymak -e doğru 1, ve belgili tanımlık sayı -in pairwise karşılaştırma was almak aynı derecede belgili tanımlık sayı -in chromosomes infaz adl. şu haplogroup içinde B. değer -in FST müstenit STRs tek başına ya da üstünde STRs artı işareti çift damgalı, ile çift damgalı tutkucun a 10- ağıl yüksek ağırlık, were herli için karşılaştırma. bilcümle -in bunlar halletmek, belgili tanımlık mesafe matris kullanılmış koyuluk -in belgili tanımlık sayı -in merdiven yanında hangi her çift -in haplotypes fark. ocak rafı sınav için belgili tanımlık önem -in correlations arada FST değer were araba dışarı içinde Arlequin, ve multidimensional yanık (MDS) parsellemek were inşa etmek yanında kullanma -in belgili tanımlık SPSS yorum 7.0 bilgisayar yazılımı paket.

Kitle iletişim araçları- iltihak ağ were inşa etmek yanında ağ 2.0b ( şerit et al. 1999). A ağırlık entrika ile a beş- ağıl sıra was kullanılmış içinde belgili tanımlık yapılış -in belgili tanımlık ağ. belgili tanımlık ağırlık pay olarak vermek were özgül için her haplogroup ve took içine rapor belgili tanımlık Y-STR değişme miktarı karşıdan karşıya belgili tanımlık haplogroup içinde kül Pakistani nüfus. ertesi gün ağırlık were kullanılmış karşıtlık 0-0.09, ağırlık 5; karşıtlık 0.1-0.19, ağırlık 4; karşıtlık 0.2-0.49, ağırlık 3; karşıtlık 0.5-0.99, ağırlık -in 2; ve karşıtlık 1.00, ağırlık 1. -e rağmen bu, belgili tanımlık ağ için haplogroup 1 içermek adl yüksek boyut küp ve was karar vermek yanında uygulamak belgili tanımlık azaltmak kitle iletişim araçları ve kitle iletişim araçları iltihak ağ yöntem ardıl. azaltmak kitle iletişim araçları algoritma (şerit et al. 1995) was kullanılmış -e doğru oluşturmak a *.rmf eğe ve belgili tanımlık kitle iletişim araçları iltihak ağ yöntem was tatbikî -e doğru bu eğe.

BATWING (Wilson ve kel 1998), Bayesian çözümleme -in ağaç ile dahili boğum üretme, was kullanılmış -e doğru değer biçmek belgili tanımlık zaman -e doğru belgili tanımlık en yeni ortak ata (TMRCA) -in a koymak -in chromosomes. bu bilgisayar programı uses a işaret zincir ay Carlo prosedür -e doğru oluşturmak phylogenetic ağaç ve birleştirmek parameter değer sürekli olarak ile girdi veri (a koymak -in Y haplotypes) ve gen ve demografi misal belgili tanımlık gen misal gerçek saymak tek- adım değişme -in belgili tanımlık STRs ve belgili tanımlık demografi misal seçilmek was exponential büyüme --dan an ilk direşimli- büyüklük nüfus, ile ya da ezelî hane içinde farklı ishal -in belgili tanımlık bilgisayar programı tüm 16 STR loci were kullanılmış; geometrik yer- özgül değişme oran önce ihtimal müstenit belgili tanımlık veri -in Kayser et al. (Kayser et al. 2000) were inşa etmek için belgili tanımlık loci elde edilebilir aynı derecede tütsülenmiş jambon dağıtma -in belgili tanımlık biçim tütsülenmiş jambon(, b) nereye a = (1 + sayı -in değişme dikkat etmek yanında Kayser et al.), ve b = (1 + sayı -in meioses). için loci değil araştırmak yanında Kayser et al., belgili tanımlık dağıtma tütsülenmiş jambon (1,416) was kullanılmış, hangi bkz. have a pinti -in 0.0024. A üretme zaman -in 25 yıl was gerçek saymak. böylece belgili tanımlık 95% güven ara tutkucun hesaba katmak kuşku içinde değişme oran, nüfus büyüme ve ( nereye ayırmak) hane, yokluksa üretme zaman.

Den sonuçlanmak

Y-Chromosome çift Polymorphisms
Belgili tanımlık 18 çift damgalı kullanılmış tanımak 20 haplogroups içinde worldwide nüfus incir 1A), ama biricik 11 were kurmak içinde Pakistan, ve 5 rapor için 92% -in belgili tanımlık örnek ( incir. 1 ve masa 2). Haplogroups 1 ve 9 were armağan bilcümle Pakistani nüfus incelemek, haplogroup 3 was armağan bilcümle ayırmak belgili tanımlık tehlike, ve haplogroup 28 was armağan bilcümle ayırmak belgili tanımlık tehlike ve belgili tanımlık Kashmiris. Southwestern nüfus göstermek yüksek sık sık oluş -in hg 9 ve belgili tanımlık YAP+ haplogroups 21 ve 8 --dan northeastern nüfus (figs. 1D–E), ama, tulum, küçük coğrafi salkım -in haplogroup sık sık oluş bkz. be kolaylıkla görülür zarfında belgili tanımlık ülke.


Başlıca- parça çözümleme
Biz dilek -e doğru karşılaştırmak belgili tanımlık Pakistani Y haplogroup veri ile veri --dan nüfus --dan belgili tanımlık dinlenme -in belgili tanımlık dünya. hayır uygun veri koymak was elde edilebilir için belgili tanımlık bütün koymak -in 18 damgalı, ama belgili tanımlık veri -in çekiç et al. (2001) bırakmak tüm ama 5 -e doğru var olmak kullanılmış, çünkü ayni ya da phylogenetically eşdeğer damgalı were söylendiğine göre. başlıca- parça çözümleme incir 2A) göstermek biraz fark --dan belgili tanımlık orijinal çözümleme -in çekiç et al., belgili tanımlık ana boru bir varlık belgili tanımlık be. daha az ayırma -in belgili tanımlık Afrika nüfus. bu bkz. be dolay iden, a büyük uzunluk, -e doğru belgili tanımlık subset -in damgalı kullanılmış, hangi does değil katmak adl -in belgili tanımlık Afrika- özgül kendisi. en Pakistani nüfus salkım ile güney Asya`ya ait ve ortadaki şarkî nüfus, ve are kapatmak -e doğru şimalî Afrika, merkezi Asya`ya ait ve Frenk nüfus, böylece göstermek a genel benzer ile coğrafi kapatmak nüfus. belgili tanımlık bir istisna bkz. be belgili tanımlık tehlike, kim are tamamen farklı. A benzer çözümleme -in belgili tanımlık Pakistani nüfus tek başına, istimal tüm -in belgili tanımlık çift damgalı ( incir. 2B), doğrulamak belgili tanımlık fark arada belgili tanımlık tehlike ve öteki nüfus hem daha açık göstermek belgili tanımlık distinctness -in belgili tanımlık Kalash ve belgili tanımlık Parsis. o bkz. be dikkat çekici adl. şu belgili tanımlık dil isolate–speaking Burusho ve belgili tanımlık Dravidian- konuşmak Brahuis yapmak değil ayakta durmak dışarı içinde bunlar halletmek.


Karıştırma değer biçmek
Hipotez hakkında nüfus başlangıç ( masa 1) -ebilmek var olmak iyice düşünüp taşınmak aynı derecede nicel soru hakkında karıştırma. meselâ, -e doğru sınav belgili tanımlık olanak adl. şu belgili tanımlık Baluch Y chromosomes -si olmak a Suriye başlangıç, biz -ebilmek sormak ne oran -in belgili tanımlık Baluch Ys are müştak --dan Suriye ve ne oran are --dan Pakistan ( iyice düşünüp taşınmak -e doğru var olmak belgili tanımlık Pakistani örnek eksi belgili tanımlık Baluch). veri üstünde önermek kaynak nüfus were almak --dan belgili tanımlık edebiyat ve üç ölçü -in karıştırma were herli. belgili tanımlık üç değer biçmek gave geniş sürekli olarak -den sonuçlanmak, ile küçük sistemli fark tipik m? > Bay > uzun WLS için belgili tanımlık değer biçmek kalıtım --dan belgili tanımlık dış kaynak nüfus ( masa 3). bunlar -den sonuçlanmak sağlamak kanıt için an dış kalıtım -e doğru belgili tanımlık tehlike, Kalash, Arap Makrani, ve Parsis yokluksa -e doğru öteki nüfus.


Y-Chromosome STR Polymorphisms
Y-STR polymorphisms were iyice düşünülmüş -e doğru elde etmek a daha mufassal görüş -in Y değişme miktarı, ortasında belgili tanımlık farklı Pakistani budunsal topluluk, adl. şu -cekti var olmak be. daha az tarafgir yanında belgili tanımlık damgalı-ascertainment prosedür belgili tanımlık farklılık -in Y-STR haplotypes ( masa 4) was dip için belgili tanımlık tehlike (0.893) aynı derecede önermek yanında önceki halletmek (Ayub et al. 2000).
belgili tanımlık 16 Y-STRs tanımlamak 502 Y haplotypes, belgili tanımlık çok geniş çoğunluk varlık dikkat etmek içinde tek bireysel belgili tanımlık artık haplotypes were pay yanında 2–18 bireysel ( tafsilât are tutkucun içinde belgili tanımlık online- biricik ilave masa). içinde tüm hal ama bir, belgili tanımlık chromosomes pay a haplotype uygun olmak -e doğru ayni haplogroup ( bu nedenle, 503 birleştirme haplotypes) ve, içinde en hal, belgili tanımlık bireysel pay a haplotype uygun olmak -e doğru ayni nüfus (masa 5).

Belgili tanımlık GST ve modal büyüklük -in belgili tanımlık tekrarlamak birim, için tüm 16 Y-STRs incelemek içinde belgili tanımlık Pakistani nüfus, are tutkucun içinde masa 6. belgili tanımlık correlation arada damgalı heterozygosity ve GST was kurmak değil -e doğru var olmak önemli (r0.329=; P=.213). belgili tanımlık modal büyüklük ve karşıtlık -in belgili tanımlık 16 Y-STRs zarfında haplogroups 1, 2, 3, 8, 9, 10, 21, 26, ve 28 bkz. be da tutkucun içinde masa 6. kesin haplogroups -si olmak a farklı modal allele büyüklük, ve biraz örnek -in bu are göstermek içinde boldface italik yazı içinde masa 6. için örnek, DYS388 bkz. have 15 tekrarlamak içinde haplogroup 9, karşılaştırmak ile 12 tekrarlamak içinde en -in öteki haplogroups içinde Pakistan. benzer, belgili tanımlık modal allele için DYS438 bkz. be 9 içinde haplogroup 9, ama 10 ya da 11 içinde öteki haplogroups. belgili tanımlık modal allele için DYS434 için haplogroup 10 bkz. be 11, hangi bkz. be dikkat çekici farklı --dan belgili tanımlık allele büyüklük -in bu geometrik yer içinde diğer haplogroups. belgili tanımlık tam -sizlik çekmek -in değişkenlik için DYS436 içinde belgili tanımlık 233 erkek kul ait haplogroup 3 bkz. be dikkate değer. Haplogroup 10 gözükmek -e doğru -si olmak belgili tanımlık be. en az değişkenlik karşıdan karşıya en loci ayırmak için DYS390 ( masa 6). bunlar bulgu göstermek belgili tanımlık güçlü yapısal -in Y-STR değişkenlik yanında haplogroup.

Biz istemek -e doğru hesaplamak a Y- esaslı ölçü -in gen mesafe arada nüfus adl. şu -cekti yansıtmak belgili tanımlık ayırmak adl. şu bkz. have olay zarfında Pakistan ve adl. şu -cekti değil var olmak oransız egemen olmak yanında çok eski fark adl. şu bkz. have evvelce toplamak arada haplogroups. belgili tanımlık norm yol -e doğru yapmak bu -cekti var olmak -e doğru kullanma STR değişme miktarı, ve masa 7 özetlemek nüfus pairwise değer -in FST üstünde belgili tanımlık temel -in STR değişme miktarı tek başına (A) ya da -in çift- damgalı artı işareti STR değişme miktarı (B), ile çift- damgalı fark ağırlık 10 kere yüksek --dan STR fark. bunlar evlilik are dağlık correlated (r0.95=; P.001<), aynı derecede -ebilmek beklenmek --dan belgili tanımlık yapısal -in STR değişme miktarı yanında haplogroup. her nasıl, bunlar ölçü are önemli müteessir çok eski fark, ve biz -si olmak bu yüzden gelişmiş a anlam değiştirici ölçü. biz neden adl. şu çok -in belgili tanımlık STR değişme miktarı zarfında haplogroups -cekti -si olmak orijinal geçende ve -ebil var olmak kullanılmış için bu purpose.Nous avons hesaplamaké donc nominal değer çifte des vadi de nüfus de FST, sur la temel du STR değişme miktarı dans des haplogroups, et yararé une moyenne peseé de ces derniers dökmek üretmek une evlilik sade de mesafe de FST ( masa 7C ; endam 3) bunlar mesafe are da dağlık correlated ile mesafe esaslı üstünde STRs tek başına (r0.76=; P.001<) ya da üstünde STRs artı işareti çift damgalı (r0.70=; P.001<), ama a azam oran -in belgili tanımlık değişme miktarı bkz. be seen arada nüfus (22%, karşılaştırmak ile 6% ve 7%, anılan sıraya göre). A karşılaştırma -in biçim 3 ile biçim 2B ( hangi was müstenit çift damgalı sık sık oluş tek başına) açığa vurmak a dikkat çekici tulum benzerlik, ile belgili tanımlık tehlike varlık farklı --dan tüm -in öteki nüfus. öteki diğerlerinden iyi nüfus are belgili tanımlık Kalash ve Parsis (aynı derecede önce), belgili tanımlık Kashmiris (belki hasebiyle belgili tanımlık küçük örnek), ve belgili tanımlık Brahuis, kim are böylece daha farklı içinde onların STR yandan görünüş --dan haplogroup sık sık oluş. MDS parsellemek -in belgili tanımlık mesafe içinde masa 7A ve 7B (değil göstermek) götürmek -e doğru benzer son, ama benzemek biçim 2B daha yakından içinde belgili tanımlık yol adl. şu belgili tanımlık Brahuis yapmak değil ayakta durmak dışarı öylesine çok.


Kitle iletişim araçları- iltihak ağ

Belgili tanımlık gen akrabalık ortasında belgili tanımlık farklı Pakistani budunsal topluluk were keşfe çıkmak daha fazla yanında resim kitle iletişim araçları- iltihak ağ ( şerit et al. 1995), ve örnek are göstermek içinde biçim 4, 5, ve 6. belgili tanımlık haplogroup 1 ağ incir 4) açığa vurmak büyük değişme miktarı, ama da a yüksek derece -in nüfus- özgül substructure. meselâ, belgili tanımlık 24 Parsi haplogroup 1 chromosomes tüm düşmek içine bir -in üç salkım ( incir. 4, yeşil), 19 -in 26 Burusho haplogroup 1 chromosomes düşmek içine iki salkım ( mavi), ve 12 -in 14 tehlike haplogroup 1 chromosomes düşmek içine a tek salkım, ve tüm -in bunlar salkım are özgül -e doğru onların anılan sıraya göre nüfus. belgili tanımlık haplogroup 10 ağ incir 5) bkz. be çok sade, hasebiyle belgili tanımlık asgarî sayı -in chromosomes, ama bir daha açığa vurmak nüfus- özgül salkım için Burusho ve tehlike haplotypes. belgili tanımlık haplogroup 28 ağ ( incir. 6) göstermek a dikkat çekici izole Parsi- özgül salkım, vasıl belgili tanımlık son -in a uzun dal, muhtevi 15 -in 16 Parsi haplogroup 28 chromosomes. salkım -in Kalash, Burusho, and—to a be. daha az degree—Baluch chromosomes are da besbelli, -e karşın bir Baluch haplotype bkz. be pay ile Sindhi ve Makrani Baluch bireysel --dan yakın cenubî nüfus.
BATWING TMRCAs were herli için belgili tanımlık haplogroup 28 ağ ve için seçme soy zarfında a sayı -in haplogroups. belgili tanımlık -den sonuçlanmak are özetlemek içinde masa 8.

Müzakere

Biz -si olmak araba dışarı belgili tanımlık ilk geniş çözümleme -in Y farklılık zarfında Pakistan, examining 34 damgalı içinde 718 erkek kul --dan 12 nüfus bu bırakmak bizi -e doğru karşılaştırmak Pakistani Y farklılık ile adl. şu evvelce söylendiğine göre içinde dünya nüfus, -e doğru araştırmak fark zarfında Pakistan, ve -e doğru değer biçmek biraz -in belgili tanımlık önermek nüfus tarihçi --dan a Y perspektif.


Karşılaştırma ile Worldwide veri
Içinde a worldwide karşılaştırma, Pakistani nüfus ekseriya salkım çevrede a havuz güney Asya`ya ait örnek ve yatmak kapatmak -e doğru a ortadaki şarkî örnek ( incir. 2A). bu bulgu bkz. be unsurprising, içinde bölüm çünkü belgili tanımlık güney Asya`ya ait örnek dahil 62 Pakistani bireysel (i.e., 32% -in 196 toplam) ve içinde bölüm çünkü Y değişme miktarı içinde adl alan -in belgili tanımlık dünya bkz. be üstün yapı yanında coğrafya, değil yanında dil ya da budunsal birleştirmek (Rosser et al. 2000; Zerjal et al. 2001). belgili tanımlık azam gen benzer -in Pakistani nüfus -e doğru o içinde belgili tanımlık batı --dan -e doğru şarkî nüfus bkz. be resimli yanında belgili tanımlık gerçek adl. şu dört -in belgili tanımlık beş yaygın haplogroups içinde Pakistan (haplogroups 1, 2, 3, ve 9, hangi biraraya yapmak yukarıya 79% -in belgili tanımlık toplam nüfus) are da yaygın içinde batı Asya ve garp yokluksa içinde çini ya da Japonya; konuşmak, belgili tanımlık haplogroups adl. şu are yaygın içinde doğu Asya (e.g., 4, 5, 10, 13, ve 20) are nadir ya da yok içinde Pakistan, biçim biricik 2.5% -in belgili tanımlık toplam eğer, aynı derecede içinde biraz yorum, an erken exodus --dan Afrika ileri belgili tanımlık cenubî kıyı -in Asya led -e doğru belgili tanımlık ilk anatomically Rumca insana ilişkin nüfus içinde Pakistan, ve bunlar insanlar araba belgili tanımlık şarkî haplogroups ya da onların precursors, onların Y chromosomes -si olmak şimdi be ziyadesiyle eski yerine koymak yanında sonradan ortaya çıkan göç ya da gen akmak; gerçekten, belgili tanımlık temsil eden -in belgili tanımlık şarkî haplogroups içinde Pakistan -ebilmek var olmak müştak --dan Rumca sırt- göç, değil --dan çok eski ölümden dönen kimse.
belgili tanımlık beşinci haplogroup adl. şu bkz. be ortak içinde Pakistan, haplogroup 28, farklı olmak --dan tüm belgili tanımlık diğer içinde onun dağıtma. zarfında Pakistan, o -den yapılmış yukarıya 14% -in bizim örnek ve was armağan bilcümle ama iki nüfus ( her ikisi -in hangi bkz. have minimini örnek büyüklük), öylesine o bkz. be her ikisi ortak ve yaygın dış Pakistan ve belgili tanımlık yakın ülke, her nasıl, o bkz. be nadir. o bkz. have be söylendiğine göre içinde Hindistan (30%; armağan içinde 3/3 nüfus), Tajikistan (10%; armağan içinde 5/6 nüfus), ve Uzbekistan (3%; armağan içinde 10/13 nüfus), ama o bkz. be nadir içinde Rusya (0.4%; armağan içinde 1/6 nüfus) ve belgili tanımlık Kafkas (1.4%; armağan içinde 1/6 nüfus (su kuyusu et al. 2001) ve bkz. have değil be kurmak vasıl tüm içinde çini ya da mongol (unpublished inceleme BATWING değer biçmek -in belgili tanımlık TMRCA -in belgili tanımlık Pakistani haplogroup 28 chromosomes were ~7,000 (4,000–14,000) yıl ( masa 8). böylece, zarfında bu zaman dönem, belgili tanımlık Pakistani nüfus -si olmak dalgıç --dan a ortak atalara ilişkin nüfus ya da -si olmak tecrübeli büyük erkek gen akmak arada kendileri ya da --dan a ortak kaynak. ondan beri belgili tanımlık değer biçmek yaş uymak -e doğru belgili tanımlık erken Neolithic dönem, belgili tanımlık yaymak -in bu soy -ebilmek var olmak birleştirmek ile belgili tanımlık yerel genişleme -in çiftçi.


Karşılaştırma zarfında Pakistan
Haplogroup dağıtma içinde Pakistani nüfus, ile belgili tanımlık istisna -in belgili tanımlık tehlike ( ele almak içinde belgili tanımlık en yakın parça), are dikkat çekici benzer -e doğru biraz birini (figs. 1 ve 2), -e rağmen biraz dikkate değer dilbilimsel fark. gerçekten, belgili tanımlık dil ayırmak- konuşmak Burusho, belgili tanımlık Dravidian- konuşmak Brahuis, ve belgili tanımlık Sino-Tibetan–speaking Baltis did değil ayakta durmak dışarı --dan öteki nüfus vasıl tüm içinde belgili tanımlık haplogroup halletmek ( masa 2 ve incir. 2), telkin ikisinden biri adl. şu belgili tanımlık dilbilimsel fark arose -den sonra belgili tanımlık ortak Y numune was kurulu ya da adl. şu orada bkz. have be yeterli Y gen akmak arada nüfus -e doğru elemek birisi ilk fark henüz a daha mufassal çözümleme -in belgili tanımlık Y haplotypes (e.g., figs. 3–6) açığa vurmak biraz farklı şekil -in belgili tanımlık Brahui ve büyük nüfus özgül; nüfus- özgül salkım -in ilgili haplotypes are ortak kurmak içinde bunlar ağ öyle salkım -ecek biricik var olmak seen eğer nüfus are izole --dan biraz birini. o -ebilmek var olmak adl. şu a alçak derece -in gen akmak arada nüfus yere a uzun zaman bkz. be yeterli -e doğru -den sonuçlanmak içinde benzer haplogroup sık sık oluş ezelî istihsal adl pay salkım.
nüfus- özgül salkım -in haplotypes are özellikle besbelli içinde biraz nüfus. içinde belgili tanımlık tehlike, nereye belgili tanımlık farklı haplogroup sık sık oluş ünlü yukarıda are kurmak, en chromosomes (19/23; 83%) düşmek içine bir -in adil iki su kuyusu- izole salkım (figs. 4 ve 5), oysaki belgili tanımlık Parsis, belgili tanımlık Kalash, ve belgili tanımlık Burusho da göstermek çıkık salkım. belgili tanımlık tehlike, Parsis, ve Kalash were belgili tanımlık üç nüfus göstermek belgili tanımlık en önemli farklı nüfus pairwise FST değer. belgili tanımlık yüksek değer -in belgili tanımlık tehlike ve Parsis -ebilmek kısmen var olmak rapor için yanında göç -e doğru Pakistan --dan diğer yer, ama a kalıtım amil bkz. be beğenmek -e doğru var olmak sürükleme, ikisinden biri hak edilen -e doğru a mahdut sayı -in esaslı soy ya da olay sonradan ortaya çıkan zarfında küçük nüfus. Tk değer (Ewens 1972) sağlamak a yol -in karşılaştırma etkili nüfus büyüklük. değer müstenit belgili tanımlık STRs için belgili tanımlık tehlike, Parsis, Kalash, ve Burushos were 8.9, 77.5, 25.8, ve 74.2, anılan sıraya göre, karşılaştırmak ile a pinti -in 181.8 için öteki nüfus ile örnek büyüklük >20. etkili nüfus büyüklük için Y chromosomes -ebilmek farklı olmak büyük --dan nüfus sayımı nüfus büyüklük, ama o bkz. be dikkate değer adl. şu belgili tanımlık Parsis ve Kalash yapmak -si olmak belgili tanımlık asgarî nüfus sayımı büyüklük, bir- yüz ya da bir- bin -in en -in o -in öteki nüfus (masa 1), öylesine bunlar küçük nüfus sayımı büyüklük -ebilmek -si olmak be paraca desteklemek için a uzun zaman. içinde özet, adl şekil -in şimdiki Pakistani Y haplotype dağıtma -ebilmek var olmak rapor için yanında a pay atalara ilişkin gen havuz, ile mahdut gen akmak arada nüfus ve sürükleme içinde belgili tanımlık asgarî kendisi.


Kavrama içine nüfus başlangıç
belgili tanımlık önermek nüfus başlangıç ( masa 1) -ebilmek şimdi var olmak iyice düşünüp taşınmak içinde belgili tanımlık ışık -in bunlar Y -den sonuçlanmak. bilgi bkz. be sağlamak yanında haplogroup sık sık oluş, hangi -ebilmek var olmak kullanılmış -e doğru üretmek karıştırma değer biçmek, ve bunlar are basit -e doğru çevirmenlik yapmak eğer nüfus are büyük ve izole ve belgili tanımlık kaynak nüfus -si olmak farklı sık sık oluş. ne zaman bunlar durum are değil met, belgili tanımlık hazır bulunma -in farklı Y soy -ebilmek hareketsiz var olmak bilgi verici belgili tanımlık başlangıç -in belgili tanımlık Parsis are su kuyusu- belge (Nanavutty 1997) ve böylece sağlamak a yararlı sınav hal. onlar are izlemek -in belgili tanımlık Iranian yalvaç Zoroaster, kim göç -e doğru Hindistan -den sonra belgili tanımlık çökmek -in belgili tanımlık Sassanian imparatorluk içinde belgili tanımlık 7th yüzyıl a.d. onlar sabit içinde 900 a.d. içinde Gujarat, Hindistan, nereye onlar were seslenmek belgili tanımlık “Parsi” ( meal “from Iran”). sonunda onlar hareket ettirmek -e doğru mırıldanmak içinde Hindistan ve karate içinde Pakistan, nereden şimdiki nüfus was örnek ( incir. 7). onların sık sık oluş için haplogroups 3 (8%) ve 9 (39%) yapmak gerçekten benzemek o içinde Iran daha --dan o -in onların şimdiki komşu içinde Pakistan. onlar göstermek belgili tanımlık dip sık sık oluş için haplogroup 3 içinde Pakistan (ayrı --dan belgili tanımlık tehlike; incir 1C). belgili tanımlık pinti için sekiz Iranian nüfus was 14% (n401=) (Quintana-Murci et al. 2001), oysaki adl. şu için Pakistan, hariç belgili tanımlık Parsis, was 36%. uymak biçim için haplogroup 9 were 39% içinde belgili tanımlık Parsis, 40% içinde Iran, ve 15% içinde Pakistan hariç belgili tanımlık Parsis. bunlar biçim götürmek -e doğru an karıştırma değer biçmek -in 100% --dan Iran ( masa 3). tutkucun belgili tanımlık küçük etkili nüfus büyüklük -in belgili tanımlık Parsis, belgili tanımlık closeness -in onların eş -e doğru belgili tanımlık Iranian veri -ebilmek var olmak rastlantısal, ve belgili tanımlık hazır bulunma -in haplogroup 28 chromosomes vasıl 18% (4% içinde Iran; su kuyusu et al. 2001) önermek biraz gen akmak --dan belgili tanımlık muhit nüfus belgili tanımlık TMRCA için belgili tanımlık Parsi- özgül salkım içinde belgili tanımlık haplogroup 28 ağ was 1,800 (600–4,500) yıl (masa 8), sürekli olarak ile belgili tanımlık göç -in a küçük sayı -in soy --dan Iran. tulum, bunlar -den sonuçlanmak göstermek a kapatmak eş arada belgili tanımlık tarihsel yazmak ve belgili tanımlık Y veri, ve böylece önermek adl. şu belgili tanımlık Y veri -ecek yaramak ne zaman be. daha az tarihsel bilgi bkz. be elde edilebilir.
belgili tanımlık nüfus yani genetically en farklı, belgili tanımlık tehlike, alacak iniş --dan Genghis han ordu; onların ad bkz. be müştak --dan belgili tanımlık İranlı kelime “hazar,” meal “thousand,” çünkü küme were sol arkaya içinde ayırma -in a bin. bkz. towards belgili tanımlık son -in belgili tanımlık 19th yüzyıl, biraz tehlike hareket ettirmek --dan Afghanistan -e doğru belgili tanımlık Khurram vadi içinde Pakistan, belgili tanımlık kaynak -in belgili tanımlık örnek araştırmak burada böylece, onların sözel tarih identifies an başlangıç içinde mongol ve nüfus dar geçit ~800 ve ~100 yıl önce. -in belgili tanımlık iki üstün Y haplogroups armağan içinde bu nüfus, haplogroup 1 bkz. be yaygın içinde Pakistan, çok -in Asya, garp, ve belgili tanımlık Amerika, vesaire sağlamak küçük vukuf belgili tanımlık menşe. Haplogroup 10, içinde karşıtlık, bkz. be nadir içinde en Pakistani nüfus (1.4%, ne zaman belgili tanımlık tehlike are müstesna) ama bkz. be ortak içinde doğu Asya, dahil mongol, nereye o geçici yukarıya yere yarı -in belgili tanımlık nüfus (unpublished -den sonuçlanmak). karıştırma değer biçmek ( masa 3) are sürekli olarak ile a katı kalıtım --dan mongol. BATWING çözümleme -in belgili tanımlık tehlike- özgül haplotype salkım içinde haplogroups 1 ve 10 önermek TMRCAs -in 400 (120–1,200) ve 100 (6–600) yıl ( masa 8), anılan sıraya göre böylece, belgili tanımlık gen kanıt bkz. be sürekli olarak ile belgili tanımlık sözel gelenek ve, içinde görüş -in onun bağımsız tabiat, sağlamak güçlü çekmek için o ( incir. 7).

biraz diğer önermek başlangıç almak daha mahdut çekmek --dan belgili tanımlık Y veri. belgili tanımlık Arap Makrani, ile a gerçek olarak kabul etmek başlangıç içinde Afrika, taşımak belgili tanımlık yüksek sık sık oluş -in haplogroup 8 chromosomes kurmak içinde birisi Pakistani nüfus, aynı derecede ünlü başka yerde (Qamar et al. 1999). bu haplogroup bkz. be ziyadesiyle kapatmak -e doğru üye aidatı-Saharan Afrika, nereye o oluşturmak hakkında yarı -in belgili tanımlık nüfus (çekiç et al. 2001) ve -ebilmek böylece var olmak bakmak aynı derecede a damgalı -in Afrika Y chromosomes. bununla birlikte, o geçici yukarıya biricik 9% -in belgili tanımlık Arap Makrani örnek, ve haplogroup 28 (ileri ile diğer tipik Pakistani haplogroups) bkz. be armağan içinde bu nüfus. eğer belgili tanımlık Y chromosomes were ilk Afrika ( incir. 7), en -si olmak sonradan ortaya çıkan be eski yerine koymak: belgili tanımlık tulum değer biçmek -in belgili tanımlık Afrika kalıtım bkz. be ~12% ( masa 3).

belgili tanımlık Balti are düşünüş -e doğru -si olmak orijinal içinde Tibet, nereye belgili tanımlık üstün haplogroups are 4 ve 26. hiçbiri was armağan içinde belgili tanımlık örnek --dan bu çalışma, -mek şartıyla hayır çekmek için a Tibetan başlangıç -in belgili tanımlık Y chromosome soy ve an karıştırma değer biçmek -in sıfır ( masa 3). her nasıl, bu -den sonuçlanmak -meli var olmak tercüman ile uyarı, hasebiyle belgili tanımlık küçük örnek büyüklük. üç nüfus -si olmak olanaklı başlangıç --dan belgili tanımlık armies -in Alexander belgili tanımlık büyük: belgili tanımlık Burusho, belgili tanımlık Kalash, ve belgili tanımlık keçiyolu. Rumca Yunanca göstermek a orta yüksek sık sık oluş -in haplogroup 21 (28%; Rosser et al. 2000), ama bu haplogroup was değil seen içinde ikisinden biri belgili tanımlık Burusho ya da belgili tanımlık Kalash örnek ve was kurmak içinde biricik 2% -in belgili tanımlık keçiyolu, oysaki belgili tanımlık yerel haplogroup 28 was armağan vasıl 17%, 25%, ve 13%, anılan sıraya göre. Yunanca- karıştırma değer biçmek -in 0% were elde etmek için belgili tanımlık Burusho ve belgili tanımlık keçiyolu, ama biçim -in 20–40%% were dikkat etmek için belgili tanımlık Kalash ( masa 3). içinde görüş -in belgili tanımlık uzakta olma -in haplogroup 21, biz atfetmek bu -den sonuçlanmak ikisinden biri -e doğru sürükleme içinde belgili tanımlık sık sık oluş -in öteki haplogroups, özellikle haplogroups 2 ve 1, ya da -e doğru belgili tanımlık yoksul kararlılık -in soy zarfında bunlar haplogroups, hâsıl içinde farklı soy varlık sınıflandırılmış içine ayni paraphyletic haplogroups. tulum, hayır çekmek için a Yunanca başlangıç -in onların Y chromosomes was kurmak, ama bu son does istemek belgili tanımlık üzerine alma adl. şu Rumca Yunanca are temsil eden -in Alexander’s armies. iki nüfus, belgili tanımlık Kashmiris ve belgili tanımlık keçiyolu, da yaymak hak talep etmek -e doğru a olanaklı Musevî başlangıç Musevî nüfus ortak -si olmak a orta sık sık oluş -in haplogroup 21 (e.g., 20%) ve a yüksek sık sık oluş -in haplogroup 9 (e.g., 36%; (çekiç et al. 2000). belgili tanımlık sık sık oluş -in her ikisi -in bunlar haplogroups are alçak içinde belgili tanımlık Kashmiris ve keçiyolu, ve haplogroup 28 bkz. be armağan vasıl 13% içinde belgili tanımlık keçiyolu, öylesine hayır çekmek için a Musevî başlangıç bkz. be kurmak, ve belgili tanımlık karıştırma değer biçmek was 0% ( masa 3), -e karşın, bir daha, bu son bkz. be mahdut her ikisi yanında belgili tanımlık küçük örnek büyüklük elde edilebilir --dan Kashmir ve yanında belgili tanımlık üzerine alma adl. şu belgili tanımlık Rumca örnek are temsil eden -in çok eski nüfus.

belgili tanımlık önermek başlangıç -in belgili tanımlık Baluch bkz. be içinde Suriye. Suriye, beğenmek Iranians, are tipik yanında a alçak sık sık oluş -in haplogroup 3 ve a yüksek sık sık oluş -in haplogroup 9 (9% ve 57%, anılan sıraya göre; çekiç et al. 2000), oysaki belgili tanımlık uymak sık sık oluş içinde belgili tanımlık Baluch are 29% ve 12%. bu fark ve belgili tanımlık yüksek sık sık oluş -in haplogroup 28 içinde belgili tanımlık Baluch (29%) yapmak a üstün Suriye başlangıç için onların Y chromosome muhtemel olmayan, ve belgili tanımlık karıştırma değer biçmek was 0% (masa 3), -e karşın belgili tanımlık 8% sık sık oluş için haplogroup 21, belgili tanımlık yüksek identified içinde Pakistan böylece uzakta, does göstermek biraz batı kalıtım -e doğru onların Y soy. Brahuis -si olmak a olanaklı başlangıç içinde batı Asya (Hughes- kurşun 1991) ve o bkz. have be önermek adl. şu a yaymak -in haplogroup 9 Y chromosomes was birleştirmek ile belgili tanımlık genişleme -in Dravidian- konuşmak çiftçi (Quintana-Murci et al. 2001). Brahuis -si olmak belgili tanımlık yüksek sık sık oluş -in haplogroup 9 chromosomes içinde Pakistan (28%) -den sonra belgili tanımlık Parsis, -mek şartıyla biraz çekmek için bu hipotez, ama onların yüksek sık sık oluş -in haplogroup 3 (39%) bkz. be değil tipik -in belgili tanımlık verimli hilal (Quintana-Murci et al. 2001) ve önermek a daha birçok parçadan oluşmuş başlangıç, belki ile karıştırma --dan sonradan göç, öyle aynı derecede o -in Indo-Iranian sözcü --dan belgili tanımlık bozkır -in merkezi Asya ve diğer --dan daha fazla doğu bu olanak bkz. be taraftar yanında belgili tanımlık hafiye -in alçak sık sık oluş -in haplogroups 10, 12, ve 13 içinde belgili tanımlık Brahuis, tüm nadir içinde Pakistan ve tipik -in doğu Asya, doğu ve şimalî Asya, ve güneydoğu Asya, anılan sıraya göre.

belgili tanımlık muvaffakiyetsizlik -e doğru bulmak a Y bağlantı ile a önermek nüfus -in başlangıç does değil yanlış olduğunu kanıtlamak a tarihsel kurum, ama o does göstermek adl. şu belgili tanımlık Y chromosomes müştak --dan öyle tarihsel vukuat -si olmak be kayıp ya da eski yerine koymak. halletmek -in mitochondrial DNA ve diğer loci -cekti yardım etmek -e doğru elucidate belgili tanımlık nüfus tarihçi ve -cekti var olmak özellikle ilginç içinde nüfus beğenmek belgili tanımlık Arap Makrani ve belgili tanımlık Balti, içinde hangi var a karşıtlık arada belgili tanımlık phenotype ve belgili tanımlık tipik Pakistani Y haplotypes.

Onay

bu iş was taraftar yanında a Wellcome güven işbirliği araştırma ilk adım vermek -e doğru S.Q.M. T.Z. was da taraftar yanında belgili tanımlık Wellcome güven, ve C.T.-S. yanında belgili tanımlık Yengeç Burcu araştırma kampanya. biz açık bizim değerlendirme -e doğru belgili tanımlık orijinal DNA bağışta bulunan kimse kim -den yapılmış bu çalışma olanaklı. belgili tanımlık kısım -in sağlık -in belgili tanımlık yönetme -in Baluchistan ve belgili tanımlık Baluch öğrenci federasyon, Quetta, Pakistan, yardım etmek içinde belgili tanımlık toplama -in belgili tanımlık Brahui ve Baluch örnek. keçiyolu örnek were kendine hakim ile belgili tanımlık yardım -in belgili tanımlık kısım -in Paediatrics, hanımefendi gönüllülük posta üniversite mezunu tıbbi hastane, Peshawar, Pakistan. biz are da minettar -e doğru Dr. I. Kazmi ve belgili tanımlık Aga han kuruluş kırsal sağlık çekmek bilgisayar programı için onların yardım içinde belgili tanımlık toplama -in Burusho örnek. Dr. F. Sethna sağlamak değerli yardım içinde belgili tanımlık toplama -in belgili tanımlık Parsi örnek. biz ham dolsun Luis Quintana-Murci için onun yorum üstünde belgili tanımlık yazma.


Elektronik-Database bilgi

URLs için veri içinde bu eşya are aynı derecede izlemek:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ ağ 2.0, http:/www.fluxus-engineering.com/.
/ uzak manzara, http:/forrest.psych.unc.edu/.
/
Bahsetme

Ahmad AKN (1952) Isa içinde cennet üstünde yerküre. belgili tanımlık sivil ve askerler gözünü dikerek bakmak Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin A, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- demirci C (2000) tanıma ve characterisation -in roman insana ilişkin Y-chromosomal microsatellites --dan ard arda geliş database bilgi. nükleer asit Res 28e8: [ özgür dolu metin içinde PMC].
Backstrom PC (1992) Balti. içinde Backstrom PC, Radloff CF (eds) Sociolinguistic bakmak -in şimalî Pakistan. Vol 2, dil -in şimalî alan ulusal enstitü -in Pakistan iyice düşünülmüş, Islamabad, pp 3–27.
şerit HJ, bırakmak P, Rohl A (1999) kitle iletişim araçları- iltihak ağ için inferring intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ özgür dolu metin].
şerit HJ, bırakmak P, Sykes BC, Richards MB (1995) Mitochondrial insan resmi -in insana ilişkin nüfus istimal kitle iletişim araçları ağ. Genetics 141743–753: [PubMed] [ özgür dolu metin].
çan HW (1979) belgili tanımlık yarış -in Afghanistan. umutlu-e-Meel neşriyat, Lahore, Pakistan.
çan HW (1998) An soruşturma içine belgili tanımlık ethnography -in Afghanistan. öncü kitap, Lahore, Pakistan.
Bergen AW, Wang C-Y, Tsai J, Jefferson K, Dey C, demirci KD, park S-C, Tsai S-J, altın D (1999) An Asian–Native Amerikalı babayla ilgili soy identified yanında RPS4Y resequencing ve yanında microsatellite haplotyping. Ann uğuldamak gen 6363–80: [PubMed] [dolu metin].
Bianchi hayır, Bailliet G, budalaca cesaret CM, cinsel RF, Rothhammer F, kırlangıç-Marignac VL, cezai SD (1997) başlangıç -in Amerindian Y-chromosomes aynı derecede sonucunu çıkarmak yanında belgili tanımlık çözümleme -in altı polymorphic damgalı. Am J fiziksel Anthropol 10279–89: [PubMed] [ dolu metin].
Biddulph J (1977) kabile -in belgili tanımlık arka Koosh. -e ikna etmek neşriyat, karate, Pakistan.
Burton RF (1851) Sindh ve belgili tanımlık yarış adl. şu iskân belgili tanımlık vadi -in belgili tanımlık -e ikna etmek. WH Allen ve Co Ltd, Londra.
Noel şarkısı O (1958) belgili tanımlık keçiyolu. Oxford üniversite sıkıştırma, karate, Pakistan.
Casanova M, Leroy P, Boucekkine C, Weissenbach J, piskopos C, adam M, Purrello M, Fiori G, Siniscalco M (1985) A insana ilişkin Y- halkalı DNA polymorphism ve onun potansiyel için kanı gen ve evrim mesafe bilim 2301403–1406: [PubMed].
süvari alayı resmi geçidi-Sforza LL, Menozzi P, Piazza A (1994) belgili tanımlık tarih ve coğrafya -in insana ilişkin türüm. prens üniversite sıkıştırma, prens.
vadi GF (1991) belgili tanımlık olay -in belgili tanımlık -e ikna etmek uygarlık. içinde Jansen M, baharatla kaynatmak M, kent ile ilgili G (eds) Forgotten vatandaş üstünde belgili tanımlık -e ikna etmek: erken uygarlık içinde Pakistan --dan belgili tanımlık 8th -e doğru belgili tanımlık 2nd millennia BC. Verlag Philipp von Zabern, ana boru, Almanya, pp 129–144.
güverte KD (1992) Sociolinguistic bakmak -in şimalî Pakistan. Vol 5, dil -in küçük çocuk. ulusal enstitü -in Pakistan iyice düşünülmüş, Islamabad.
Ewens WJ (1972) belgili tanımlık örnek teori -in selectively yansız alleles. Theor halk Biol 387–112: [PubMed].
sert BF (1992) Ethnologue: dil -in belgili tanımlık dünya. yaz enstitü -in dilbilim, Dallas.
çekiç MF (1994) A yeni sokmak -in an Alu öge üstünde belgili tanımlık Y chromosome bkz. be a yararlı damgalı için insana ilişkin nüfus iyice düşünülmüş. Mol Biol Evol 11749–761: [PubMed] [özgür dolu metin].
çekiç MF, Horai S (1995) Y chromosomal DNA değişme miktarı ve belgili tanımlık insanlar -in Japonya. Am J uğuldamak gen 56951–962: [PubMed].
çekiç MF, karate TM, Redd AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarchical numune -in geniş çaplı insana ilişkin Y-chromosome farklılık Mol Biol Evol 181189–1203: [PubMed] [ özgür dolu metin].
çekiç MF, Redd AJ, odun ET, kaporta Bay, Jarjanazi H, karate T, Santachiara-Benerecetti S, Oppenheim A, Jobling anne, Jenkins T, devekuşu H, kaporta-Tamir B (2000) Musevî ve ortadaki şarkî non- Musevî nüfus pay a ortak havuz -in Y-chromosome biallelic haplotypes. Proc Natl akademik Sci USA 976769–6774: [ özgür dolu metin içinde PMC].
Helgason A, Sigurdardottir S, Nicholson J, Sykes B, tepe EW, Bradley DG, Bosnes V, Gulcher JR, semt R, Stefansson K (2000) kanı İskandinavyalı ve Gaelic soy içinde belgili tanımlık erkek -de koloniler kurmak -in Islandı. Am J uğuldamak gen 67697–717: [PubMed] [ özgür dolu metin].
Hughes- kurşun R (1991) imparator ile ilgili gazetteer -in Hindistan: taşralı sıra, Baluchistan. umutlu-e-Meel, Lahore, Pakistan.
edepsiz J (1997) A tarih -in belgili tanımlık insanlar -in Pakistan akşamüstü bağımsızlık. Oxford üniversite sıkıştırma, karate, Pakistan.
Ibbetson D (1883) Panjab fırlatmak umutlu-e-Meel, Lahore, Pakistan.
Jarrige JF (1991) Mehrgarh: onun yer içinde belgili tanımlık gelişme -in çok eski kültür içinde Pakistan. içinde Jansen M, baharatla kaynatmak M, kent ile ilgili G (eds) Forgotten vatandaş üstünde belgili tanımlık -e ikna etmek: erken uygarlık içinde Pakistan --dan belgili tanımlık 8th -e doğru belgili tanımlık 2nd millennia BC. Verlag Philipp von Zabern, ana boru, Almanya, pp 34–50.
Jobling anne, Tyler- demirci C (2000) yeni uses için yeni haplotypes: belgili tanımlık insana ilişkin Y chromosome, hastalık ve seçme eğilim gen 16356–362: [PubMed] [ dolu metin].
karate TM, Zegura SL, Posukh O, Osipova L, Bergen A, uzun J, altın D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffiths RC, tapınak AR, çekiç MF (1999) atalara ilişkin Asya`ya ait kaynak() -in yeni dünya Y-chromosome esaslı haplotypes. Am J uğuldamak gen 64817–831: [PubMed] [özgür dolu metin].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila A (2000) tipik ve sık sık oluş -in germline değişme vasıl microsatellite loci --dan belgili tanımlık insana ilişkin Y chromosome, aynı derecede kâşif yanında yolu tarif etmek inceleme içinde baba/ oğul çift. Am J uğuldamak gen 661580–1588: [PubMed] [ özgür dolu metin].
Kwok C, Tyler- demirci C, Mendonca BB, Hughes I, Berkovitz GD, Goodfellow PN, doğan JR (1996) değişme çözümleme -in belgili tanımlık 2 kb 5' -e doğru SRY içinde XY dişi ve XY gömmek kul J Med gen 33465–468: [PubMed].
uzun JC (1991) belgili tanımlık gen yapı -in karışmak nüfus. Genetics 127417–428: [PubMed] [özgür dolu metin].
matematik N, Bayes M, Tyler- demirci C (1994) dağlık bilgi verici katmak haplotypes için belgili tanımlık insana ilişkin Y chromosome. uğuldamak Mol gen 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, konak A, Ismail M, çekiç MF, Underhill baba, süvari alayı resmi geçidi-Sforza LL (1999) belgili tanımlık başlangıç -in Pakistani nüfus kanıt --dan Y chromosome damgalı. içinde Papiha SS, Deka R, Chakraborty R (eds) soykırım farklılık: kullanma içinde insana ilişkin nüfus genetics. Kluwer akademik/ tam naşir, yeni York, pp 83–90.
Mohyuddin A, Ayub Q, Qamar R, Zerjal T, Helgason A, Mehdi SQ, Tyler- demirci C (2001) Y-chromosomal STR haplotypes içinde Pakistani nüfus mahkemeye ait Sci Int 118141–146: [PubMed] [dolu metin].
Nanavutty P (1997) belgili tanımlık Parsis. ulusal kitap güven, yeni Delhi, Hindistan.
Pandya A, kral TE, Santos FR, Taylor PG, Thangaraj K, söylemek L, Jobling anne, Tyler- demirci C (1998) A polymorphic insana ilişkin Y-chromosomal G -e doğru A geçiş kurmak içinde Hindistan. Ind J uğuldamak gen 452–61:.
Qamar R, Ayub Q, Khaliq S, konak A, karate T, Mehdi SQ, çekiç MF (1999) Afrika ve Levanten başlangıç -in Pakistani YAP+ Y chromosomes. uğuldamak Biol 71745–755: [PubMed].
Quddus SA (1990) belgili tanımlık kabile Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, çekiç MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin A, Radhakrishna U, Jobling anne, Tyler- demirci C, McElreavey K (2001) Y-chromosome soy izini sürmek yayma -in insanlar ve dil içinde southwestern Asya. Am J uğuldamak gen 68537–542: [PubMed] [özgür dolu metin].
cüppe DF, Hiorns R (1965) yöntem -in çözümleme -in belgili tanımlık gen beste -in a hybrid nüfus. uğuldamak Biol 3738–43:.
Robertson GS (1896) belgili tanımlık Kafirs -in belgili tanımlık Hinduizm dininden olan kimse-Kush. Oxford üniversite sıkıştırma, karate, Pakistan.
Rosser ZH, Zerjal T, fırlatmak beni, Adojaan M, Alavantic D, ahlak dışı A, Amos W, et al (2000) Y-chromosomal farklılık içinde garp bkz. be yapışmak ve müteessir herşeyden önce yanında coğrafya, tercihan --dan yanında dil. Am J uğuldamak gen 671526–1543: [PubMed] [ özgür dolu metin].
Santos FR, Carvalho- gümüş DR, cezai SDJ (1999a) PCR- esaslı DNA yandan görünüş -in insana ilişkin Y chromosomes. içinde Epplen JT, Lubjuhn T (eds) yöntem ve alet içinde biosciences ve ilaç. Birkhauser Verlag, esassız, İsviçre, pp 133–152.
Santos FR, Pandya A, Kayser M, Mitchell RJ, Liu A, söylemek L, yok etmek- bizon G, Novelletto A, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- demirci C (2000) A polymorphic L1 retroposon sokmak içinde belgili tanımlık centromere -in belgili tanımlık insana ilişkin Y chromosome. uğuldamak Mol gen 9421–430: [PubMed] [ özgür dolu metin].
Santos FR, Pandya A, Tyler- demirci C, cezai SD, Schanfield M, Leonard WR, Osipova L, Crawford MH, Mitchell RJ (1999b) belgili tanımlık merkezi Siberian başlangıç için yerli Amerikalı Y chromosomes. Am J uğuldamak gen 64619–628: [PubMed] [ özgür dolu metin].
Schneider S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: a bilgisayar yazılımı için nüfus gen veri çözümleme Genetics ve Biometry laboratuvar, üniversite -in gen, İsviçre.
Seielstad MT, Hebert JM, Lin AA, Underhill baba, Ibrahim M, Vollrath D, süvari alayı resmi geçidi-Sforza LL (1994) yapılış -in insana ilişkin Y-chromosomal haplotypes istimal a yeni polymorphic A -e doğru G geçiş. uğuldamak Mol gen 32159–1261: [PubMed].
incik T, Tomita K, bugün T, Kotliarova SE, Lee J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) gen değişme miktarı üstünde belgili tanımlık Y chromosome içinde belgili tanımlık Japonca nüfus ve bulaştırma için Rumca insana ilişkin Y chromosome soy. J uğuldamak gen 44240–245: [PubMed].
Thomas MG, Bradman N, geri çekilmek HM (1999) yüksek -den geçerek çözümleme -in 10 microsatellite ve 11 diallelic polymorphisms üstünde belgili tanımlık insana ilişkin Y-chromosome. uğuldamak gen 105577–581: [PubMed] [dolu metin].
Tyler- demirci C (1999) Y-chromosomal DNA damgalı. içinde Papiha SS, Deka R, Chakraborty R (eds) soykırım farklılık: kullanma içinde insana ilişkin nüfus genetics. Kluwer akademik/ tam naşir, yeni York, pp 65–73.
Underhill baba, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, Davis RW, süvari alayı resmi geçidi-Sforza LL, Oefner PJ (1997) hafiye -in birçok Y chromosome biallelic polymorphisms yanında denaturing yüksek- ifa sıvı chromatography. soykırım Res 7996–1005: [PubMed] [özgür dolu metin].
su kuyusu RS, Yuldasheva N, Ruzibakiev R, Underhill baba, Evseeva I, mavi- demirci J, Jin L, et al (2001) belgili tanımlık Eurasian heartland: a kıta perspektif üstünde Y-chromosome farklılık Proc Natl akademik Sci USA 9810244–10249: [ özgür dolu metin içinde PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) ard arda geliş değişme miktarı -in belgili tanımlık insana ilişkin Y chromosome. tabiat 378379–380: [PubMed] [ dolu metin].
Wilson IJ, kel DJ (1998) Genealogical sonuç çıkarma --dan microsatellite veri. Genetics 150499–510: [PubMed] [ özgür dolu metin].
Wolpert S (2000) A yeni tarih -in Hindistan. Oxford üniversite sıkıştırma, yeni York.
genç FW, bayrak CM (1996) A görsel istatistik sistem. içinde sokmak RA, tilki J (eds) istatistik hesap yapmak çevre için toplumsal araştırma. Sage neşriyat, yeni York, pp 207–236.
Zerjal T, Beckman L, Beckman G, Mikelsaar AV, Krumina A, Kucinskas V, fırlatmak beni, Tyler- demirci C (2001) coğrafi, dilbilimsel, ve kültürel etki üstünde gen farklılık: Y-chromosomal dağıtma içinde şimalî Frenk nüfus. Mol Biol Evol 181077–1087: [PubMed] [ özgür dolu metin].
Zerjal T, Dashnyam B, Pandya A, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Fretwell N, Jobling anne, Harihara S, titrek ışık K, Semjidmaa D, Sajantila A, salon P, Crawford MH, Ginter EK, Evgrafov OV, Tyler- demirci C (1997) gen akrabalık -in Asya`ya ait ve şimalî Frenk, kâşif yanında Y-chromosomal DNA çözümleme. Am J uğuldamak gen 601174–1183: [PubMed].


 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Sayfa son güncellestirmek: , Saturday, February 04, 2006 17:45:01 -0500