Perinnöllisyystiede

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Kromosomi DNA Hajonta kotona Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Kristus Tyler- Seppä ja S-kirjain. Qasim Mehdi1

1Biomedical ja Perinnöllisyystiede Järjestäen Divisioona, Dr. Q. Kaani Tutkia Laboratorio, Islamabad; 2Cancer Tutkia Olla sotaretkellä, Kromosomi Molekyyli- Biologia Jaotella, Departementti -lta Biokemia, ja 3Institute -lta Biologinen Antropologia, Korkeakoulu -lta Oxford, Oxford, Yhdistetty Kuningaskunta; ja tulkita selväkielelle Perinnöllisyystiede, Reykjavik.


Abstrakti

Kahdeksantoista binääri monimuotoisuus ja 16 multiallelic, lyhytfilmi- tandem- kertaus (STR) loci polveutua nonrecombining osa -lta ihmis- Y-KIRJAIN kromosomi toivoisin olevani kirjake kotona 718 koiras- aihe omaisuus jotta 12 etninen jaotella -lta Pakistan. Nämä tunniste 11 kilpa-ajohevoset haplogroups ja 503 konserni binääri merkitsijä/STR haplotypes. Haplogroup frekvenssi toivoisin olevani tavallisesti rinnakkainen jotta ne kotona neighboring maantieteellinen kohta, ja Pakistan väestö puhuva kielenkäyttö eristää ( Burushos), Dravidian kielenkäyttö ( Brahui), eli Sino- Tiibet kielenkäyttö ( Balttilainen) muistuttaa Indo-European–speaking enemmistö Kuitenkin, joukkoviestimet- ottaa osaa jhk verkko -lta haplotypes tuli ilmi aikamoinen substructuring -lta Y-KIRJAIN hajonta sisäpuolella Pakistan, avulla usea väestö vaikutus erillinen terttu -lta haplotypes. Nämä malli kanisteri olla häntä pidetään muotoa ajaksi luona alhainen allas -lta Y-KIRJAIN rivimäärä, avulla aineellinen eristetty asema kesken väestö ja ajaa kotona harvalukuinen itse Harva komparatiivinen perinnöllisyystiede eli historiallinen aineisto aari saatavana ajaksi enimmät väestö, ainoastaan lopputulos kanisteri olla verrattuna avulla oraalinen perimätieto jokseenkin alkuperä Y-KIRJAIN aineisto apu kummuta- laillinen juontaa -lta Kitsastelu kotona Iran, johdattaa mieleen alamäki -lta Arpapeli polveutua Genghis Kaani armeija, ja juontaa -lta Neekeri Makrani kotona Afrikka, ainoastaan ajaa ei apu perimätieto -lta Tiibet, Syyrialainen, Kreikan kieli, eli Juutalainen alkuperä ajaksi toinen väestö.


Alkulause

aikaisimmin osoittaa -lta Paleolithic ihmis- läsnäolo kotona Etelä- Affair koostua jstk -lta kivinen työkalu perustaa hajallaan liepeillä Soan Joki Laakso kotona pohjoinen Pakistan ( husaari 1997). Huolimatta pula -lta fossiili osoittaa, nämä koristella esiintyä jotta ilmaista läsnäolo -lta kotiin palaava kotona Etelä- Affair koska aikainen koska 200,000–400,000 ikä sitten (Wolpert 2000) ja niin aari uskottava jotta hankkia liittyy jhk avulla kujeellinen Gay laji. Pakistan lies model after edellytys eteläinen ajaa vapaalla ajoväylä kannattaja luona anatominen ajanmukainen Gay Sapiens rikki -lta Afrikka, ja joten toukokuu hankkia asuttu luona ajanmukainen ihmis- koska aikainen koska 60,000–70,000 ikä sitten. Paikalla on osoittaa -lta luola asukas kotona Pakistan luoteinen raja, ainoastaan fossiili osoittaa polveutua Paleolithic has katkelma ( husaari 1997). Osoittaa has avopäin aikaa Mehrghar, kotona lounainen Pakistan, ilmaisten Neoliittinen määrääminen polveutua koska kauan sitten koska 7,000 b.c. (Jarrige 1991), joka toivoisin olevani kannattaja luona Indus Laakso kulttuuri ( käsittävä mainitseva -lta Puhe ja Mohenjodaro) että fanfaari kotona 3d ja 2d tuhatvuotinen valtakunta b.c. (laakso 1991). Liepeillä 1500 b.c., Indo-European–speaking paimentolais- pastoral heimo polveutua edelleen north—often vieras Aryans—crossed Karakorum Rinne ardor Etelä- Affair. Jälkeinen historiallinen tapahtuma käsittää hyökkäys -lta Alexander Erinomainen (327–325 b.c.) ja Arabialainen ja Muhamettilainen valloitus polveutua 711 a.d. edelleen (Wolpert 2000).

läsnä asujaimisto -lta Pakistan koostua jstk -lta enemmän kuin 160 miljoona yksilö ( antava jotta 2005 JOKA esiintyä) joka kuulua jotta aikaa pienin 18 etninen jaotella ja haastaa enemmän kuin 60 kielenkäyttö ( ankea 1992). Enimmät -lta nämä kielenkäyttö aari Indo- Eurooppalainen, ainoastaan he kin käsittää by eristää, Burushaski; Dravidian kielenkäyttö, Brahui; ja Sino- Tiibet kielenkäyttö, Balttilainen. Punjabi- puhuva yksilö asu enemmistö asujaimisto -lta Pakistan, ainoastaan he edustaa kompleksi admixture -lta etninen jaotella (Ibbetson 1883) ja aari ei analysoiminen tähän; 12 etninen jaotella aari mukaanluettuna kotona läsnä asemakartta. ilmianto saatavana jokseenkin heidät on tehdä yhteenveto kotona esittää 1, keskenään avulla hypoteesi jokseenkin heidän alkuperä (Mehdi et al. 1999). Joskin jokin -lta nämä hypoteesi aari kummuta- kannattaja (e.g., juontaa -lta Kitsastelu kotona Iran), enimmät aari pitää keskuspaikkanaan model after oraalinen perimätieto ja hankkia ei koekäyttää vastaan toinen aiheuttaja -lta osoittaa.

Niukka perinnöllisyystiede aineisto aari saatavana ajaksi nämä Pakistan etninen jaotella Aikainen luvut -lta ABO totuttaa vereen jaotella ja antiikkinen proteiini merkitsijä valmis ei käsittää aivan jaotella ja enimmäkseen luokiteltu heidät antava jotta heidän kohta -lta asuinpaikka. asujaimisto puu pitää keskuspaikkanaan model after 54 antiikkinen entsyymi merkitsijä paikoitellen Arpapeli ja Käytävä kotona Lännenpuoleinen Aasialainen kasaantua hillitä pohjoinen Caucasoids (kavalkadi-Sforza et al. 1994). Kotona toinen asujaimisto puu, pitää keskuspaikkanaan model after 47 antiikkinen proteiini monimuotoisuus, Pakistan näyte asu harvalukuinen subcluster sisäpuolella Indo- Eurooppalainen puhuja polveutua Etu-Intia ( kavalkadi-Sforza et al. 1994).

Y-KIRJAIN kromosomi ehkäistä ainoa laatuaan aiheuttaja -lta perinnöllisyystiede osoittaa (Tyler- Seppä 1999; Työtön ja Tyler- Seppä 2000). Se joutua avara nonrecombining segmentoida kotona Genova ja hillitä lukuisa kilpa-ajohevoset binääri merkitsijä, käsittävä nojata korvaaminen (hiippakunta, e.g., Salainen et al. 1997) ja retroposon insertions ( hana 1994; Gravel et al. 2000), joka kanisteri olla käytetty kotona konserni avulla enemmän- nopeasti kehitteleminen merkitsijä, moinen koska microsatellites (hiippakunta, e.g., Ayub et al. 2000). Niin muodoin, erittäin esittää tarkasti Y-KIRJAIN phylogenies kanisteri olla konstruoida että antaa koiras-- erityinen aspekti -lta perinnöllisyystiede historia jotta olla tutkia. Nämä aari voimakkaasti vaikutus luona harvalukuinen tehokkaasti asujaimisto koko -lta Y-KIRJAIN kromosomi, johtava jotta nopea perinnöllisyystiede ajaa, ja luona harjoitella -lta patrilocality kotona usea yhteiskunta, johtava jotta jalo laakea -lta maantieteellinen erilaistuminen -lta Y-KIRJAIN haplotypes. Kuitenkin aikaansaada -lta Qamar et al. (1999) model after analyysi -lta Luskuttaa+ kromosomi ( käsittävä ~2.6% -lta laskea yhteen) ja analysoida -lta STR hajonta (Ayub et al. 2000; Mohyuddin et al. 2001), vähäinen määrä aikaansaada has joutua rikki model after Pakistan Y-KIRJAIN kromosomi. Sen tähden, me hankkia kas noin esiintyjä by aava analyysi -lta Pakistan Y-KIRJAIN rivimäärä, jotta määritellä mikä kynttilä he kanisteri aitta model after alkuperä ja perinnöllisyystiede historia -lta alaryhmä että ehtiä jalkeilla Pakistan asujaimisto.


Aine ja Järjestys

Näyte
Y-KIRJAIN kromosomi -lta 718 aivan muu koiras- aihe, omaisuus jotta 12 etninen jaotella -lta Pakistan, toivoisin olevani analysoiminen (ruokalusikka 1 ja 2; viikuna. 1). Asoihin perehtynyt hyväksyminen ammentaa polveutua aivan osallinen kotona nyt kuluva harjoitelma. By Epstein Kasarmi virus–transformed lymphoblastoid kammio asettaa riviin laillinen polveutua joka yksilö, ja DNA kiristävä polveutua nämä kammio piirteet ajaksi analyysi.


Binääri Monimuotoisuus Konekirjoitus
Me kirjake 15 SNPs, by Alu liite ( hana 1994; Hana ja Horatius 1995), Asettaa riviin liite ( gravel et al. 2000), ja 12f2 deletoiva (Casanova et al. 1985). nojata korvaaminen toivoisin olevani 92R7 C?T-KIRJAIN (Mathias et al. 1994); M9 C?G ( salainen et al. 1997); SRY-2627 C?T-kirjain (Bianchi et al. 1997); SRY-1532 G? (Whitfield et al. 1995; Kwok et al. 1996; Gravel et al. 1999b); sY81 (DYS271) ?G (Seielstad et al. 1994); SRY-8299 G? (gravel et al. 1999a); Altis G? ( panda et al. 1998); SRY +465 C?T-KIRJAIN ( potka et al. 1999); LLY22g C? ja Tehdä sukkulapitsiä T-kirjain?C muutos (Zerjal et al. 1997). Kotona jatko, M17 merkitsijä ( salainen et al. 1997) kirjake, luona apu -lta alkeiskirja GTGGTTGCTGGTTGTTACGT ja AGCTGACCACAAACTGATGTAGA kannattaja luona AflIII ruoansulatus -lta PCR hedelmä; esi-isiltä peritty allele ei järjestellä M20 merkitsijä (salainen et al. 1997) genotyyppi, luona apu -lta alkeiskirja CACACAACAAGGCACCATC ja GATTGGGTGTCTTCAGTGCT kannattaja luona SspI ruoansulatus; ?G mutaatio hävittää asema aikaa asema 118 kotona 413-bp hedelmä. M11 (salainen et al. 1997) kirjake, kohteleva alkeiskirja TTCATCACAAGGAGCATAAACAA ja CCCTCCCTCTCTCCTTGTATTCTACC kannattaja luona ruoansulatus avulla MspI. 215-bp hedelmä järjestellä jotta 193-bp ja 22-bp katkelma kotona johtaa allele. RPS4Y C?T-KIRJAIN mutaatio (Bergen et al. 1999) huomata luona BslI rajoitus ruoansulatus -lta 528-bp PCR hedelmä ammentaa luona apu -lta alkeiskirja CCACAGAGATGGTGTGGGTA ja GAGTGGGAGGGACTGTGAGA. esi-isiltä peritty C allele hillitä kakkonen asema, ja johtaa T-KIRJAIN allele hillitä ainoa. M48 (salainen et al. 1997), G, kirjake luona allele- erityinen PCR kohteleva arvostelukykyinen alkeiskirja TGACAATTAGGATTAAGAATATTATA ja TGACAATTAGGATTAAGAATATTATG ja alhainen alkeiskirja AAAATTCCAAGTTTCAGTGTCACATA jotta kehittää erityinen 145-bp hedelmä asento -lta Y-KIRJAIN binääri merkitsijä alleles joutua luona ainoa yksilö jälkisäädös olla alistaa jotta koska “the Y-kirjain haplogroup.”
-lta 718 näyte, 717 hirveä ardor haplogroups arvata model after kivijalka -lta tunnettu phylogeny, ainoastaan ainoa Käytävä koettaa (PKH134) epäonnistua jotta kuvailla laveasti aikaa SRY –1532 ja M17 loci. Hän määrätä jotta haplogroup 3 model after kivijalka -lta vaihtoehto SRY –1532 alkeiskirja ( esittää tarkasti model after anomus) ja -nsa STR leikkauskuva.


Y-kirjain-STR Konekirjoitus
Viisi trinucleotide- kertaus monimuotoisuus (DYS388, DYS392, DYS425, DYS426, ja DYS436), kymmenen tetranucleotide- kertaus monimuotoisuus (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, ja DYS439) ja ainoa pentanucleotide microsatellite (DYS438) toivoisin olevani kirjake kotona aivan Y-KIRJAIN kromosomi. Kolme kerrannainen PCR vastavaikutus toivoisin olevani esiintyjä ajaksi aivan Y-KIRJAIN-STRs, kotona a10-µl finaali reaktio avaruus hillitä 20 ng Genova DNA, koska kertoa muualla ( Tuomas et al. 1999; Ayub et al. 2000). PCR hedelmä toivoisin olevani ajelu model after by ABI 377 jakso. ABIGS350 TAMRA käytetty koska jäsentenvälinen ajokaista alusta. GENESCAN ja GENOTYYPPI pehmo pakkaus toivoisin olevani käytetty jotta kollehtarukous aineisto ja jotta analysoiminen katkelma koko Y-KIRJAIN-STR alleles toivoisin olevani maine antava jotta joukko -lta kertaus aggregaatti he contain.The joukko -lta kertaus aggregaatti laillinen alusta loppuun apu -lta jakso alistaminen DNA näyte. Allele pituus ajaksi DYS389b toivoisin olevani ammentaa luona vähennyslasku -lta DYS389II allele hevosmitta polveutua DYS389I.
Y-KIRJAIN-STR jäljentäminen toivoisin olevani perustaa aikaa useat loci. DYS393 kaksois- kotona PKH165 (13 ja 15) ja DYS437 kaksois- kotona SDH181 (8 ja 9). enemmän kompleksi kuvioida perustaa kotona DYS425, johon kakkonen jotta neljä alleles toivoisin olevani perustaa kotona 36 yksilö polveutua haplogroups 8, 9, 13, ja 21.


Aineisto Analyysi
Ensimmäinen- aineosa analyysi joutua rikki model after haplogroup frekvenssi luona apu -lta Näköala ( näkö Statistiikka) elimistö pehmo, käännös 5.0.2 (nuori ja Lippu 1996). Ajaksi graafinen agentuuri, edellä ja avustaa ensimmäinen aineosa toivoisin olevani vehkeilijä luona Mikroskooppi Keittiön puoli Seurue Kunnostautua Kääriä paperiin model after Akkuna 2000. Biallelic monimuotoisuus aineisto ajaksi eri maailma väestö käytetty kotona analyysi toivoisin olevani ammentaa polveutua Hana et al. (2001). Admixture arvioitu luona apu -lta kolme eri mitata: Kauan jyvittää pienin- nelikulmio (WLS) mitata ( kauan 1991); herra, pienin- nelikulmio arvioida (aamutakki ja Hiorns 1965); ja m-kirjain? (Helgason et al. 2000).
Analyysi -lta molekyyli- epäsopu (AMOVA) joutua rikki luona apu -lta Arlequin kääriä paperiin (Schneider et al. 1997). AMOVA mitata mittasuhteet -lta mutaatio erisuuntaisuus perustaa sisäpuolella ja kesken väestö, kukin erikseen. Joskin hyvin -lta hajonta aikaa nopeasti mutaatio microsatellite loci on arvata jotta hankkia aiheuttaa kotona eri Pakistan subpopulations, ainoa laatuaan mutaatio tapahtuma aikaa binääri loci aari hyvin vanhempi ja hankkia ei että kotona asiayhteys -lta alajaos -lta Pakistan asujaimisto. Me keksiä seuraava sodanjohtotaito jotta hyödyntää enimmäis- erä -lta asiaan kuuluva mutaatio ilmianto polveutua Y-KIRJAIN- kromosomi haplotypes. STR hajonta sisäpuolella haplogroups käytetty jotta arvioida asujaimisto pairwise FST arvo ajaksi joka yksilö haplogroup. Ajaksi joka asujaimisto muodostaa pari, jyvittää alhainen FST arvioida, johon arvo ammentaa ajaksi joka haplogroup jyvittää antava jotta koko -lta pairwise vertailu kietominen että haplogroup. Kotona poisjäänti -lta detalji haplogroup polveutua ainoa asujaimisto, , -lta muodostaa pari ja B, FST asento jotta 1, ja joukko -lta pairwise vertailu varattu koska joukko -lta kromosomi kantavuus että haplogroup kotona B. Arvo -lta FST pitää keskuspaikkanaan model after STRs yksin eli model after STRs ynnä binääri merkitsijä, avulla binääri merkitsijä kimmoisuus 10- kerätä tarhaan jalo jyvittää, toivoisin olevani arvioida ajaksi komparaatio. Kotona aivan -lta nämä analysoida, etäisyys matriisi käytetty johdonmukaisuus -lta joukko -lta portaat luona joka joka muodostaa pari -lta haplotypes erilaisuus. Mantel koekäyttää ajaksi merkittävyys -lta korrelaatio kesken FST arvo toivoisin olevani joutua rikki kotona Arlequin, ja multidimensional hilseilevä (MDS) maatilkku toivoisin olevani konstruoida luona apu -lta SPSS käännös 7.0 pehmo kääriä paperiin.

Joukkoviestimet- ottaa osaa jhk verkko toivoisin olevani konstruoida luona Verkko 2.0b ( liittyä yhteen et al. 1999). jyvittää ehdotelma avulla viisi- kerätä tarhaan ala käytetty kotona konstruktio -lta verkko. paino määrätä toivoisin olevani erityinen ajaksi joka haplogroup ja ajaa ardor arvo Y-KIRJAIN-STR hajonta halki haplogroup kotona eheä Pakistan asujaimisto. seuraava paino toivoisin olevani käytetty epäsopu 0-0.09, jyvittää 5; epäsopu 0.1-0.19, jyvittää 4; epäsopu 0.2-0.49, jyvittää 3; epäsopu 0.5-0.99, jyvittää -lta 2; ja epäsopu 1.00, jyvittää 1. Huolimatta nyt kuluva, verkko ajaksi haplogroup 1 astia usea jalo kolmiulotteinen korottaa kolmanteen potenssiin ja hajota luona anoa alentaa joukkoviestimet ja joukkoviestimet ottaa osaa jhk verkko järjestys sequentially. alentaa joukkoviestimet algoritmi (liittyä yhteen et al. 1995) käytetty jotta kehittää *.rmf arkistoida ja joukkoviestimet ottaa osaa jhk verkko järjestys soveltava jotta nyt kuluva arkistoida.

BATWING (Wilson ja Kaljuuntua 1998), Bayesian Analyysi -lta Puu Avulla Jäsentenvälinen Kyhmy Generointi, käytetty jotta arvioida aika jotta enimmät taannoinen alhainen esi-isä (TMRCA) -lta asento -lta kromosomi. Nyt kuluva ohjelmoida uses Arvostella kahlehtia Kuu Carlo menetelmä jotta kehittää phylogenetic puu ja liittyy jhk parametri arvo johdonmukaisesti avulla syöttää aineisto ( asento -lta Y-KIRJAIN haplotypes) ja perinnöllisyystiede ja demografia esikuvallinen perinnöllisyystiede esikuvallinen anastaa ainoa- astua mutaatio -lta STRs ja demografia esikuvallinen valikoida edustaja kasvaminen polveutua by aluksi ainainen- koko asujaimisto, avulla eli ilman alajaos kotona eri runs -lta ohjelmoida Aivan 16 STR loci toivoisin olevani käytetty; locus- erityinen mutaatio arvioida aiempi todennäköisyys pitää keskuspaikkanaan model after aineisto -lta Kayser et al. (Kayser et al. 2000) toivoisin olevani konstruoida ajaksi loci saatavana koska gamma jakaminen -lta asu gamma(, b) johon = (1 + joukko -lta mutaatio tarkastaa luona Kayser et al.), ja b = (1 + joukko -lta meioses). Ajaksi loci ei tutkia luona Kayser et al., jakaminen gamma (1,416) käytetty, joka has alhainen -lta 0.0024. generointi aika -lta 25 ikä väärä. Niin 95% itseluottamus ajoittain kimmoisuus ajaa ardor arvo epämääräisyys kotona mutaatio arvioida, asujaimisto kasvaminen ja ( johon anastaa) alajaos, ainoastaan ei generointi aika.

lopputulos

Y-kirjain- Kromosomi Binääri Monimuotoisuus
18 binääri merkitsijä käytetty hahmottaa 20 haplogroups kotona globaali väestö viikuna 1A), ainoastaan ainoa 11 toivoisin olevani perustaa kotona Pakistan, ja 5 häntä pidetään muotoa ajaksi 92% -lta koettaa ( viikuna. 1 ja esittää 2). Haplogroups 1 ja 9 toivoisin olevani läsnä kotona aivan Pakistan väestö kuulustella, haplogroup 3 läsnä kotona aivan lukuunottamatta Arpapeli, ja haplogroup 28 läsnä kotona aivan lukuunottamatta Arpapeli ja Cashmere. Lounainen väestö esitellä jalo frekvenssi -lta hg 9 ja Luskuttaa+ haplogroups 21 ja 8 kuin koillinen väestö (figs. 1D–E), ainoastaan, haalari, vähäinen määrä maantieteellinen kasaantua -lta haplogroup frekvenssi on ilmeinen sisäpuolella kreivikunta.


Ensimmäinen- Aineosa Analyysi
Me toivottu jotta vertailu Pakistan Y-KIRJAIN haplogroup aineisto avulla aineisto polveutua väestö polveutua lepuuttaa -lta maailma. Ei otollinen aineisto asento saatavana ajaksi ehjä asento -lta 18 merkitsijä, ainoastaan aineisto -lta Hana et al. (2001) antaa aivan ainoastaan 5 jotta olla käytetty, koska sama eli phylogenetically samamerkityksinen merkitsijä toivoisin olevani epäsuora esitys. ensimmäinen- aineosa analyysi viikuna 2A) esitellä jokin erilaisuus polveutua alkuperäiskappale analyysi -lta Hana et al., meri ainoa olemassaolo vähempi asumusero -lta Afrikkalainen väestö. Nyt kuluva on arvonmukainen, jotta avara ala, jotta subset -lta merkitsijä käytetty, joka does ei käsittää usea -lta Afrikka- erityinen itse. Enimmät Pakistan väestö kasaantua avulla Etelä- Aasialainen ja Keskikohta Itäinen väestö, ja aari lakkauttaa jotta Pohjoinen Afrikkalainen, Keskeinen Aasialainen ja Eurooppalainen väestö, niin vaikutus kaikinpuolinen samanlaisuus avulla maantieteellinen lakkauttaa väestö. ainoa poikkeus on Arpapeli, joka aari aivan erillinen. rinnakkainen analyysi -lta Pakistan väestö yksin, kohteleva aivan -lta binääri merkitsijä ( viikuna. 2B), konfirmoida erilaisuus kesken Arpapeli ja toinen väestö ja kin enemmän selvästi esitellä distinctness -lta Kalash ja Kitsastelu. Se on hosuminen että kielenkäyttö isolate–speaking Burusho ja Dravidian- puhuva Brahuis ajaa ei alusta rikki kotona nämä analysoida.


Admixture Arvioida
Hypoteesi jokseenkin asujaimisto alkuperä ( esittää 1) kanisteri olla harkittu koska kvantitatiivinen asia jokseenkin admixture. Ajaksi esikuva, jotta koekäyttää mahdollisuus että Baluch Y-KIRJAIN kromosomi hankkia Syyrialainen juontaa, me kanisteri anoa mikä koko -lta Baluch Ys aari johtaa polveutua Syyria ja mikä koko aari polveutua Pakistan ( harkittu jotta olla Pakistan koettaa miinus Baluch). Aineisto model after johdattaa mieleen aiheuttaja väestö toivoisin olevani varattu polveutua kaunokirjallisuus ja kolme mitata -lta admixture toivoisin olevani arvioida. kolme arvioida kimmoisuus suurin piirtein johdonmukaisesti lopputulos, avulla harvalukuinen järjestelmällinen erilaisuus karakteristinen m-kirjain? > herra > Kauan WLS ajaksi arvioitu avustus polveutua ulkonaiset seikat aiheuttaja asujaimisto ( esittää 3). Nämä lopputulos ehkäistä osoittaa ajaksi by ulkonaiset seikat avustus jotta Arpapeli, Kalash, Neekeri Makrani, ja Kitsastelu ainoastaan ei jotta toinen väestö.


Y-KIRJAIN- Kromosomi STR Monimuotoisuus
Y-KIRJAIN-STR monimuotoisuus toivoisin olevani harkittu jotta ammentaa enemmän esittää tarkasti katsella -lta Y-KIRJAIN hajonta, joukkoon eri Pakistan etninen jaotella, että olla l;sitellä vino luona merkitsijä-ascertainment menetelmä erilaisuus -lta Y-KIRJAIN-STR haplotypes ( esittää 4) alimmainen ajaksi Arpapeli (0.893) koska johdattaa mieleen luona aiempi analysoida (Ayub et al. 2000).
16 Y-KIRJAIN-STRs määritellä 502 Y-KIRJAIN haplotypes, aava enemmistö olemassaolo tarkastaa kotona ainoa yksilö jäljellä oleva haplotypes toivoisin olevani annos luona 2–18 yksilö ( esittää tarkasti aari kimmoisuus kotona online- ainoa liite- esittää). Kotona aivan asia ainoastaan ainoa, kromosomi jakaminen haplotype kuulua jotta sama haplogroup ( tästä, 503 konserni haplotypes) ja, kotona enimmät asia, yksilö jakaminen haplotype kuulua jotta sama asujaimisto (esittää 5).

GST ja modaali koko -lta kertaus aggregaatti, ajaksi aivan 16 Y-KIRJAIN-STRs kuulustella kotona Pakistan asujaimisto, aari kimmoisuus kotona esittää 6. korrelaatio kesken merkitsijä heterozygosity ja GST perustaa ei jotta olla merkitsevä (r0.329=; P=.213). modaali koko ja epäsopu -lta 16 Y-KIRJAIN-STRs sisäpuolella haplogroups 1, 2, 3, 8, 9, 10, 21, 26, ja 28 on kin kimmoisuus kotona esittää 6. Eräs haplogroups hankkia eri modaali allele koko, ja jokin esikuva -lta nyt kuluva aari esitellä kotona boldface kursiivi kotona esittää 6. Ajaksi esimerkki, DYS388 has 15 kertaus kotona haplogroup 9, verrattuna avulla 12 kertaus kotona enimmät -lta toinen haplogroups kotona Pakistan. Samalla tavoin, modaali allele ajaksi DYS438 on 9 kotona haplogroup 9, ainoastaan 10 eli 11 kotona toinen haplogroups. modaali allele ajaksi DYS434 ajaksi haplogroup 10 on 11, joka on huomiotaherättävän eri polveutua allele koko -lta nyt kuluva locus kotona toinen haplogroups. lopettaa pula -lta variability ajaksi DYS436 kotona 233 koiras- aihe omaisuus jotta haplogroup 3 on merkkihenkilö. Haplogroup 10 säilyttää jotta hankkia pienin variability halki enimmät loci lukuunottamatta ajaksi DYS390 ( esittää 6). Nämä tulokset demonstroida ankara rakenteellinen -lta Y-KIRJAIN-STR variability luona haplogroup.

Me palvelukseen halutaan jotta arvioida Y-KIRJAIN- pitää keskuspaikkanaan mitata -lta perinnöllisyystiede etäisyys kesken väestö että heijastaa erilaistuminen että had että sisäpuolella Pakistan ja että ei olla epäsuhtainen dominoida luona antiikkinen erilaisuus että had aikaisemmin karttua kesken haplogroups. alusta elämäntapa jotta ajaa nyt kuluva olla jotta apu STR hajonta, ja esittää 7 tehdä yhteenveto asujaimisto pairwise arvo -lta FST model after kivijalka -lta STR hajonta yksin () eli -lta binääri- merkitsijä ynnä STR hajonta (B), avulla binääri- merkitsijä erilaisuus jyvittää 10 silloin tällöin jalo kuin STR erilaisuus. Nämä matrices aari ylänkömaa korreloida (r0.95=; P.001<), koska mahti olla arvata polveutua rakenteellinen -lta STR hajonta luona haplogroup. Joka tapauksessa, nämä mitata aari merkittävä vaikutus luona antiikkinen erilaisuus, ja me hankkia sen tähden edistää modified mitata. Me harkittu että hyvin -lta STR hajonta sisäpuolella haplogroups hankkia määrätä jnk asema äskettäin ja olla käytetty ajaksi nyt kuluva purpose.Nous avons arvioidaé donc pari muodostaa pari des laakso de asujaimisto de FST, sur la nojata du STR hajonta dans des haplogroups, et utilisé une moyenne peseé de ces derniers kaataa aiheuttaa une matrice herkkäuskoinen de etäisyys de FST ( esittää 7C ; figue. 3) Nämä etäisyys aari kin ylänkömaa korreloida avulla etäisyys pitää keskuspaikkanaan model after STRs yksin (r0.76=; P.001<) eli model after STRs ynnä binääri merkitsijä (r0.70=; P.001<), ainoastaan erinomainen koko -lta hajonta on hiippakunta kesken väestö (22%, verrattuna avulla 6% ja 7%, kukin erikseen). komparaatio -lta esiintyä 3 avulla esiintyä 2B ( joka pitää keskuspaikkanaan model after binääri merkitsijä frekvenssi yksin) ilmaista hosuminen haalari samankaltaisuus, avulla Arpapeli olemassaolo erillinen polveutua aivan -lta toinen väestö. toinen erinomainen väestö aari Kalash ja Kitsastelu (koska aiemmin), Cashmere (ehkä koska -lta harvalukuinen koettaa), ja Brahuis, joka aari niin enemmän erillinen kotona heidän STR sivukuva kuin haplogroup frekvenssi. MDS maatilkku -lta etäisyys kotona ruokalusikka 7A ja 7B (ei esitellä) lyijyinen jotta rinnakkainen johtopäätös, ainoastaan muistuttaa esiintyä 2B enemmän tiiviisti kotona elämäntapa että Brahuis ajaa ei alusta rikki joten hyvin.


Joukkoviestimet- Ottaa osaa jhk Verkko
Perinnöllisyystiede yhteys joukkoon eri Pakistan etninen jaotella toivoisin olevani tehdä tutkimusmatka edelleen luona piirustus joukkoviestimet- ottaa osaa jhk verkko ( liittyä yhteen et al. 1995), ja esikuva aari esitellä kotona esiintyä 4, 5, ja 6. haplogroup 1 verkko viikuna 4) ilmaista aikamoinen hajonta, ainoastaan kin jalo arvo -lta asujaimisto- erityinen substructure. Ajaksi esikuva, 24 Kitsastelu haplogroup 1 kromosomi aivan syksyinen ardor ainoa -lta kolme terttu ( viikuna. 4, kokematon), 19 -lta 26 Burusho haplogroup 1 kromosomi syksyinen ardor kakkonen terttu ( alakuloinen), ja 12 -lta 14 Arpapeli haplogroup 1 kromosomi syksyinen ardor ainoa kasaantua, ja aivan -lta nämä terttu aari erityinen jotta heidän eri väestö. haplogroup 10 verkko viikuna 5) on hyvin herkkäuskoinen, koska -lta harvalukuinen joukko -lta kromosomi, ainoastaan jälleen ilmaista asujaimisto- erityinen kasaantua ajaksi Burusho ja Arpapeli haplotypes. haplogroup 28 verkko ( viikuna. 6) esitellä hosuminen eristetty Kitsastelu- erityinen kasaantua, aikaa häntäpää -lta kauan ala, hillitä 15 -lta 16 Kitsastelu haplogroup 28 kromosomi. Terttu -lta Kalash, Burusho, and—to vähempi degree—Baluch kromosomi aari kin ilmeinen, joskin ainoa Baluch haplotype on annos avulla Sindhi ja Makrani Baluch yksilö polveutua lähellä eteläinen väestö.
BATWING TMRCAs toivoisin olevani arvioida ajaksi haplogroup 28 verkko ja ajaksi ensiluokkainen rivimäärä sisäpuolella joukko -lta haplogroups. lopputulos aari tehdä yhteenveto kotona esittää 8.

Keskustelu

Me hankkia joutua rikki edellä aava analyysi -lta Y-KIRJAIN erilaisuus sisäpuolella Pakistan, kuulusteleminen 34 merkitsijä kotona 718 koiras- aihe polveutua 12 väestö Nyt kuluva antaa objektimuoto jotta vertailu Pakistan Y-KIRJAIN erilaisuus avulla että aikaisemmin epäsuora esitys kotona maailma väestö, jotta tutkia erilaisuus sisäpuolella Pakistan, ja jotta arvioida jokin -lta johdattaa mieleen asujaimisto historiankirjoittaja polveutua Y-KIRJAIN näköala.


Vertailu avulla Globaali Aineisto
Kotona globaali komparaatio, Pakistan väestö enimmäkseen kasaantua liepeillä allas Etelä- Aasialainen koettaa ja lekotella lakkauttaa jotta Keskikohta Itäinen koettaa ( viikuna. 2A). Nyt kuluva löytäminen on unsurprising, kotona eritä koska Etelä- Aasialainen koettaa mukaanluettuna 62 Pakistan yksilö (i.e., 32% -lta 196 laskea yhteen) ja kotona eritä koska Y-KIRJAIN hajonta kotona usea kohta -lta maailma on valtaosa kokoonpano luona maantiede, ei luona kielenkäyttö eli etninen isyystutkimus (Rosser et al. 2000; Zerjal et al. 2001). erinomainen perinnöllisyystiede samanlaisuus -lta Pakistan väestö jotta ne kotona lännenpuoleinen kuin jotta itäinen väestö on valaista luona asia että neljä -lta viisi lukuisa haplogroups kotona Pakistan (haplogroups 1, 2, 3, ja 9, joka keskenään ehtiä jalkeilla 79% -lta laskea yhteen asujaimisto) aari kin lukuisa kotona lännenfilmi Affair ja Eurooppa ainoastaan ei kotona Leuka eli Japani; käänteinen suhde, haplogroups että aari lukuisa kotona Idänpuoleinen Affair (e.g., 4, 5, 10, 13, ja 20) aari harvinainen eli poissa kotona Pakistan, asu ainoa 2.5% -lta laskea yhteen Tokko, koska kotona jokin tulkinta, by aikainen joukkolähtö polveutua Afrikka pitkin eteläinen ajaa vapaalla -lta Affair valodiodi jotta edellä anatominen ajanmukainen ihmis- väestö kotona Pakistan, ja nämä ihmiset joutua itäinen haplogroups eli heidän airut, heidän Y-KIRJAIN kromosomi hankkia kas noin suureksi osaksi asettaa takaisin luona jälkeinen muutto eli geeni aaltoilu; jopa, agentti -lta itäinen haplogroups kotona Pakistan toukokuu olla johtaa polveutua ajanmukainen taaksepäin- muutto, ei polveutua antiikkinen eloonjäänyt.
viidennes haplogroup että on alhainen kotona Pakistan, haplogroup 28, eritä polveutua aivan toiset kotona sen jakaminen. Sisäpuolella Pakistan, se kokoonpantu jalkeilla 14% -lta meidän koettaa ja läsnä kotona aivan ainoastaan kakkonen väestö ( kumpikin -lta joka had erittäin harvalukuinen koettaa koko), joten se on kumpikin alhainen ja laaja Ulkona Pakistan ja lähellä kreivikunta, joka tapauksessa, se on harvinainen. Se has epäsuora esitys kotona Etu-Intia (30%; läsnä kotona 3/3 väestö), Tajikistan (10%; läsnä kotona 5/6 väestö), ja Uzbekistan (3%; läsnä kotona 10/13 väestö), ainoastaan se on harvinainen kotona Venäjä (0.4%; läsnä kotona 1/6 väestö) ja Kaukasus (1.4%; läsnä kotona 1/6 väestö (kummuta et al. 2001) ja has ei perustaa aikaa aivan kotona Leuka eli Mongolia ( ilmestymätön havainnointi BATWING arvioida -lta TMRCA -lta Pakistan haplogroup 28 kromosomi toivoisin olevani ~7,000 (4,000–14,000) ikä ( esittää 8). Niin, sisäpuolella nyt kuluva aika aika, Pakistan väestö hankkia erisuuntaisuus polveutua alhainen esi-isiltä peritty asujaimisto eli hankkia kokenut aikamoinen koiras- geeni aaltoilu kesken itseänsä eli polveutua alhainen aiheuttaja. Alkaen arvioitu ikääntyä olla kirjeenvaihdossa jotta aikainen Neoliittinen aika, aueta -lta nyt kuluva rivimäärä mahti olla liittyy jhk avulla ammattiosasto ekspansio -lta farmi.


Vertailu sisäpuolella Pakistan
Haplogroup jakaminen kotona Pakistan väestö, avulla poikkeus -lta Arpapeli ( keskustella kotona lähinnä jakso), aari huomiotaherättävän rinnakkainen jotta ainoa toinen (figs. 1 ja 2), huolimatta jokin merkkihenkilö kielellinen erilaisuus. Jopa, kielenkäyttö eristää- puhuva Burusho, Dravidian- puhuva Brahuis, ja Sino-Tibetan–speaking Balttilainen valmis ei alusta rikki polveutua toinen väestö aikaa aivan kotona haplogroup analysoida ( esittää 2 ja viikuna. 2), ehdottaen jompikumpi että kielellinen erilaisuus ilmaantua jäljessä alhainen Y-kirjain kuvioida laillinen eli että paikalla has riittävä Y-KIRJAIN geeni aaltoilu kesken väestö jotta poissulkea jokin alku- erilaisuus Joko enemmän esittää tarkasti analyysi -lta Y-KIRJAIN haplotypes (e.g., figs. 3–6) ilmaista jokin erillinen erikoisartikkeli -lta Brahui ja aikamoinen asujaimisto erityinen; asujaimisto- erityinen terttu -lta jklle sukua oleva haplotypes aari alhainen perustaa kotona nämä verkko Moinen terttu jälkisäädös ainoa olla hiippakunta tokko väestö aari eristetty polveutua ainoa toinen. Se toukokuu olla että ammua arvo -lta geeni aaltoilu kesken väestö aikana kauan aika on riittävä jotta lopputulos kotona rinnakkainen haplogroup frekvenssi ilman aiheuttaminen usea annos terttu.

Asujaimisto- erityinen terttu -lta haplotypes aari erikoisen ilmeinen kotona jokin väestö. Kotona Arpapeli, johon erillinen haplogroup frekvenssi kuuluisa edellä aari perustaa, enimmät kromosomi (19/23; 83%) syksyinen ardor ainoa -lta kohtuullinen kakkonen kummuta- eristetty terttu (figs. 4 ja 5), kuun taas Kitsastelu, Kalash, ja Burusho kin esitellä etevä terttu. Arpapeli, Kitsastelu, ja Kalash toivoisin olevani kolme väestö vaikutus enimmät merkittävä eri asujaimisto pairwise FST arvo. jalo arvo -lta Arpapeli ja Kitsastelu kanisteri osaksi olla häntä pidetään muotoa ajaksi luona muutto jotta Pakistan polveutua toinen paikoitellen, ainoastaan avustaminen tekijä on uskottava jotta olla ajaa, jompikumpi arvonmukainen jotta rajoitettu joukko -lta perustaa rivimäärä eli että jäljestäpäin sisäpuolella harvalukuinen väestö. Tk arvo (Ewens 1972) ehkäistä elämäntapa -lta rinnastava tehokkaasti asujaimisto koko. Arvo pitää keskuspaikkanaan model after STRs ajaksi Arpapeli, Kitsastelu, Kalash, ja Burushos toivoisin olevani 8.9, 77.5, 25.8, ja 74.2, kukin erikseen, verrattuna avulla alhainen -lta 181.8 ajaksi toinen väestö avulla koettaa koko >20. Tehokkaasti asujaimisto koko ajaksi Y-KIRJAIN kromosomi kanisteri eritä suuresti polveutua henkikirjoitus asujaimisto koko, ainoastaan se on merkkihenkilö että Kitsastelu ja Kalash ajaa hankkia harvalukuinen henkikirjoitus koko, ainoa- sadas eli ainoa- tuhannes -lta enimmät -lta ne -lta toinen väestö (esittää 1), joten nämä harvalukuinen henkikirjoitus koko toukokuu hankkia elättää ajaksi kauan aika. Kotona lyhennelmä, usea erikoisartikkeli -lta läsnä Pakistan Y-KIRJAIN haplotype jakaminen kanisteri olla häntä pidetään muotoa ajaksi luona annos esi-isiltä peritty geeni allas, avulla rajoitettu geeni aaltoilu kesken väestö ja ajaa kotona harvalukuinen itse.


Eläytyminen ardor Asujaimisto Alkuperä
Johdattaa mieleen asujaimisto alkuperä ( esittää 1) kanisteri kas noin olla harkittu kotona kynttilä -lta nämä Y-KIRJAIN lopputulos. Ilmianto on sillä ehdolla luona haplogroup frekvenssi, joka kanisteri olla käytetty jotta aiheuttaa admixture arvioida, ja nämä aari helppo jotta selittää tokko väestö aari avara ja eristetty ja aiheuttaja väestö hankkia eri frekvenssi. Jahka nämä olosuhteet aari ei kattaa, läsnäolo -lta erillinen Y-KIRJAIN rivimäärä kanisteri hiljentää olla informatiivinen alkuperä -lta Kitsastelu aari kummuta- dokumentoitu (Nanavutty 1997) ja niin ehkäistä edullinen koekäyttää asia. He aari kannattaja -lta Iranilainen naisprofeetta Zoroaster, joka muuttaa jotta Etu-Intia jäljessä luhistuminen -lta Sassanian empiirityyli kotona 7th vuosisata a.d. He määrätty kotona 900 a.d. kotona Gujarat, Etu-Intia, johon he toivoisin olevani vieras “Parsi” ( merkitys “from Iran). Lopulta he ehdottaa jotta Mutista kotona Etu-Intia ja Karate kotona Pakistan, polveutua johon läsnä asujaimisto koettaa ( viikuna. 7). Heidän frekvenssi ajaksi haplogroups 3 (8%) ja 9 (39%) ajaa jopa muistuttaa ne kotona Iran enemmän kuin ne -lta heidän ajankohtainen lähimmäinen kotona Pakistan. He esitellä alimmainen frekvenssi ajaksi haplogroup 3 kotona Pakistan (erikseen polveutua Arpapeli; viikuna 1C). alhainen ajaksi kahdeksan Iranilainen väestö 14% (n401=) (kvintetti-Murci et al. 2001), kuun taas että ajaksi Pakistan, poistava Kitsastelu, 36%. olla kirjeenvaihdossa esiintyä ajaksi haplogroup 9 toivoisin olevani 39% kotona Kitsastelu, 40% kotona Iran, ja 15% kotona Pakistan poistava Kitsastelu. Nämä esiintyä lyijyinen jotta by admixture arvioida -lta 100% polveutua Iran ( esittää 3). Kimmoisuus harvalukuinen tehokkaasti asujaimisto koko -lta Kitsastelu, closeness -lta heidän käydä jotta Iranilainen aineisto toukokuu olla sattumanvarainen, ja läsnäolo -lta haplogroup 28 kromosomi aikaa 18% (4% kotona Iran; Kummuta et al. 2001) johtuu mieleen jokin geeni aaltoilu polveutua ympäristö väestö TMRCA ajaksi Kitsastelu- erityinen kasaantua kotona haplogroup 28 verkko 1,800 (600–4,500) ikä (esittää 8), johdonmukaisesti avulla muutto -lta harvalukuinen joukko -lta rivimäärä polveutua Iran Haalari, nämä lopputulos demonstroida lakkauttaa käydä kesken historiallinen arkisto ja Y-KIRJAIN aineisto, ja niin johdattaa mieleen että Y-KIRJAIN aineisto jälkisäädös olla edullinen jahka l;sitellä historiallinen ilmianto on saatavana.

Asujaimisto että on genetically enimmät erillinen, Arpapeli, lunastaa alamäki polveutua Genghis Kaani armeija; heidän maine on johtaa polveutua Iranilainen sana “hazar,” merkitys “thousand,” koska joukot toivoisin olevani jäljelle takainen kotona erillisosasto -lta tuhat. = seur häntäpää -lta 19th vuosisata, jokin Arpapeli ehdottaa polveutua Afganistan jotta Khurram Laakso kotona Pakistan, aiheuttaja -lta näyte tutkia tähän Niin, heidän oraalinen historia tunniste by juontaa kotona Mongolia ja asujaimisto kapeikko ~800 ja ~100 ikä sitten. -lta kakkonen vallitseva Y-KIRJAIN haplogroups läsnä kotona nyt kuluva asujaimisto, haplogroup 1 on laaja kotona Pakistan, hyvin -lta Affair, Eurooppa, ja Amerikka, ja joten ehkäistä vähäinen määrä ilmianto jokseenkin kohta -lta juontaa. Haplogroup 10, kotona asettaa vastakkain, on harvinainen kotona enimmät Pakistan väestö (1.4%, jahka Arpapeli aari poistaa) ainoastaan on alhainen kotona Idänpuoleinen Affair, käsittävä Mongolia, johon se hätäkeino jalkeilla aikana puoli -lta asujaimisto (ilmestymätön lopputulos). Admixture arvioida ( esittää 3) aari johdonmukaisesti avulla aineellinen avustus polveutua Mongolia. BATWING analyysi -lta Arpapeli- erityinen haplotype terttu kotona haplogroups 1 ja 10 johdattaa mieleen TMRCAs -lta 400 (120–1,200) ja 100 (6–600) ikä ( esittää 8), kukin erikseen Niin, perinnöllisyystiede osoittaa on johdonmukaisesti avulla oraalinen muistitieto ja, kotona katsella -lta sen villi laatu, ehkäistä ankara apu ajaksi se ( viikuna. 7).

Jokin toinen johdattaa mieleen alkuperä kokea enemmän rajoitettu apu polveutua Y-KIRJAIN aineisto. Neekeri Makrani, avulla edellytys juontaa kotona Afrikka, ajaa jalo frekvenssi -lta haplogroup 8 kromosomi perustaa kotona jokin Pakistan asujaimisto, koska kuuluisa muualla (Qamar et al. 1999). Nyt kuluva haplogroup on suureksi osaksi rajoittaa jotta ala-- Saharan erämaa Afrikka, johon se asettaa jokseenkin puoli -lta asujaimisto (hana et al. 2001) ja kanisteri niin olla katsella koska merkitsijä -lta Afrikkalainen Y-KIRJAIN kromosomi. Kuitenkin, se hätäkeino jalkeilla ainoa 9% -lta Neekeri Makrani koettaa, ja haplogroup 28 (pitkin avulla toinen karakteristinen Pakistan haplogroups) on läsnä kotona nyt kuluva asujaimisto. Tokko Y-KIRJAIN kromosomi toivoisin olevani aluksi Afrikkalainen ( viikuna. 7), enimmät hankkia jäljestäpäin asettaa takaisin: haalari arvioida -lta Afrikkalainen avustus on ~12% ( esittää 3).

Balttilainen aari ajatus jotta hankkia määrätä jnk asema kotona Tiibet, johon vallitseva haplogroups aari 4 ja 26. Ei kumpikaan läsnä kotona koettaa polveutua nyt kuluva harjoitelma, ehkäisevä ei apu ajaksi Tiibet juontaa -lta Y-KIRJAIN kromosomi rivimäärä ja by admixture arvioida -lta nollata ( esittää 3). Joka tapauksessa, nyt kuluva lopputulos raivo olla tulkki avulla huolellisuus, koska -lta harvalukuinen koettaa koko. Kolme väestö hankkia mahdollinen alkuperä polveutua asevoimat -lta Alexander Erinomainen: Burusho, Kalash, ja Käytävä. Ajanmukainen Kreikan kieli esitellä kohtalaisen jalo frekvenssi -lta haplogroup 21 (28%; Rosser et al. 2000), ainoastaan nyt kuluva haplogroup ei hiippakunta kotona jompikumpi Burusho eli Kalash koettaa ja perustaa kotona ainoa 2% -lta Käytävä, kuun taas ammattiosasto haplogroup 28 läsnä aikaa 17%, 25%, ja 13%, kukin erikseen. Kreikan kieli-admixture arvioida -lta 0% toivoisin olevani ammentaa ajaksi Burusho ja Käytävä, ainoastaan esiintyä -lta 20–40%% toivoisin olevani tarkastaa ajaksi Kalash ( esittää 3). Kotona katsella -lta poisjäänti -lta haplogroup 21, me lukea jkn ansioksi nyt kuluva lopputulos jompikumpi jotta ajaa kotona frekvenssi -lta toinen haplogroups, erikoisen haplogroups 2 ja 1, eli jotta epäkelpo erottelukyky -lta rivimäärä sisäpuolella nämä haplogroups, seuraava kotona erillinen rivimäärä olemassaolo luokiteltu ardor sama paraphyletic haplogroups. Haalari, ei apu ajaksi Kreikan kieli juontaa -lta heidän Y-KIRJAIN kromosomi perustaa, ainoastaan nyt kuluva johtopäätös does edellyttää anastaminen että ajanmukainen Kreikan kieli aari agentti -lta Alexander’s asevoimat. Kakkonen väestö, Cashmere ja Käytävä, kin maallikko lunastaa jotta mahdollinen Juutalainen juontaa Juutalainen väestö alhainen hankkia maltillinen frekvenssi -lta haplogroup 21 (e.g., 20%) ja jalo frekvenssi -lta haplogroup 9 (e.g., 36%; (hana et al. 2000). frekvenssi -lta kumpikin -lta nämä haplogroups aari ammua kotona Cashmere ja Käytävä, ja haplogroup 28 on läsnä aikaa 13% kotona Käytävä, joten ei apu ajaksi Juutalainen juontaa on perustaa, ja admixture arvioida 0% ( esittää 3), joskin, jälleen, nyt kuluva johtopäätös on rajoitettu kumpikin luona harvalukuinen koettaa koko saatavana polveutua Cashmere ja luona anastaminen että ajanmukainen näyte aari agentti -lta antiikkinen väestö.

Johdattaa mieleen juontaa -lta Baluch on kotona Syyria. Syyrialainen, kuin Iranilainen, aari kuvata luona ammua frekvenssi -lta haplogroup 3 ja jalo frekvenssi -lta haplogroup 9 (9% ja 57%, kukin erikseen; Hana et al. 2000), kuun taas olla kirjeenvaihdossa frekvenssi kotona Baluch aari 29% ja 12%. Nyt kuluva erilaisuus ja jalo frekvenssi -lta haplogroup 28 kotona Baluch (29%) ehtiä valtaosa Syyrialainen juontaa ajaksi heidän Y-KIRJAIN kromosomi epätodennäköinen, ja admixture arvioida 0% (esittää 3), joskin 8% frekvenssi ajaksi haplogroup 21, jalo tunniste kotona Pakistan niin l;, does ilmaista jokin lännenfilmi avustus jotta heidän Y-KIRJAIN rivimäärä. Brahuis hankkia mahdollinen juontaa kotona Lännenpuoleinen Affair (Hughes- Luoti 1991) ja se has johdattaa mieleen että aueta -lta haplogroup 9 Y-KIRJAIN kromosomi liittyy jhk avulla ekspansio -lta Dravidian- puhuva farmi ( kvintetti-Murci et al. 2001). Brahuis hankkia jalo frekvenssi -lta haplogroup 9 kromosomi kotona Pakistan (28%) jäljessä Kitsastelu, ehkäisevä jokin apu ajaksi nyt kuluva hypoteesi, ainoastaan heidän jalo frekvenssi -lta haplogroup 3 (39%) on ei karakteristinen -lta Fertiili Paisuen ( kvintetti-Murci et al. 2001) ja johtuu mieleen enemmän kompleksi juontaa, ehkä avulla admixture polveutua myöhempi muutto, moinen koska ne -lta Indo- Iranilainen puhuja polveutua astuva -lta Keskeinen Affair ja toiset polveutua edelleen idänpuoleinen Nyt kuluva mahdollisuus on kannattaja luona etsivä -lta ammua frekvenssi -lta haplogroups 10, 12, ja 13 kotona Brahuis, aivan harvinainen kotona Pakistan ja karakteristinen -lta Idänpuoleinen Affair, Idänpuoleinen ja pohjoinen Affair, ja Kaakko Affair, kukin erikseen.

Epäonnistuminen jotta hankkia Y-KIRJAIN kytkeä avulla johdattaa mieleen asujaimisto -lta juontaa does ei kumota historiallinen assosiaatio, ainoastaan se does demonstroida että Y-KIRJAIN kromosomi johtaa polveutua moinen historiallinen tapahtuma hankkia eksynyt eli asettaa takaisin. Analysoida -lta mitochondrial DNA ja toinen loci auttaa jotta selventää asujaimisto historiankirjoittaja ja olla erikoisen mielenkiintoinen kotona väestö kuin Neekeri Makrani ja Balttilainen, kotona joka paikalla on asettaa vastakkain kesken fenotyyppi ja karakteristinen Pakistan Y-KIRJAIN haplotypes.

Kiitos


Nyt kuluva aikaansaada kannattaja luona Wellcome Holhous Yhteistyö Tutkia Aloite Apuraha jotta S.Q.M. T.Z. kin kannattaja luona Wellcome Holhous, ja C.T.-s-kirjain luona Syöpä Tutkia Olla sotaretkellä. Me esiintuoda meidän arvio jotta alkuperäiskappale DNA lahjoittaja joka kokoonpantu nyt kuluva harjoitelma mahdollinen. Departementti -lta Hyvinvointi -lta Hallinto -lta Baluchistan ja Baluch Lukupää Federaatio, Quetta, Pakistan, auttaa kotona kanto -lta Brahui ja Baluch näyte. Käytävä näyte toivoisin olevani tyyni avulla apu -lta Departementti -lta Paediatrics, Aatelisnainen Lukeneisuus Asettaa Jakaa asteisiin Lääketieteellinen Klinikka, Peshawar, Pakistan Me aari kin kiitollinen jotta Dr. i-kirjain Kazmi ja Aga Kaani Alusta Maalainen Hyvinvointi Apu Ohjelmoida ajaksi heidän apu kotona kanto -lta Burusho näyte. Dr. f-kirjain Sethna sillä ehdolla arvokas apu kotona kanto -lta Kitsastelu näyte. Me kiittää Luis Kvintetti-Murci ajaksi -nsa huomautus model after käsikirjoitus.


Elektroninen- Tietokanta Ilmianto

URLs ajaksi aineisto kotona nyt kuluva artikkeli aari koska harjoittaa:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Verkko 2.0, http:/www.fluxus-engineering.com/.
/ Näköala, http:/forrest.psych.unc.edu/.

Todistus

Ahmad AKN (1952) Jeesus kotona taivas model after kätkeä maahan. Kansalais- ja Sotilas Katsella Oy, Lahore, Pakistan.
Ayub Q, Mohyuddin , Qamar R-kirjain, Mazhar K, Zerjal T-kirjain, Mehdi SQ, Tyler- Seppä C (2000) Identifikaatio ja characterisation -lta ennen näkemätön ihmis- Y-KIRJAIN- kromosomi microsatellites polveutua jakso tietokanta ilmianto. Ydinkäyttöinen Hapan Res 28e8: [ vapauttaa Ml;mellinen kirjoitus kotona PMC].
Backstrom PC (1992) Balttilainen. kotona Backstrom PC, Radloff CF (eds) Sociolinguistic asemakartta -lta pohjoinen Pakistan. Vol 2, Kielenkäyttö -lta pohjoinen kohta Kansallinen Asettaa virkaan -lta Pakistan Luvut, Islamabad, pp 3–27.
Liittyä yhteen HJ, Hylätä P, Rohl (1999) Joukkoviestimet- ottaa osaa jhk verkko ajaksi inferring intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Liittyä yhteen HJ, Hylätä P, Sykes BC, Richards MB (1995) Mitochondrial muotokuva -lta ihmis- väestö kohteleva joukkoviestimet verkko. Perinnöllisyystiede 141743–753: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Kello HW (1979) ratsastuskilpailut -lta Afganistan. Porista- e-kirjain-Meel Julkaiseminen, Lahore, Pakistan.
Kello HW (1998) By kysely ardor etnografia -lta Afganistan Etujoukko Luettelossa, Lahore, Pakistan.
Bergen AW, Wang C- Y-kirjain, Tsai J, Jefferson K, Dey C, Seppä KD, Parkkeerata S-KIRJAIN-C, Tsai S-KIRJAIN-J, Kulta D-KIRJAIN (1999) By Asian–Native Amerikkalainen isällinen rivimäärä tunniste luona RPS4Y resequencing ja luona microsatellite haplotyping. Ann Humista Perinnöllisyystiede 6363–80: [PubMed] [ml;mellinen Kirjoitus].
Bianchi Ei, Bailliet G, Uhittelu CM, Verilöyly RF, Rothhammer F-kirjain, Räystäspääsky-Marignac VL, Rangaistava SD (1997) Juontaa -lta Amerindian Y-KIRJAIN- kromosomi koska johtaa luona analyysi -lta kuusi monimuotoisuus merkitsijä. Olen J Lääke Ihmisenmuotoinen 10279–89: [PubMed] [ ml;mellinen Kirjoitus].
Biddulph J (1977) Heimo -lta Taka- Koosh. Indus Julkaiseminen, Karate, Pakistan.
Burton RF (1851) Sindh ja ratsastuskilpailut että asua laakso -lta Indus. WH Allen ja Yhteis Oy, Lontoo.
Joululaulu O-KIRJAIN (1958) Käytävä. Oxford Korkeakoulu Ahdistaa, Karate, Pakistan.
Casanova M-kirjain, Leroy P, Boucekkine C, Weissenbach J, Lähetti C, Aatetoveri M-kirjain, Purrello M-kirjain, Fiori G, Siniscalco M-KIRJAIN (1985) ihmis- Y-KIRJAIN- kytkeä DNA monimuotoisuus ja sen jännite ajaksi arvioiva perinnöllisyystiede ja evoluutio etäisyys Luonnontiede 2301403–1406: [PubMed].
Kavalkadi-Sforza LL, Menozzi P, Piazza (1994) historia ja maantiede -lta ihmis- geeni. Prinssi Korkeakoulu Ahdistaa, Prinssi.
Laakso GF (1991) ilmiö -lta Indus kulttuuri. kotona Jansen M-kirjain, Hieno musliini M-kirjain, Kaupunki- G (eds) Unohtaa mainitseva model after Indus: aikainen kulttuuri kotona Pakistan polveutua 8th jotta 2nd tuhatvuotinen valtakunta BC. Verlag Filippiiniläinen von Zabern, Meri, Saksa, pp 129–144.
Kannellinen KD (1992) Sociolinguistic asemakartta -lta Pohjoinen Pakistan. Vol 5, Kielenkäyttö -lta Kirjelippu. Kansallinen Asettaa virkaan -lta Pakistan Luvut, Islamabad.
Ewens WJ (1972) koettava teoria -lta selektiivinen epämääräinen alleles. Lause Alhaiso Biol 387–112: [PubMed].
Ankea BF (1992) Ethnologue: kielenkäyttö -lta maailma. Kesä Asettaa virkaan -lta Kielellinen, Dallas.
Hana MF (1994) taannoinen liite -lta by Alu aakkoset model after Y-KIRJAIN kromosomi on edullinen merkitsijä ajaksi ihmis- asujaimisto luvut. Mol Biol Evol 11749–761: [PubMed] [vapauttaa Ml;mellinen Kirjoitus].
Hana MF, Horatius S-KIRJAIN (1995) Y-KIRJAIN kromosomi DNA hajonta ja ihmiset -lta Japani. Olen J Humista Perinnöllisyystiede 56951–962: [PubMed].
Hana MF, Karate TM, Punertava AJ, Jarjanazi H-kirjain, Santachiara-Benerecetti S-kirjain, Soodyall H-kirjain, Zegura SL (2001) Hierarkkinen malli -lta globaali ihmis- Y-KIRJAIN- kromosomi erilaisuus Mol Biol Evol 181189–1203: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Hana MF, Punertava AJ, Puinen ET, Naisen lakki Herra, Jarjanazi H-kirjain, Karate T-kirjain, Santachiara-Benerecetti S-kirjain, Oppenheim , Työtön Filosofian maisteri, Jenkins T-kirjain, Strutsi H-kirjain, Naisen lakki-Tamir B (2000) Juutalainen ja Keskikohta Itäinen ei-- Juutalainen väestö annos alhainen allas -lta Y-KIRJAIN- kromosomi biallelic haplotypes. Proc Natl Akateeminen Sci USA 976769–6774: [ vapauttaa Ml;mellinen kirjoitus kotona PMC].
Helgason , Sigurdardottir S-kirjain, Nikolai J, Sykes B, Kukkula EW, Nasta DG, Bosnes V, Gulcher JR, Holhottava R-kirjain, Stefansson K (2000) Arvioiva Skandinaavi ja Gaelilainen suku kotona koiras- siirtolainen -lta Islanti. Olen J Humista Perinnöllisyystiede 67697–717: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Hughes- Luoti R-KIRJAIN (1991) Pieni pujoparta gazetteer -lta Etu-Intia: ahdasmielinen jakso, Baluchistan. Porista- e-kirjain-Meel, Lahore, Pakistan.
Husaari J (1997) historia -lta kansa -lta Pakistan jtk kohti itsenäisyys. Oxford Korkeakoulu Ahdistaa, Karate, Pakistan.
Ibbetson D-KIRJAIN (1883) Panjab kasti Porista- e-kirjain-Meel, Lahore, Pakistan.
Jarrige JF (1991) Mehrgarh: sen kohta kotona edistyminen -lta antiikkinen viljely kotona Pakistan. kotona Jansen M-kirjain, Hieno musliini M-kirjain, Kaupunki- G (eds) Unohtaa mainitseva model after Indus: aikainen kulttuuri kotona Pakistan polveutua 8th jotta 2nd tuhatvuotinen valtakunta BC. Verlag Filippiiniläinen von Zabern, Meri, Saksa, pp 34–50.
Työtön Filosofian maisteri, Tyler- Seppä C (2000) Veres uses ajaksi veres haplotypes: ihmis- Y-kirjain kromosomi, sairaus ja lajitelma Kehityssuunta Perinnöllisyystiede 16356–362: [PubMed] [ ml;mellinen Kirjoitus].
Karate TM, Zegura SL, Posukh O-kirjain, Osipova L, Bergen , Kauan J, Kulta D-kirjain, Klitz W, Harihara S-kirjain, de Knijff P, Wiebe V, Aarni RC, Kankaan pingotin AR, Hana MF (1999) Esi-isiltä peritty Aasialainen aiheuttaja() -lta veres maailma Y-KIRJAIN- kromosomi perustaa haplotypes. Olen J Humista Perinnöllisyystiede 64817–831: [PubMed] [vapauttaa Ml;mellinen Kirjoitus].
Kayser M-kirjain, Roewer L, Hedman M-kirjain, Henke L, Henke J, Brauer S-kirjain, Kruger C, Krawczak M-kirjain, Nagy M-kirjain, Dobosz T-kirjain, Szibor R-kirjain, de Knijff P, Stoneking M-kirjain, Sajantila (2000) Karakteristinen ja frekvenssi -lta germline mutaatio aikaa microsatellite loci polveutua ihmis- Y-KIRJAIN kromosomi, koska tuli ilmi luona antaa tehtäväksi havainnointi kotona isä/ poika pari. Olen J Humista Perinnöllisyystiede 661580–1588: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Kwok C, Tyler- Seppä C, Mendonca BB, Hughes I-kirjain, Berkovitz GD, Goodfellow PN, Haukka JR (1996) Mutaatio analyysi -lta 2 kb 5' jotta SRY kotona XY naaras- ja XY haudata aihe J Med Perinnöllisyystiede 33465–468: [PubMed].
Kauan JC (1991) perinnöllisyystiede kokoonpano -lta admixed väestö. Perinnöllisyystiede 127417–428: [PubMed] [vapauttaa Ml;mellinen Kirjoitus].
Mathias N, Bayes M-kirjain, Tyler- Seppä C (1994) Ylänkömaa informatiivinen sekoittaa haplotypes ajaksi ihmis- Y-KIRJAIN kromosomi. Humista Mol Perinnöllisyystiede 3115–123: [PubMed].
Mehdi SQ, Qamar R-kirjain, Ayub Q, Kaliq S-kirjain, Mansoor , Ismail M-kirjain, Hana MF, Salainen Isi, Kavalkadi-Sforza LL (1999) alkuperä -lta Pakistan väestö osoittaa polveutua Y-KIRJAIN kromosomi merkitsijä. kotona Nysty SS, Deka R-kirjain, Chakraborty R-KIRJAIN (eds) Genova erilaisuus: ahkeruus kotona ihmis- asujaimisto perinnöllisyystiede Kluwer Akateeminen/ Täysistunto Kustantaja, Veres York, pp 83–90.
Mohyuddin , Ayub Q, Qamar R-kirjain, Zerjal T-kirjain, Helgason , Mehdi SQ, Tyler- Seppä C (2001) Y-KIRJAIN- kromosomi STR haplotypes kotona Pakistan väestö Oikeus- Sci Int 118141–146: [PubMed] [ml;mellinen Kirjoitus].
Nanavutty P (1997) Kitsastelu. Kansallinen Kirjanpidollinen Holhous, Veres Delhi, Etu-Intia.
Panda , Kuningas Ye, Gravel FR, Taylor PG, Thangaraj K, Porista L, Työtön Filosofian maisteri, Tyler- Seppä C (1998) monimuotoisuus ihmis- Y-KIRJAIN- kromosomi G jotta muutos perustaa kotona Etu-Intia. Ind J Humista Perinnöllisyystiede 452–61:.
Qamar R-kirjain, Ayub Q, Khaliq S-kirjain, Mansoor , Karate T-kirjain, Mehdi SQ, Hana MF (1999) Afrikkalainen ja Paeta velkojiaan alkuperä -lta Pakistan Luskuttaa+ Y-KIRJAIN kromosomi. Humista Biol 71745–755: [PubMed].
Quddus SA (1990) heimo- Baluchistan. Ferozsons (Pvt) Oy, Lahore, Pakistan.
Kvintetti-Murci L, Krausz C, Zerjal T-kirjain, Sayar Florin, Hana MF, Mehdi SQ, Ayub Q, Qamar R-kirjain, Mohyuddin , Radhakrishna U, Työtön Filosofian maisteri, Tyler- Seppä C, McElreavey K (2001) Y-KIRJAIN- kromosomi rivimäärä etsiä diffuusio -lta ihmiset ja kielenkäyttö kotona lounainen Affair. Olen J Humista Perinnöllisyystiede 68537–542: [PubMed] [vapauttaa Ml;mellinen Kirjoitus].
Aamutakki DF, Hiorns R-KIRJAIN (1965) Järjestys -lta analyysi -lta perinnöllisyystiede aine -lta sekamuotoinen asujaimisto. Humista Biol 3738–43:.
Robertson GS (1896) Kafirs -lta Hindulainen-Kush. Oxford Korkeakoulu Ahdistaa, Karate, Pakistan.
Rosser ZH, Zerjal T-kirjain, Heitto We, Adojaan M-kirjain, Alavantic D-kirjain, Lemmekäs , Amos W, et al (2000) Y-KIRJAIN- kromosomi erilaisuus kotona Eurooppa on kotkata ja vaikutus ensiksi luona maantiede, aika kuin luona kielenkäyttö. Olen J Humista Perinnöllisyystiede 671526–1543: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Gravel FR, Carvalho- Hopea DR, Rangaistava SDJ (1999a) PCR- pitää keskuspaikkanaan DNA leikkauskuva -lta ihmis- Y-kirjain kromosomi kotona Epplen JT, Lubjuhn T-KIRJAIN (eds) Järjestys ja koristella kotona biosciences ja lääke. Birkhauser Verlag, Takaraja, Sveitsi, pp 133–152.
Gravel FR, Panda , Kayser M-kirjain, Mitchell RJ, Liu , Porista L, Hävittää-Bisol G, Novelletto , Qamar R-kirjain, Mehdi SQ, Adhikari R-kirjain, Knijff P, Tyler- Seppä C (2000) monimuotoisuus L1 retroposon liite kotona centromere -lta ihmis- Y-KIRJAIN kromosomi. Humista Mol Perinnöllisyystiede 9421–430: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Gravel FR, Panda , Tyler- Seppä C, Rangaistava SD, Schanfield M-kirjain, Leonard WR, Osipova L, Crawford MH, Mitchell RJ (1999b) keskeinen Siperia juontaa ajaksi kotimainen Amerikkalainen Y-KIRJAIN kromosomi. Olen J Humista Perinnöllisyystiede 64619–628: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Schneider S-kirjain, Kueffer J- M-kirjain, Roessli D-kirjain, Excoffier L (1997) Arlequin ver 1.1: pehmo ajaksi asujaimisto perinnöllisyystiede aineisto analyysi Perinnöllisyystiede ja Biometry Laboratorio, Korkeakoulu -lta Geeni, Sveitsi.
Seielstad MT, Hebert JM, Lin AA, Salainen Isi, Ibrahim M-kirjain, Vollrath D-kirjain, Kavalkadi-Sforza LL (1994) Konstruktio -lta ihmis- Y-KIRJAIN- kromosomi haplotypes kohteleva veres monimuotoisuus jotta G muutos. Humista Mol Perinnöllisyystiede 32159–1261: [PubMed].
Potka T-kirjain, Tomita K, Nykyisin T-kirjain, Kotliarova SE, Suojanpuoli J, Kuroki Y-kirjain, Jin DK, Tokunaga K, Nakamura H-kirjain, Nakahori Y-KIRJAIN (1999) Perinnöllisyystiede vaihtelu model after Y-KIRJAIN kromosomi kotona Japanilainen asujaimisto ja sekaantuminen ajaksi ajanmukainen ihmis- Y-KIRJAIN kromosomi rivimäärä. J Humista Perinnöllisyystiede 44240–245: [PubMed].
Tuomas MG, Nasta N, Peräytyä HM (1999) Jalo alusta loppuun analyysi -lta 10 microsatellite ja 11 diallelic monimuotoisuus model after ihmis- Y-KIRJAIN- kromosomi. Humista Perinnöllisyystiede 105577–581: [PubMed] [ml;mellinen Kirjoitus].
Tyler- Seppä C (1999) Y-KIRJAIN- kromosomi DNA merkitsijä. kotona Nysty SS, Deka R-kirjain, Chakraborty R-KIRJAIN (eds) Genova erilaisuus: ahkeruus kotona ihmis- asujaimisto perinnöllisyystiede Kluwer Akateeminen/ Täysistunto Kustantaja, Veres York, pp 65–73.
Salainen Isi, Jin L, Lin AA, Mehdi SQ, Jenkins T-kirjain, Vollrath D-kirjain, Davis RW, Kavalkadi-Sforza LL, Oefner PJ (1997) Etsivä -lta lukuisa Y-KIRJAIN kromosomi biallelic monimuotoisuus luona denaturing jalo- esitys juokseva chromatography. Genova Res 7996–1005: [PubMed] [vapauttaa Ml;mellinen Kirjoitus].
Kummuta RS, Yuldasheva N, Ruzibakiev R-kirjain, Salainen Isi, Evseeva I-kirjain, Alakuloinen- Seppä J, Jin L, et al (2001) Euraasialainen sydämetön: mannermainen näköala model after Y-KIRJAIN- kromosomi erilaisuus Proc Natl Akateeminen Sci USA 9810244–10249: [ vapauttaa Ml;mellinen kirjoitus kotona PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Jakso hajonta -lta ihmis- Y-kirjain kromosomi Laatu 378379–380: [PubMed] [ ml;mellinen Kirjoitus].
Wilson IJ, Kaljuuntua TISKIJUKKA (1998) Sukututkimus- johtopäätös polveutua microsatellite aineisto. Perinnöllisyystiede 150499–510: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Wolpert S-KIRJAIN (2000) veres historia -lta Etu-Intia. Oxford Korkeakoulu Ahdistaa, Veres York.
Nuori FW, Lippu CM (1996) näkö statistiikka elimistö. kotona Karvastella RA, Kettu J (eds) Statistinen arvioiden elinympäristö ajaksi seura- etsintä. Filosofi Julkaiseminen, Veres York, pp 207–236.
Zerjal T-kirjain, Nyökkäys L, Nyökkäys G, Mikelsaar AV, Krumina , Kucinskas V, Heitto We, Tyler- Seppä C (2001) Maantieteellinen, kielellinen, ja kulttuuri- vaikute model after perinnöllisyystiede erilaisuus: Y-KIRJAIN- kromosomi jakaminen kotona Pohjoinen Eurooppalainen väestö. Mol Biol Evol 181077–1087: [PubMed] [ vapauttaa Ml;mellinen Kirjoitus].
Zerjal T-kirjain, Dashnyam B, Panda , Kayser M-kirjain, Roewer L, Gravel FR, Schiefenhovel W, Fretwell N, Työtön Filosofian maisteri, Harihara S-kirjain, Hohtaa K, Semjidmaa D-kirjain, Sajantila , Salonki P, Crawford MH, Ginter EK, Evgrafov OV, Tyler- Seppä C (1997) Perinnöllisyystiede yhteys -lta Aasialainen ja Pohjoinen Eurooppalainen, tuli ilmi luona Y-KIRJAIN- kromosomi DNA analyysi. Olen J Humista Perinnöllisyystiede 601174–1183: [PubMed].

 

Hotellipoika kestää ajantasaistaa: Friday, November 25, 2005 23:10:49 -0500