Genetiken

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Kromosomen DNA Variationen i Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Chris Tyler- Smed och så. Qasim Mehdi1

1Biomedical och Genetisk ingenjörsvetenskapen Division, Dr. en Q. Khan Forska Laboratorium, Islamabad; 2Cancer Forska Kampanj, Kromosomen Molekylar Biology Grupp, Avdelning av Biochemistry, och 3Institute av Biological Antropologien, Universitet av Oxford, Oxford, Förenat Kungarike; och dechiffrera Genetiken, Reykjavik.


Abstrakt Begreppen

Arton binär polymorphisms och 16 multiallelic, kort-tandem- upprepa (STR) loci från nonrecombining portion om mänsklig Y kromosomen var skrift på maskin i 718 mansperson undersåten tillhöra till 12 etnisk grupperna av Pakistan. De här kännemärken 11 stabil haplogroups och 503 kombination binär märkaren/STR haplotypes. Haplogroup frekvens var vanligvis lik till den här i neighboring geografisk områdena, och den Pakistansk befolkningen talande en språk isolera ( den Burushos), en Dravidian språk ( den Brahui), eller en Sino-Tibetan språk ( den Baltisk) liknat den Indo-European–speaking majoriteten Inte desto mindre, median- blir med nätverken av haplotypes avslöja betydande substructuring av Y variationen inom Pakistan, med många befolkningen visande tydlig klungen av haplotypes. De här monstera kanna bli redovisa för vid en gemensam pöl av Y arvföljd, med verklig isolering emellan befolkningen och driva inne om mindre en Få relativ genetisk eller historisk datan de/vi/du/ni är tillgänglig för mest befolkningen, utom den resultaten kanna bli jämförde med muntlig tradition omkring ursprungen Den Y datan stöd den brunn- fast ursprungen om Analysen i Iran, den antyd nedgången om Slump från Genghis Khan’s armé, och ursprungen av den Negern Makrani i Afrika, utom inte stöd tradition av Tibetan, Spruta, Grek, eller Judisk ursprungen för annan befolkningen.


Introduktion

Den tidigt bevis av Paleolithic mänsklig fånge inne om Söder Asien består av sten realisera grunda sprid runt omkring den Soan Flod Dal i nordlig Pakistan (Hussain 1997). Trots den brist på fossil bevis, de här redskapen framträda till ange närvaron av hominids inne om Söder Asien så tidlig som 200,000–400,000 åren för ... sedan (Wolpert 2000) och sålunda de/vi/du/ni är sannolik till har blitt förbundet med arkaisk Homo arten. Pakistan lies på det postulat sydost kust rutt följde efter vid anatomisk modern Homo Sapiens ute om Afrika, och så Maj har blitt befolkat vid modern mänsklig så tidlig som så 60,000–70,000 åren för ... sedan. Där er bevis av grotta dväljas i Pakistan nordväst gränsen, utom fossil bevis från Paleolithic har blitt fragmentarisk (Hussain 1997). Bevis er blitt avtäckt på Mehrghar, i sydväst Pakistan, antydande Neolithic bosättning från så for länge siden så 7,000 b.c. (Jarrige 1991), vilken var följde efter vid den Förmå Dal civilizations ( inklusive staden av Plåga och Mohenjodaro) så pass blomstra inne om 3d och 2d millennia b.c. (Dales 1991). Runt omkring 1500 b.c., den Indo-European–speaking nomad herde folkstam från längre bort north—often alarmerat den Aryans—crossed den Karakorum Fjällen in i Söder Asien. Följande historisk händelsen omfatta den invasion av Alexandria den Stor (327–325 b.c.) och den Araber och Muslim erövring från 711 a.d. framåtriktad (Wolpert 2000).

Den föreställa befolkning av Pakistan består av mer än 160 miljonen individuella ( i den mån som till 2005 VEM sillarna) vem höra till det vill si 18 etnisk grupperna och tala mer än 60 språken ( smuts 1992). Högst omen de här språken de/vi/du/ni är Indo- Europeisk, utom de också omfatta en isolera, Burushaski; en Dravidian språk, Brahui; och en Sino-Tibetan språk, Baltisk. Punjabi- talande individuella form majoriteten befolkning av Pakistan, utom de representera en komplex tillsatsen av etnisk grupperna (Ibbetson 1883) och blandar inte analyser här; 12 etnisk grupperna de/vi/du/ni är omfattat inne om föreställa överblick. informationen tillgänglig omkring dem är sammanfattning i bord 1, tillsammans med hypotesen omkring deras ursprungen (Mehdi et al. 1999). Fastän något av de här hypotesen de/vi/du/ni är brunn- stöttat (e.g., den ursprungen om Analysen i Iran), mest de/vi/du/ni är baserat på muntlig tradition och har inte blitt provat emot annan källan av bevis.

Knapp genetisk datan de/vi/du/ni är tillgänglig för de här Pakistansk etnisk grupperna Tidigt studier av den ABO blod grupperna och klassisk proteinet märkena inkluderade inte all grupperna och mest klassificerad dem alt efter deras ställe av bostad. EN befolkning träd baserat på 54 klassisk enzymen märkena ställen den Slump och Stig inne om Väster Asiaten klunga innehållet den nordlig Caucasoids (kavalkad-Sforza et al. 1994). I en annan befolkning träd, baserat på 47 klassisk proteinet polymorphisms, den Pakistansk prov form en liten subcluster inom den Indo- Europeisk talaren från Indien ( kavalkad-Sforza et al. 1994).

Den Y kromosomen skaffar en unik källa av genetisk bevis (Tyler- Smed 1999; Arbetslös och Tyler- Smed 2000). Den bära den störst nonrecombining avsnitten i den Genova och innehåll talrik stabil binär märkena, inklusive tarvlig ersättandet (se, e.g., Lömsk et al. 1997) och retroposon insättanden ( hammare 1994; Santiago et al. 2000), vilken kanna bli brukat i kombination med mer- hurtig utviklande märkena, sådan som microsatellites (se, e.g., Ayub et al. 2000). Följaktligen, mycket specificerat Y phylogenies kanna bli bygget så pass tillåta mansperson- bestämd aspekterna av genetisk historia till vara undersöka. De här de/vi/du/ni är stark ha inflyttande på vid den liten effektiv befolkning storlek om det box Y kromosomen, ledaren till hastig genetisk driva, och vid praxisen av patrilocality i många samfund, ledaren till hög nivån av geografisk differentieringen av Y haplotypes. Oaktat den verk av Qamar et al. (1999) på det analys av YAP+ kromosomen ( inbegripa ~2.6% om räkna samman) och analyser av STR variationen (Ayub et al. 2000; Mohyuddin et al. 2001), litten verk er blitt genomför på Pakistansk Y kromosomen. Därför, vi har nu utfört en vidsträckt analys av Pakistansk Y arvföljd, till avgöra vad ljus de kanna skjul på det ursprungen och genetisk historia om under gruppen så pass kosmetika den Pakistansk befolkning.


Material och Metoderna

Prov
Den Y kromosomen av 718 obesläktad mansperson undersåten, tillhöra till 12 etnisk grupperna av Pakistan, var analyser (borden 1 och 2; fikon. 1). Informerat samtycke var få från all siden deltagarna i den här studera. En Epstein Barr virus–transformed lymphoblastoid cell lina blev grundlagt från var individuell, och DNA var utdraget från de här cell linjen för analys.


Binär Polymorphism Maskinskrivning
Vi skrift på maskin 15 SNPs, en Alu insättanden ( hammare 1994; Hammare och Horai 1995), en Lina insättanden ( Santiago et al. 2000), och den 12f2 strykningen (Casanova et al. 1985). Basisten ersättandet var 92R7 C?T (Mathias et al. 1994); M9 C?G ( lömsk et al. 1997); SRY-2627 C?T (Bianchi et al. 1997); SRY-1532 enG?EN (Whitfield et al. 1995; Kwok et al. 1996; Santiago et al. 1999b); sY81 (DYS271) En?G (Seielstad et al. 1994); SRY-8299 G?En (Santiago et al. 1999a); Lämplig G?EN (Pandya et al. 1998); SRY +465 C?T ( smalben et al. 1999); LLY22g C?EN och Tat T?C övergång (Zerjal et al. 1997). Dessutom, den M17 märkaren ( lömsk et al. 1997) var skrift på maskin, vid använda om grundfärgen GTGGTTGCTGGTTGTTACGT och AGCTGACCACAAACTGATGTAGA följde efter vid AflIII äcklig om PCR produkt; den börd allele slog inte sammandrag Den M20 märkaren (lömsk et al. 1997) var anleggspreg, vid använda av den grundfärgen CACACAACAAGGCACCATC och GATTGGGTGTCTTCAGTGCT följde efter vid SspI äcklig; den En?G mutation förstöra tomten på position 118 inne om 413-bp produkt. M11 (lömsk et al. 1997) var skrift på maskin, användande den grundfärgen TTCATCACAAGGAGCATAAACAA och CCCTCCCTCTCTCCTTGTATTCTACC följde efter vid äcklig med MspI. Den 215-bp produkt var sammandrag till 193-bp och 22-bp fragmenten inne om drog allele. Den RPS4Y C?T mutation (Bergen et al. 1999) var upptäckt vid BslI begränsningen äcklig av en 528-bp PCR produkt få vid använda om grundfärgen CCACAGAGATGGTGTGGGTA och GAGTGGGAGGGACTGTGAGA. Den börd C allele innehåll två tomten, och den drog T allele innehåll en. M48 (lömsk et al. 1997), enG, var skrift på maskin vid allele- bestämd PCR användande den skiljande grundfärgen TGACAATTAGGATTAAGAATATTATA och TGACAATTAGGATTAAGAATATTATG och den gemensam grundfärgen AAAATTCCAAGTTTCAGTGTCACATA till generera bestämd 145-bp produkten Sätten av Y binär märkaren alleles bar vid en enkel individuell vilja bli hänskjut till så “the Y haplogroup.”
Om 718 prov, 717 fälla till jord in i haplogroups väntat på det basis om den känt phylogeny, utom en Stig prov (PKH134) lott vare å betala utvidga på den SRY –1532 och M17 loci. Han var anvisat till haplogroup 3 på det basis om av alternativ SRY –1532 grundfärgen ( detaljerna på anmodan) och hans STR profil.


Y-STR Maskinskrivning
Fem trinucleotide- upprepa polymorphisms (DYS388, DYS392, DYS425, DYS426, och DYS436), tio tetranucleotide- upprepa polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, och DYS439) och en pentanucleotide microsatellite (DYS438) var skrift på maskin i all Y kromosomen. Tre flerfaldig PCR reaktionerna var utfört för all Y-STRs, i a10-µl final reaktionen volym innehållet 20 ng Genova DNA, så beskrev någon annanstans (Thomas et al. 1999; Ayub et al. 2000). PCR produkten var springa på en ABI 377 ordningsföljd. ABIGS350 TAMRA var använd så den inre smal väg standaren. Den TILBLIVELSE och ANLEGGSPREG mjukvaran packarna var använd till samla den datan och till analyser stycke storleken Y-STR alleles var benämn alt efter antalen av upprepa enheten de contain.The antal av upprepa enheten var fast igenom den använda av ordningsföljd hänvisningen DNA prov. Allele längden för DYS389b var få vid subtraktion om DYS389II allele längd från DYS389I.
Y-STR fördubblande var grunda på flera loci. DYS393 var duplicerat i PKH165 (13 och 15) och DYS437 var duplicerat i SDH181 (8 och 9). EN mer komplex model var grunda i DYS425, var två till fyra alleles var grunda i 36 individuella från haplogroups 8, 9, 13, och 21.


Datan Analys
Huvudsaklig- komponenterna analys var genomför på haplogroup frekvens vid använda om ViSta ( visuell Statistiken) system mjukvaran, version 5.0.2 (ung och Förbjudet 1996). För grafiken framställande, den första och andra huvudsaklig komponenterna var tegna vid den Mikroskop Kontor Sviten Excellera Packe på Fönstren 2000. Biallelic polymorphism datan för olika värld befolkningen använd inne om analys var få från Hammare et al. (2001). Tillsatsen var beräknat vid använda av tre olik mått: Lång överlastat minst- fyrkant (WLS) mått ( lång 1991); mR, en minst- fyrkant uppskattning (Robert och Hiorns 1965); och m? (Helgason et al. 2000).
Analys av molekylar skiljaktig (AMOVA) var genomför vid använda om Arlequin packe (Schneider et al. 1997). AMOVA mått proportionsena av mutational isärgående grunda inom och emellan befolkningen, respectively. Fastän mycket om variationen på den hurtig mutating microsatellite loci är väntat till har blitt producerat i den olik Pakistansk subpopulations, den unik mutation händelsen på den binär loci de/vi/du/ni är mycket gammalt och har inte händelse inne om sammanhangen om subdivision om Pakistansk befolkning. Vi konstruerat den följande strategi till exploatera den maximum belopp av relevant mutational informationen från den Y- kromosomen haplotypes. STR variationen inom haplogroups var använd till beräkna befolkning pairwise FST värden för var individuell haplogroup. För var befolkning para samman, en överlastat snål FST var beräknat, var vadaren få för var haplogroup var överlastat alt efter proportionen av pairwise jämförelserna invecklas så pass haplogroup. Inne om frånvaro av en särskild haplogroup från en befolkning, En, om para samman EN och B, FST var sätta till 1, och antalen av pairwise jämförelserna var tog så antalen av kromosomen bringar så pass haplogroup i B. Värden av FST baserat på STRs ensam eller på STRs plus binär märkena, med binär märkena givit en 10- veck höger överlastande, var beräknat för jämförelse. I all av de här analyser, avstånden matris använd bestod om antal av stammen hur var para samman av haplotypes skillnad. Mantel proverna för den mening av correlations emellan FST värden var bar ute i Arlequin, och multidimensional bestiger (MDS) komplotterna var bygget vid använda om SPSS version 7.0 mjukvaran packe.

Median- blir med nätverken var bygget vid Nätverken 2.0b ( banderol et al. 1999). EN överlastande intrigera med en fem- veck ställa i rad var använd inne om konstruktion om nätverken. Den vikten anvisat var bestämd för var haplogroup och tog med i beräkning den Y-STR variationen över den haplogroup i den helhet Pakistansk befolkning. Den följande vikten var använd skiljaktig 0-0.09, vikt 5; skiljaktig 0.1-0.19, vikt 4; skiljaktig 0.2-0.49, vikt 3; skiljaktig 0.5-0.99, vikt av 2; och skiljaktig 1.00, vikt 1. Trots den här, nätverken för haplogroup 1 innehållet många hög dimensionell kuberna och var beslutat vid använder den nedsatte median och median blir med nätverken metoderna följande. nedsatte median algoritmen (banderol et al. 1995) var använd till generera en *.rmf arkivera och den median blir med nätverken metod var praktisk till den här arkivera.

BATWING (Wilson och Skallet 1998), Bayesian Analys av Trän Med Inre Nod Generation, var använd till uppskattning den tid till mest ny gemensam stamfader (TMRCA) av en sätta av kromosomen. Den här program använda en Märke kedja Monte Carlo procedur till generera phylogenetic trän och förbundet parametern värden konsekvent med insatsen datan ( en sätta av Y haplotypes) och genetisk och demographic modellerna Den genetisk modell antar enkel- steg mutations om STRs och den demographic modell väljare var exponenten växten från en i början ständig- storlek befolkning, med eller utan subdivision i olik springa om program All 16 STR loci var använd; locus- bestämd mutation hastighet tidigare sannolikhet baserat på datan av Kayser et al. (Kayser et al. 2000) var bygget för den loci tillgänglig så gamma distributionerna om form gamma(, b) var en = (1 + antal av mutations observera vid Kayser et al.), och b = (1 + antal av meioses). För loci inte undersöka vid Kayser et al., distributionen gamma (1,416) var använd, vilken har en snål av 0.0024. EN generation tid av 25 åren var anta. Sålunda den 95% förtroende intervallerna givit ta med i beräkning osäker i mutation hastighet, befolkning växten och ( var lämplig) subdivision, utom inte generation tid.

Resultaten

Y- Kromosomen Binär Polymorphisms
Den 18 binär märkena använd identifiera 20 haplogroups i worldwide befolkningen fikon 1A), utom bara 11 var grunda i Pakistan, och 5 redovisa för 92% om prov ( fikon. 1 och bord 2). Haplogroups 1 och 9 var föreställa i all Pakistansk befolkningen undersökat, haplogroup 3 var föreställa i all utom den Slump, och haplogroup 28 var föreställa i all utom den Slump och den Kashmiris. Sydväst befolkningen utställning höger frekvens av hg 9 och den YAP+ haplogroups 21 och 8 än nordost befolkningen ( fikonen. 1D–E), utom, rock, litten geografisk klunga av haplogroup frekvens är synbar inom den land.


Huvudsaklig- Komponenterna Analys
Vi önskat till jämföra den Pakistansk Y haplogroup datan med datan från befolkningen från vila om värld. Nej passande datan sätta var tillgänglig för helheten sätta av 18 märkena, utom den datan av Hammare et al. (2001) tillåtet nästen 5 till vara använd, emedan den samma eller phylogenetically motsvarande märkena var rapportera. huvudsaklig- komponenterna analys fikon 2A) visar något differenserna från original analys av Hammare et al., den huvudsaklig en varelse den mindre separeringen om Afrikaner befolkningen. Den här ved hjälp av, en stor utsträckning, till subset av märkena använd, vilken gör inte omfatta många om Afrika- bestämd en. Mest Pakistansk befolkningen klunga med Söder Asiaten och Mellersta Östlig befolkningen, och de/vi/du/ni är nära till Nordlig Afrikaner, Central Asiaten och Europeisk befolkningen, sålunda visande en general likheten med geografisk nära befolkningen. Den en undantagen är den Slump, vem de/vi/du/ni är helt tydlig. EN lik analys om Pakistansk befolkningen ensam, användande all om binär märkena ( fikon. 2B), bekräftar differensen i mellan dem Slump och den annan befolkningen samt mer klar visar tydligheten om Kalash och den Analysen. Den slår till så pass språken isolate–speaking Burusho och den Dravidian- talande Brahuis löp inte ute i de här analyser.


Tillsatsen Värderingen
Hypotesen omkring befolkning ursprungen ( bord 1) kanna bli betraktat som så kvantitativ spörsmålen omkring tillsatsen. För exempel, till prov den möjlighet så pass den Baluch Y kromosomen har en Spruta ursprungen, vi kanna fråga vad proportion om Baluch Ys de/vi/du/ni är drog från Spruta och vad proportion de/vi/du/ni är från Pakistan ( betraktat som till vara den Pakistansk prov minus den Baluch). Datan på antyd källa befolkningen var tog från litteratur och tre mått av tillsatsen var beräknat. Den tre värderingen gav bred konsekvent resultaten, med liten systematisk differenserna typiskt m? > mR > Lång WLS för den beräknat bidragen från yttre källa befolkning ( bord 3). De här resultaten skaffa bevis för en yttre bidragen till Slump, Kalash, Negern Makrani, och Analysen utom inte till den annan befolkningen.


Y- Kromosomen STR Polymorphisms
Y-STR polymorphisms var studier till få en mer specificerat syn av Y variationen, bland den olik Pakistansk etnisk grupperna, så pass skulle bli mindre förutfattat vid den märkaren-ascertainment procedur Olikheten av Y-STR haplotypes ( bord 4) var lägst för den Slump (0.893) så antyd vid föregående analyser (Ayub et al. 2000).
Den 16 Y-STRs definierat 502 Y haplotypes, den vidsträckt majoritet varelse observera i enkel individuella Den resterande haplotypes var delat vid 2–18 individuella ( detaljerna de/vi/du/ni är givit inne om online- bara tillagd bord). I all sakerna utom en, den kromosomen delar en haplotype tillhöra till samma haplogroup ( hejduk, 503 kombination haplotypes) och, i de mest tillfälle, den individuella delar en haplotype tillhöra till samma befolkning (bord 5).

Den GST och modal storlek om det box upprepa enhet, för all 16 Y-STRs undersökat inne om Pakistansk befolkning, de/vi/du/ni är givit i bord 6. Den korrigerat emellan märkaren heterozygosity och GST var grunda inte till bli betydande (r0.329=; P=.213). Den modal storlek och skiljaktig om 16 Y-STRs inom haplogroups 1, 2, 3, 8, 9, 10, 21, 26, och 28 är också givit i bord 6. Säker haplogroups har en olik modal allele storlek, och något exemplen av den här de/vi/du/ni är vist i fet kursiven i bord 6. För exempel på, DYS388 har 15 repeterar i haplogroup 9, jämförde med 12 repeterar i högst omen den annan haplogroups i Pakistan. På liknande sätt, den modal allele för DYS438 är 9 i haplogroup 9, utom 10 eller 11 inne om annan haplogroups. Den modal allele för DYS434 för haplogroup 10 är 11, vilken är slående olik från allele storlek om boxen den här locus i annan haplogroups. Den komplett brist på variability för DYS436 inne om 233 mansperson undersåten tillhöra till haplogroup 3 är märklig. Haplogroup 10 kommer till har den minst variability över mest loci utom för DYS390 ( bord 6). De här resultaten demonstrera den stark struktural av Y-STR variability vid haplogroup.

Vi viljat till beräkna en Y- baserat mått av genetisk distans emellan befolkningen så pass skulle reflektera differentieringen så pass har händelse inom Pakistan och så pass skulle inte bli oproportionerligt dominera vid forntida differenserna så pass har tidigare ackumulerat emellan haplogroups. Standaren väg till gör den här skulle bli till använda STR variationen, och bord 7 sammanfattning befolkning pairwise värden av FST på det basis av STR variationen ensam ( en) eller av binär- märkaren plus STR variationen (B), med binär- märkaren differenserna överlastat 10 tiden höger än STR differenserna. De här matrisen de/vi/du/ni är högt korrigerat (r0.95=; P.001<), så makt bli väntat från struktural av STR variationen vid haplogroup. Hur ... än, de här mått de/vi/du/ni är betydande under inflyttande fram forntida differenserna, och vi har därför vecklat upp en modifierat mått. Vi skäl så pass mycket om STR variationen inom haplogroups skulle har härröra i den senaste tid och kunde bli brukat för den här purpose.Nous avons beräknaé donc par para samman des liten dal de befolkning de FST, sur la tarvlig du STR variationen dans des haplogroups, et utilisé une moyenne peseé de ces derniers hälla produkter une matrisen enkel de distans de FST ( bord 7C ; figue. 3) De här avstånden de/vi/du/ni är också högt korrigerat med avstånden baserat på STRs ensam (r0.76=; P.001<) eller på STRs plus binär märkena (r0.70=; P.001<), utom en betydlig proportion om variationen är sett emellan befolkningen (22%, jämförde med 6% och 7%, respectively). EN jämförelse av siffra 3 med siffra 2B ( vilken var baserat på binär märkaren frekvens ensam) avslöja en slående rock likhet, med det Slump varelse tydlig från all siden om annan befolkningen. Den annan framstående befolkningen de/vi/du/ni är den Kalash och Analysen (som för), den Kashmiris (kanske på grund av den liten prov), och den Brahuis, vem de/vi/du/ni är sålunda mer tydlig i deras STR profilerna än haplogroup frekvens. MDS komplotterna om avstånden i borden 7A och 7B (inte vist) före till lik sluttningarna, utom likna siffra 2B mer undersök saken grundlig i vägen så pass den Brahuis löp inte ute så mycket.


Median- Blir med Nätverken
Den genetisk förhållandena bland den olik Pakistansk etnisk grupperna var utforska längre bort vid dragandet median- blir med nätverken ( banderol et al. 1995), och exemplen de/vi/du/ni är vist i sillarna 4, 5, och 6. Den haplogroup 1 nätverken fikon 4) avslöja betydande variationen, utom också en hög grad av befolkning- bestämd substructure. För exempel, den 24 Analysen haplogroup 1 kromosomen all falla in i en av tre klungen ( fikon. 4, grön), 19 av 26 Burusho haplogroup 1 kromosomen falla in i två klungen ( blå), och 12 av 14 Slump haplogroup 1 kromosomen falla in i en enkel klunga, och all av de här klungen de/vi/du/ni är bestämd till deras respektera befolkningen. Den haplogroup 10 nätverken fikon 5) är mycket mer enkel, på grund av den mindre antal av kromosomen, utom igen avslöja befolkning- bestämd klunga för Burusho och Slump haplotypes. Den haplogroup 28 nätverken ( fikon. 6) visar en slående isolera Analysen- bestämd klunga, bak i en lång gren, innehållet 15 av 16 Analysen haplogroup 28 kromosomen. Klungen av Kalash, Burusho, and—to en mindre degree—Baluch kromosomen de/vi/du/ni är också tydlig, fastän en Baluch haplotype är delat med Sindhi och Makrani Baluch individuella från närbelägen sydost befolkningen.
BATWING TMRCAs var beräknat för den haplogroup 28 nätverken och för valde arvföljd inom et antal haplogroups. Den resultaten de/vi/du/ni är sammanfattning i bord 8.

Diskussionen

Vi har genomför den första vidsträckt analys av Y olikheten inom Pakistan, undersökande 34 märkena i 718 mansperson undersåten från 12 befolkningen Den här tillåt oss till jämföra Pakistansk Y olikheten med så pass tidigare rapportera i värld befolkningen, till undersöka differenserna inom Pakistan, och till bedöma något om den antyd befolkning historia från en Y perspektiv.


Jämförelserna med Worldwide Datan
I en worldwide jämförelse, Pakistansk befolkningen mest klunga runt omkring en pöl Söder Asiaten prov och lögn nära till en Mellersta Östlig prov ( fikon. 2A). Den här uppfinnande är unsurprising, i del emedan den Söder Asiaten prov omfattat 62 Pakistansk individuella (i.e., 32% av 196 räkna samman) och i del emedan Y variationen i många områdena om värld är dominerande strukturellt vid geografi, inte vid språk eller etnisk upptaganden (Rosser et al. 2000; Zerjal et al. 2001). Den betydlig genetisk likheten av Pakistansk befolkningen till den här inne om väster än till östlig befolkningen är belyst vid faktumet så pass fyra om fem frekvent haplogroups i Pakistan (haplogroups 1, 2, 3, och 9, vilken tillsammans kosmetika 79% om räkna samman befolkning) de/vi/du/ni är också frekvent i västlig Asien och Europa utom inte i Porslinet eller Japan; omvänd, den haplogroups så pass de/vi/du/ni är frekvent i Öster Asien (e.g., 4, 5, 10, 13, och 20) de/vi/du/ni är sällsynt eller frånvarande i Pakistan, formande bara 2.5% om räkna samman Om, så i något förklaringen, en tidigt folkvandring från Afrika längs den sydost kust av Asien smal avsats till första anatomisk modern mänsklig befolkningen i Pakistan, och de här folk bar den östlig haplogroups eller deras precursors, deras Y kromosomen har nu blitt till stor ersätt vid följande migrations eller genen flöde; verkligen, representanterna om östlig haplogroups i Pakistan Maj bli drog från modern rygg- flytta, inte från forntida överlevanden.

Den femte haplogroup så pass är gemensam i Pakistan, haplogroup 28, skilj sig åt från all siden den självaste i sin distributionen. Inom Pakistan, den gjord upp 14% av vår prov och var föreställa i nästen två befolkningen ( båda om vilken har mycket liten prov storleken), så den er båda gemensam och vidsträckt Utsida Pakistan och den närbelägen land, hur ... än, den er sällsynt. Den er blitt rapportera i Indien (30%; föreställa i 3/3 befolkningen), Tajikistan (10%; föreställa i 5/6 befolkningen), och Uzbekistan (3%; föreställa i 10/13 befolkningen), utom den er sällsynt i Ryssland (0.4%; föreställa i 1/6 befolkningen) och den Kaukasien (1.4%; föreställa i 1/6 befolkningen (brunn et al. 2001) och har inte blitt grunda i det hel tåt i Porslinet eller Mongolia ( opublicerad observationerna BATWING värderingen om TMRCA om Pakistansk haplogroup 28 kromosomen var ~7,000 (4,000–14,000) åren ( bord 8). Sålunda, inom den hår time period, den Pakistansk befolkningen har dykaren från en gemensam börd befolkning eller har upplevat betydande mansperson genen flöde emellan sig eller från en gemensam källa. Sedan dess den beräknat ålder korresponderar till tidigt Neolithic period, den breda ut av den här arvföljd makt bli förbundet med den lokal utbredande av lantbrukarna.


Jämförelserna inom Pakistan
Haplogroup distributionerna i Pakistansk befolkningen, med det undantag om den Slump ( debatterat inne om nästa del), de/vi/du/ni är slående lik till en annan ( fikonen. 1 och 2), trots något märklig språklig differenserna. Verkligen, språken isolera- talande Burusho, den Dravidian- talande Brahuis, och den Sino-Tibetan–speaking Baltisk löp inte ute från annan befolkningen i det hel tåt inne om haplogroup analyser ( bord 2 och fikon. 2), förslagen endera så pass den språklig differenserna dunket upp efter den gemensam Y model blev grundlagt eller så pass där er blitt tillräcklig Y genen flöde emellan befolkningen till eliminera någon initial differenserna Ändå en mer specificerat analys om Y haplotypes (e.g., fikonen. 3–6) avslöja något tydlig dragen om Brahui och betydande befolkning bestämd; befolkning- bestämd klungen av berättat haplotypes de/vi/du/ni är vanligen grunda i de här nätverken Sådan klungen vilja bara synas om befolkningen de/vi/du/ni är isolera från en annan. Den Maj bli så pass en låg grad av genen flöde emellan befolkningen över for långe siden är tillräcklig till resultera inne lik haplogroup frekvens utan producerande många delat klungen.
Befolkning- bestämd klungen av haplotypes de/vi/du/ni är speciellt tydlig i något befolkningen. Inne om Slump, var den tydlig haplogroup frekvens antecknat över de/vi/du/ni är grunda, mest kromosomen (19/23; 83%) falla in i en av rättvis två brunn- isolera klungen ( fikonen. 4 och 5), var den Analysen, den Kalash, och den Burusho också utställning utsående klungen. Den Slump, Analysen, och Kalash var den tre befolkningen visande mest betydande olik befolkning pairwise FST värden. Den hög värden om Slump och Analysen kanna delvis bli redovisa för vid flytta till Pakistan från annan ställen, utom en bidrar faktorn är sannolik till vara driva, endera del till en inlemmat antal av grundaren arvföljd eller händelse därefter inom liten befolkningen. Tk värden (Ewens 1972) skaffa en väg av jämförande effektiv befolkning storleken. Värden baserat på den STRs för den Slump, Analysen, Kalash, och Burushos var 8.9, 77.5, 25.8, och 74.2, respectively, jämförde med en snål av 181.8 för den annan befolkningen med prov storleken >20. Effektiv befolkning storlek för Y kromosomen kanna vara olik högste från folkräkning befolkning storlek, utom den er märklig så pass den Analysen och Kalash gör har den minst folkräkning storleken, en- hundraden eller en- tusende av högst omen den här om annan befolkningen (bord 1), så de här liten folkräkning storleken Maj har blitt upphäll i lang tid. I sammanfattning, många dragen om föreställa Pakistansk Y haplotype distributionerna kanna bli redovisa för vid en delat börd genen pöl, med inlemmat genen flöde emellan befolkningen och driva inne om mindre en.


Inblicken in i Befolkning Ursprungen
Den antyd befolkning ursprungen ( bord 1) kanna nu bli betraktat som i lyset av av de här Y resultaten. Informationen är försynt vid haplogroup frekvens, vilken kanna bli använd till produkter tillsatsen värderingen, och de här de/vi/du/ni är lätt till tolka om befolkningen de/vi/du/ni är stor och isolera och källan befolkningen har olik frekvens. När de här författningarna blandar inte mötte, närvaron av tydlig Y arvföljd kanna stilla bli upplysande Den ursprungen om Analysen de/vi/du/ni är brunn- dokumenterat (Nanavutty 1997) och sålunda skaffa en nyttig prov fall. De er följde efter om Iranier profetisk Zoroaster, vem flytta till Indien efter den rasa om Sassanian rike inne om 7th århundrade a.d. De avgjort i 900 a.d. i Gujarat, Indien, var de var alarmerat den “Parsi” ( menande “from Iran). Slutligen de flyttat till Mumla i Indien och Karachi i Pakistan, från var den föreställa befolkning var prov ( fikon. 7). Deras frekvens för haplogroups 3 (8%) och 9 (39%) gör verkligen likna den här i Iran mer än den här av deras ström granne i Pakistan. De utställning den lägst frekvens för haplogroup 3 i Pakistan (avsides från Slump; fikon 1C). Den snål för åtta Iranier befolkningen var 14% (n401=) (Quintana-Murci et al. 2001), var så pass för Pakistan, exklusive den Analysen, var 36%. motsvarande sillarna för haplogroup 9 var 39% i den Analysen, 40% i Iran, och 15% i Pakistan exklusive den Analysen. De här sillarna före till en tillsatsen uppskattning av 100% från Iran ( bord 3). Givit den liten effektiv befolkning storlek om det box Analysen, tätheten av deras matcha till Iranier datan Maj bli tillfällig, och närvaron av haplogroup 28 kromosomen på 18% (4% i Iran; Brunn et al. 2001) antyder något genen flöde från omgivande befolkningen Den TMRCA för den Analysen- bestämd klunga inne om haplogroup 28 nätverken var 1,800 (600–4,500) åren (bord 8), konsekvent med den flytta av en liten antal av arvföljd från Iran Rock, de här resultaten demonstrera en nära matcha emellan den historisk arkivera och den Y datan, och sålunda föreslå så pass den Y datan vilja vara nyttig när mindre historisk informationen är tillgänglig.

Befolkningen den där er genetisk mest tydlig, den Slump, fordran nedgången från Genghis Khan’s armé; deras namn är drog från Persisk uttrycka “hazar,” menande “thousand,” emedan skara var lämna bakom i lösgöranden av tusen. Förestående sluten om 19th århundrade, något Slump flyttat från Afghanistan till Khurram Dal i Pakistan, källan av den prov undersöka här Sålunda, deras muntlig historia identifiera en ursprungen i Mongolia och befolkning flaskhalsen ~800 och ~100 åren för ... sedan. Om två dominerande Y haplogroups föreställa i den här befolkning, haplogroup 1 är vidsträckt i Pakistan, mycket av Asien, Europa, och den USA, och så skaffar litten upplysning på ställe om ursprungen. Haplogroup 10, i kontrast, är sällsynt i mest Pakistansk befolkningen (1.4%, när den Slump de/vi/du/ni är uteslutat) utom är gemensam i Öster Asien, inklusive Mongolia, var den göra upp över halva av befolkningen (opublicerad resultaten). Tillsatsen värderingen ( bord 3) de/vi/du/ni är konsekvent med en verklig bidragen från Mongolia. BATWING analys om Slump- bestämd haplotype klungen i haplogroups 1 och 10 antyd TMRCAs av 400 (120–1,200) och 100 (6–600) åren ( bord 8), respectively. Sålunda, den genetisk bevis är konsekvent med det muntlig tradition och, i syn av dess oberoende natur, skaffar stark stöd för den ( fikon. 7).

Något annan antyd ursprungen ta emot mer inlemmat stöd från Y datan. Den Negern Makrani, med en postulat ursprungen i Afrika, bära den aller högst frekvens av haplogroup 8 kromosomen grunda ifall något Pakistansk befolkning, så antecknat någon annanstans (Qamar et al. 1999). Den här haplogroup är till stor inskränka till sub-Saharan Afrika, var den konstituera omkring halva av befolkningen (hammare et al. 2001) och kanna sålunda bli anse som en märkaren av Afrikaner Y kromosomen. Inte desto mindre, den göra upp bara 9% om Negern Makrani prov, och haplogroup 28 (längs med annan typisk Pakistansk haplogroups) är föreställa i denne befolkning. Om den Y kromosomen var i början Afrikaner ( fikon. 7), mest har därefter blitt ersätt: den rock uppskattning om Afrikaner bidragen är ~12% ( bord 3).

Den Baltisk de/vi/du/ni är tanken till har härröra i Tibet, var den dominerande haplogroups de/vi/du/ni är 4 och 26. Varken var föreställa inne om prov från den här studera, skaffande nej stöd för en Tibetan ursprungen om Y kromosomen arvföljd och en tillsatsen uppskattning av noll ( bord 3). Hur ... än, den här vara resultatet måste bli förklarat med försiktigheten, på grund av den liten prov storlek. Tre befolkningen har möjlig ursprungen från armé av Alexandria den Stor: den Burusho, den Kalash, och den Stig. Modern Grek utställning en måttligt hög frekvens av haplogroup 21 (28%; Rosser et al. 2000), utom den här haplogroup var inte sett i endera den Burusho eller den Kalash prov och var grunda i bara 2% av den Stig, var den lokal haplogroup 28 var föreställa på 17%, 25%, och 13%, respectively. Grek- tillsatsen värderingen av 0% var få för den Burusho och den Stig, utom sillarna av 20–40%% var observera för den Kalash ( bord 3). I syn om frånvaron om haplogroup 21, vi tillskriva den här vara resultatet endera till driva inne om frekvens om annan haplogroups, speciellt haplogroups 2 och 1, eller till fattig beslutsamhet av arvföljd inom de här haplogroups, resulterande i tydlig arvföljd varelse klassificerad in i samma paraphyletic haplogroups. Rock, nej stöd för en Grek ursprungen av deras Y kromosomen blev stiftade, utom den här slut gör behöva antaganden så pass modern Grek de/vi/du/ni är representant av Alexander’s armé. Två befolkningen, den Kashmiris och den Stig, också lägga ner fordra till en möjlig Judisk ursprungen Judisk befolkningen vanligen har en måttlig frekvens av haplogroup 21 (e.g., 20%) och en hög frekvens av haplogroup 9 (e.g., 36%; (hammare et al. 2000). Frekvenserna av båda av de här haplogroups de/vi/du/ni är låg inne om Kashmiris och Stig, och haplogroup 28 är föreställa på 13% i den Stig, så nej stöd för en Judisk ursprungen är grunda, och tillsatsen uppskattning var 0% ( bord 3), fastän, igen, den här slut är inlemmat båda vid den liten prov storlek tillgänglig från Kashmir och vid antaganden så pass den modern prov de/vi/du/ni är representant av forntida befolkningen.

Den antyd ursprungen om Baluch är i Spruta. Spruta, lik Iranier, de/vi/du/ni är characterized vid en låg frekvensen av haplogroup 3 och en hög frekvens av haplogroup 9 (9% och 57%, respectively; Hammare et al. 2000), var den motsvarande frekvens inne om Baluch de/vi/du/ni är 29% och 12%. Den här skillnad och den hög frekvens av haplogroup 28 inne om Baluch (29%) göra en dominerande Spruta ursprungen för deras Y kromosomen osannolik, och tillsatsen uppskattning var 0% (bord 3), fastän den 8% frekvens för haplogroup 21, den aller högst kännemärken i Pakistan sålunda långt, gör ange något västlig bidragen till deras Y arvföljd. Brahuis har en möjlig ursprungen i Väster Asien (Hughes- Kulen 1991) och den har blitt antyd så pass en breda ut av haplogroup 9 Y kromosomen var förbundet med det utbredande av Dravidian- talande lantbrukarna (Quintana-Murci et al. 2001). Brahuis har den aller högst frekvens av haplogroup 9 kromosomen i Pakistan (28%) efter den Analysen, skaffande något stöd för den här hypotesen, utom deras höger frekvens av haplogroup 3 (39%) är inte typisk om Fruktbar Månskäran (Quintana-Murci et al. 2001) och antyder en mer komplex ursprungen, möjligen med tillsatsen från senare migrations, sådan som den här av Indo- Iranier talaren från stäpp av Central Asien och självaste från längre bort öster Den här möjlighet är stöttat vid upptäckten av låg frekvens av haplogroups 10, 12, och 13 inne om Brahuis, all sällsynt i Pakistan och typisk av Öster Asien, Öster och nordlig Asien, och Sydost Asien, respectively.

Den misslyckanden till finna en Y länk med en antyd befolkning av ursprungen motbevisade inte en historisk förening, utom den gör demonstrera så pass den Y kromosomen drog från sådan historisk händelsen har blitt förlorad eller ersätt. Analyser av mitochondrial DNA och annan loci skulle hjälp till klargöra befolkningen historia och skulle bli speciellt intressant i befolkningen lik den Negern Makrani och den Baltisk, i vilket där er en kontrast emellan den phenotype och den typisk Pakistansk Y haplotypes.

Erkännanden


Den här verk var stöttat vid en Wellcome Lita på Samarbetet Forska Initiativ Bevilja till S.Q.M. T.Z. var också stöttat vid Den Wellcome Lita på, och C.T.-S. vid den Cancer Forska Kampanj. Vi express vår uppskattning till original DNA donatorerna vem gjord den här studera möjlig. Avdelningen av Hälsa om Regering av Baluchistan och den Baluch Studerande Federation, Quetta, Pakistan, hjälp inne om insamling av kollekt omen den Brahui och Baluch prov. Stig prov var avhämtade med det hjälp om Avdelning av Pediatriken, Dam Läsande Post Kvalificera sig Medicinsk Sjukhus, Peshawar, Pakistan Vi er också tacksam till Dr. jag Kazmi och den Aga Khan Grundande Lantlig Hälsa Stöd Program för deras hjälp inne om insamling av kollekt omen Burusho prov. Dr. F. Sethna försynt värdefull hjälp inne om insamling om Analysen prov. Vi tacka Luis Quintana-Murci för hans kommentarerna på det manuskripten.


Elektronisk- Data banken Informationen

URLs för datan i denne artikeln de/vi/du/ni är som följe:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Nätverken 2.0, http:/www.fluxus-engineering.com/.
/ ViSta, http:/forrest.psych.unc.edu/.

Hänvisningarna

Ahmad AKN (1952) Jesus i himmel på jord. Den Civil och Militärisk Stirra på Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin En, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Smed C (2000) Identifieringen och karakteristik av roman mänsklig Y- kromosomen microsatellites från ordningsföljd data banken informationen. Kärn- Syra Res 28e8: [ fri Full text i PMC].
Ryggsim PC (1992) Baltisk. i Ryggsim PC, Radloff CF (eds) Sociolinguistic överblick av nordlig Pakistan. Vol 2, Språken av nordlig områdena Nationell Institut av Pakistan Studier, Islamabad, pp 3–27.
Banderol HJ, Överge Engelsk mynt, Rohl EN (1999) Median- blir med nätverken för inferring intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ fri Full Text].
Banderol HJ, Överge Engelsk mynt, Sykes BC, Richards MEGABYTE (1995) Mitochondrial porträtten av mänsklig befolkningen användande median nätverken. Genetiken 141743–753: [PubMed] [ fri Full Text].
Ringklocka HW (1979) Löpningen av Afghanistan. Sang- virker-Meel Publikationerna, Lahore, Pakistan.
Ringklocka HW (1998) En förfrågan in i ethnography av Afghanistan. Förtruppen Bokna, Lahore, Pakistan.
Bergen AW, Fiffla med C-Y, Tsai J, Jefferson K, Dey C, Smed KD, Park S-C, Tsai S-J, Guld D (1999) En Asian–Native Amerikanen faderlig arvföljd kännemärken vid RPS4Y resequencing och vid microsatellite haplotyping. Ann Surra Genetisk 6363–80: [PubMed] [full Text].
Bianchi Nej, Bailliet G, Trotsa CM, Blodbad RF, Rothhammer F, Martini-Marignac VL, Straffa SD (1997) Ursprungen av Amerindian Y- kromosomen så slutta sig till vid analysen av sexa polymorphic märkena. Er J Fysisk Anthropol 10279–89: [PubMed] [ full Text].
Biddulph J (1977) Folkstam om Back ben Koosh. Förmå Publikationerna, Karachi, Pakistan.
Burton RF (1851) Sindh och löpningen så pass bebo den dal om Förmå. WH Allen och Tillpass Ltd, London.
Carol O (1958) Den Stig. Oxford Universitet Pressa, Karachi, Pakistan.
Casanova M, Leroy Engelsk mynt, Boucekkine C, Weissenbach J, Biskop C, Karl M, Purrello M, Fiori G, Siniscalco M (1985) EN mänsklig Y- länkat DNA polymorphism och dess potential för uppskattande genetisk och utvecklings distans Vetenskap 2301403–1406: [PubMed].
Kavalkad-Sforza LL, Menozzi Engelsk mynt, Piazza EN (1994) Historien och geografi av mänsklig tilblivelse. Prinsen Universitet Pressa, Prinsen.
Dales GF (1991) Den phenomenon om Förmå civilization. i Jansen M, Mulloy M, Urban G (eds) Glömma stor stad på det Förmå: tidigt civilization i Pakistan från 8th till 2nd millennia BC. Verlag Philipp von Zabern, Huvudsaklig, Tyskland, pp 129–144.
Däcka KD (1992) Sociolinguistic överblick av Nordlig Pakistan. Vol 5, Språken av Skuldsedel. Nationell Institut av Pakistan Studier, Islamabad.
Ewens WJ (1972) Den samplande teorien av selektivt neutral alleles. Teoretisk Populär Biol 387–112: [PubMed].
Smuts BF (1992) Etnologisk: språken om värld. Sommar Institut av Språklig, Dallas.
Hammare MF (1994) EN ny insättanden av en Alu element på det Y kromosomen är en nyttig märkaren för mänsklig befolkning studier. Mol Biol Evol 11749–761: [PubMed] [fri Full Text].
Hammare MF, Horai S (1995) Y kromosomen DNA variationen och den folk av Japan. Er J Surra Genetisk 56951–962: [PubMed].
Hammare MF, Karachi TM, Röd AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarkisk monstera av global mänsklig Y- kromosomen olikheten Mol Biol Evol 181189–1203: [PubMed] [ fri Full Text].
Hammare MF, Röd AJ, Trä ET, Hättan MR, Jarjanazi H, Karachi T, Santachiara-Benerecetti S, Oppenheim En, Arbetslös MA, Jenkins T, Ostrer H, Hättan-Tamir B (2000) Judisk och Mellersta Östlig inte- Judisk befolkningen del en gemensam pöl av Y- kromosomen biallelic haplotypes. Proc Natl Akademikern Sci USA 976769–6774: [ fri Full text i PMC].
Helgason En, Sigurdardottir S, Nikolaus J, Sykes B, Kulle EW, Bradford DG, Bosnes V, Gulcher JR, Avdelning R, Stefansson K (2000) Uppskattande Nordisk och Gaelic börd inne om mansperson sätta till rätta av Island. Er J Surra Genetisk 67697–717: [PubMed] [ fri Full Text].
Hughes- Kulen R (1991) Kejserlig gazetteer av Indien: provins serie, Baluchistan. Sang- virker-Meel, Lahore, Pakistan.
Hussain J (1997) EN historia om folken av Pakistan förestående oberoende. Oxford Universitet Pressa, Karachi, Pakistan.
Ibbetson D (1883) Panjab kasta Sang- virker-Meel, Lahore, Pakistan.
Jarrige JF (1991) Mehrgarh: dess ställe inne om utveckling av forntida kultur i Pakistan. i Jansen M, Mulloy M, Urban G (eds) Glömma stor stad på det Förmå: tidigt civilization i Pakistan från 8th till 2nd millennia BC. Verlag Philipp von Zabern, Huvudsaklig, Tyskland, pp 34–50.
Arbetslös MA, Tyler- Smed C (2000) Ny använda för ny haplotypes: den mänsklig Y kromosomen, sjukdom och utväljande Riktningen Genetisk 16356–362: [PubMed] [ full Text].
Karachi TM, Zegura SL, Posukh O, Osipova L, Bergen En, Lång J, Guld D, Klitz W, Harihara S, de Knijff Engelsk mynt, Wiebe V, Griffiths RC, Tempel AR, Hammare MF (1999) Börd Asiaten källan() av ny värld Y- kromosomen grundaren haplotypes. Er J Surra Genetisk 64817–831: [PubMed] [fri Full Text].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff Engelsk mynt, Stoneking M, Sajantila EN (2000) Karakteristikerna och frekvens av germline mutations på microsatellite loci från mänsklig Y kromosomen, så avslöja vid rikta observation i fader/ son pärerna. Er J Surra Genetisk 661580–1588: [PubMed] [ fri Full Text].
Kwok C, Tyler- Smed C, Mendoza BB, Hughes Jag, Berkovitz GD, Goodfellow PN, Hök JR (1996) Mutation analys om 2 kb 5' till SRY i XY kvinno- och XY skära undersåten J Med Genetisk 33465–468: [PubMed].
Lång JC (1991) Den genetisk strukturen av tillsatsen befolkningen. Genetiken 127417–428: [PubMed] [fri Full Text].
Mathias N, Bayes M, Tyler- Smed C (1994) Högt upplysande blanda haplotypes för den mänsklig Y kromosomen. Surra Mol Genetisk 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Besätta En, Ismail M, Hammare MF, Lömsk Pappa, Kavalkad-Sforza LL (1999) Den ursprungen av Pakistansk befolkningen bevis från Y kromosomen märkena. i Papiha SS, Deka R, Chakraborty R (eds) Genova olikheten: ansökan i mänsklig befolkning genetiken Kluwer Akademikern/Plenum Förläggaren, New York, pp 83–90.
Mohyuddin En, Ayub Q, Qamar R, Zerjal T, Helgason En, Mehdi SQ, Tyler- Smed C (2001) Y- kromosomen STR haplotypes i Pakistansk befolkningen Förmiddag Sci Int 118141–146: [PubMed] [full Text].
Nanavutty ENGELSK MYNT (1997) Den Analysen. Nationell Bok Lita på, Ny Delhi, Indien.
Pandya En, Kung TE, Santiago FR, Taylor PG, Thangaraj K, Sjunga L, Arbetslös MA, Tyler- Smed C (1998) EN polymorphic mänsklig Y- kromosomen G till EN övergång grunda i Indien. Ind J Surra Genetisk 452–61:.
Qamar R, Ayub Q, Khaliq S, Besätta En, Karachi T, Mehdi SQ, Hammare MF (1999) Afrikaner och Levantine ursprungen av Pakistansk YAP+ Y kromosomen. Surra Biol 71745–755: [PubMed].
Quddus SA (1990) Den folkstam Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, Hammare MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin En, Radhakrishna Fullständig, Arbetslös MA, Tyler- Smed C, McElreavey K (2001) Y- kromosomen arvföljd spår spridningen av folk och språken i sydväst Asien. Er J Surra Genetisk 68537–542: [PubMed] [fri Full Text].
Robert DF, Hiorns R (1965) Metoderna av analys om genetisk sammansättning av en hybrid befolkning. Surra Biol 3738–43:.
Robert GS (1896) Den Kafirs om Hindu-Kush. Oxford Universitet Pressa, Karachi, Pakistan.
Rosser ZH, Zerjal T, Kastat Jag, Adojaan M, Alavantic D, Amoralisk En, Amos W, et al (2000) Y- kromosomen olikheten i Europa är clinch och ha inflyttande på primär vid geografi, hellre än vid språk. Er J Surra Genetisk 671526–1543: [PubMed] [ fri Full Text].
Santiago FR, Carvalho- Silver DR, Straffa SDJ (1999a) PCR- baserat DNA profileringen av mänsklig Y kromosomen i Epplen JT, Lubjuhn T (eds) Metoderna och redskapen i biosciences och medicin. Birkhauser Verlag, Basel, Schweiz, pp 133–152.
Santiago FR, Pandya En, Kayser M, Mitchell RJ, Liu En, Sjunga L, Förstöra-Bisol G, Novelletto En, Qamar R, Mehdi SQ, Adhikari R, Knijff Engelsk mynt, Tyler- Smed C (2000) EN polymorphic L1 retroposon insättanden i den centromere om mänsklig Y kromosomen. Surra Mol Genetisk 9421–430: [PubMed] [ fri Full Text].
Santiago FR, Pandya En, Tyler- Smed C, Straffa SD, Schanfield M, Leonard WR, Osipova L, Crawford MH, Mitchell RJ (1999b) Den central Sibirien ursprungen för inföding Amerikanen Y kromosomen. Er J Surra Genetisk 64619–628: [PubMed] [ fri Full Text].
Schneider S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: en mjukvaran för befolkning genetisk datan analys Genetiken och Biometry Laboratorium, Universitet av GenÞve, Schweiz.
Seielstad MT, Hebert JM, Lin AA, Lömsk Pappa, Ibrahim M, Vollrath D, Kavalkad-Sforza LL (1994) Konstruktion av mänsklig Y- kromosomen haplotypes användande en ny polymorphic EN till G övergång. Surra Mol Genetisk 32159–1261: [PubMed].
Smalben T, Tomita K, Idag T, Kotliarova SE, Lee J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genetisk variationen på det Y kromosomen inne om Japansk befolkning och inblandning för modern mänsklig Y kromosomen arvföljd. J Surra Genetisk 44240–245: [PubMed].
Thomas MG, Bradford N, Kasta HM (1999) Hög genom putte analys av 10 microsatellite och 11 diallelic polymorphisms på det mänsklig Y- kromosomen. Surra Genetisk 105577–581: [PubMed] [full Text].
Tyler- Smed C (1999) Y- kromosomen DNA märkena. i Papiha SS, Deka R, Chakraborty R (eds) Genova olikheten: ansökan i mänsklig befolkning genetiken Kluwer Akademikern/Plenum Förläggaren, New York, pp 65–73.
Lömsk Pappa, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, David RW, Kavalkad-Sforza LL, Oefner PJ (1997) Upptäckten av talrik Y kromosomen biallelic polymorphisms vid denaturing hög- utförande vätska chromatography. Genova Res 7996–1005: [PubMed] [fri Full Text].
Brunn RS, Yuldasheva N, Ruzibakiev R, Lömsk Pappa, Evseeva Jag, Blå- Smed J, Jin L, et al (2001) Den Eurasisk hjärtlös: en kontinental perspektiv på Y- kromosomen olikheten Proc Natl Akademikern Sci USA 9810244–10249: [ fri Full text i PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Ordningsföljd variationen om mänsklig Y kromosomen Natur 378379–380: [PubMed] [ full Text].
Wilson IJ, Skallet DJ (1998) Genealogical slutledning från microsatellite datan. Genetiken 150499–510: [PubMed] [ fri Full Text].
Wolpert S (2000) EN ny historia av Indien. Oxford Universitet Pressa, New York.
Ung FW, Förbjudet CM (1996) EN visuell statistiken system. i Stinga RA, Räv J (eds) Statistisk arbete med computer miljön för social forska. Salvia Publikationerna, New York, pp 207–236.
Zerjal T, Vinka L, Vinka G, Mikelsaar AV, Krumina En, Kucinskas V, Kastat Jag, Tyler- Smed C (2001) Geografisk, språklig, och kulturell inflytande på genetisk olikheten: Y- kromosomen distributionen i Nordlig Europeisk befolkningen. Mol Biol Evol 181077–1087: [PubMed] [ fri Full Text].
Zerjal T, Dashnyam B, Pandya En, Kayser M, Roewer L, Santiago FR, Schiefenhovel W, Fretwell N, Arbetslös MA, Harihara S, Skimra K, Semjidmaa D, Sajantila En, Salongen Engelsk mynt, Crawford MH, Ginter EK, Evgrafov OV, Tyler- Smed C (1997) Genetisk förhållandena av Asiaterna och Nordlig Europeiskan, avslöja vid Y- kromosomen DNA analys. Er J Surra Genetisk 601174–1183: [PubMed].

 

Sida Sist Uppdaterat: Saturday, February 04, 2006 15:58:28 -0500