Генетика

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

хромосома DNA Изменение в Пакистанец
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Заусеница Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Елей Tyler- Кузнец и Предмет,линия в виде буквы S. Qasim Mehdi1

1Biomedical и Генетический Инженерное искусство Деление, Dr. высшая отметка за классную работу Q. Хан Исследование Лаборатория, Islamabad; 2Cancer Исследование Поход, Хромосома Молекулярный Биология Группа, Отдел яние) от Биохимия, и 3Institute яние) от Биологический Антропология, Университет яние) от Полуботинок, Полуботинок, Соединяться Королевство; и расшифровывать Генетика, Reykjavik.


отвлеченный

Восемнадцать бинарный полиморфизм и 16 multiallelic, короткий- гуськом- повторять (STR) месторасположение от грамматический определенный член nonrecombining часть яние) от грамматический определенный член человеческий ИГРЕК хромосома быть тип в 718 мужской подчиненный причастность к 12 этнический группа яние) от Пакистанец. Этот identified 11 стойкий haplogroups и 503 соединение бинарный маркер/STR haplotypes. Haplogroup частое повторение быть широко подобный к тот в neighboring географический площадь, и грамматический определенный член Пакистанец народонаселение говорить высшая отметка за классную работу язык изолировать ( грамматический определенный член Burushos), высшая отметка за классную работу Dravidian язык ( грамматический определенный член Брама), или высшая отметка за классную работу Китаеведение-Tibetan язык ( грамматический определенный член Balti) походить грамматический определенный член Indo-European–speaking большинство Несмотря на, медиана- соединять плетенка яние) от haplotypes открывать значительный фундамент яние) от ИГРЕК изменение в Пакистанец, с многие народонаселение показывать отдельный кисть яние) от haplotypes. Этот образец мочь быть счет для у высшая отметка за классную работу общий лужа яние) от ИГРЕК происхождение, с реальный изоляция между народонаселение и медленное течение в грамматический определенный член маленький самого Немногие сравнительный генетический или исторический данные быть доступный для наибольший народонаселение, только грамматический определенный член следовать мочь быть сравнивать с устный традиция кругом источник Грамматический определенный член ИГРЕК данные поддерживать грамматический определенный член колодец- учрежденный источник яние) от грамматический определенный член Делать грамматический разбор в Иранский, грамматический определенный член внушать спуск яние) от грамматический определенный член Шанс от Genghis Хан армия, и грамматический определенный член источник яние) от грамматический определенный член Негрообразный Makrani в Африканец, только не надо поддерживать традиция яние) от Tibetan, Сирийский, Грек, или Еврейский источник для другой народонаселение.


внесение

Грамматический определенный член earliest очевидность яние) от Paleolithic человеческий присутствие в грамматический определенный член Юг Азиатский состоять из яние) от камень орудие закладывать разбрасывать всюду грамматический определенный член Soan Река Долина в северный Пакистанец ( гусар 1997). Злоба грамматический определенный член недостаток яние) от окаменелость очевидность, этот рабочий показываться к показывать грамматический определенный член присутствие яние) от возвращающийся домой в грамматический определенный член Юг Азиатский как ранний как 200,000–400,000 очень давно (Wolpert 2000) и так быть вероятный к вспомогательный глагол для образования сложных времен быть соединять с архаический Homo вид. Пакистанец lies на грамматический определенный член постулировать южанин береговой маршрут последователь у анатомический современный Homo Мудрость из яние) от Африканец, и так май вспомогательный глагол для образования сложных времен быть населенный у современный человеческий как ранний как 60,000–70,000 очень давно. Там быть очевидность яние) от пещера житель в Пакистанец лежащий,обращенный к северу граница, только окаменелость очевидность от грамматический определенный член Paleolithic вспомогательный глагол для образования сложных времен быть обрывочный ( гусар 1997). Очевидность вспомогательный глагол для образования сложных времен быть снимать крышку в Mehrghar, в сильный юго-западный ветер Пакистанец, указание Неолитический поселение от как давно как 7,000 b.c. (резкий 1991), который быть последователь у грамматический определенный член Indus Долина цивилизация ( включая грамматический определенный член придавать городской вид яние) от Harappa и Mohenjodaro) тот пышно расти в грамматический определенный член 3d и 2d тысячелетие b.c. (житель горных долин 1991). Всюду 1500 b.c., грамматический определенный член Indo-European–speaking кочевой пастушеский член рода от дальше north—often гость грамматический определенный член Aryans—crossed грамматический определенный член Karakorum Гора в грамматический определенный член Юг Азиатский. Последующий исторический случай заключать грамматический определенный член вторжение яние) от Александрийский грамматический определенный член Великий (327–325 b.c.) и грамматический определенный член Араб и Мусульманин завоевание от 711 a.d. продвигающийся вперед (Wolpert 2000).

Грамматический определенный член присутствующий народонаселение яние) от Пакистанец состоять из яние) от большой чем 160 миллион личный ( согласно к 2005 КТО фигура) кто принадлежать к в наименьший 18 этнический группа и говорить большой чем 60 язык ( глубоко въевшаяся грязь,сажа 1992). Наибольший яние) от этот язык быть Indo- Европейский, только они тоже заключать сильная форма,грамматически неопределенный член изолировать, Burushaski; высшая отметка за классную работу Dravidian язык, Брама; и высшая отметка за классную работу Китаеведение-Tibetan язык, Balti. Панджабский- говорить личный форма грамматический определенный член большинство народонаселение яние) от Пакистанец, только они представлять высшая отметка за классную работу сложный примесь яние) от этнический группа (Ibbetson 1883) и быть не анализировать здесь; 12 этнический группа быть заключать в сегодня обозревать. информация доступный кругом их быть суммировать в стол 1, вместе с гипотеза кругом их источник (Mehdi et al. 1999). Хотя некий яние) от этот гипотеза быть колодец- сторонник (e.g., грамматический определенный член источник яние) от грамматический определенный член Делать грамматический разбор в Иранский), наибольший быть основа на устный традиция и вспомогательный глагол для образования сложных времен не быть лицо,производящее испытание,анализ от другой исток яние) от очевидность.

Скудный генетический данные быть доступный для этот Пакистанец этнический группа Ранний научное занятие яние) от грамматический определенный член ABO кровь группа и классический протеин маркер делать не заключать весь группа и по большей части классифицировать их согласно к их место яние) от проживание. ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ народонаселение дерево основа на 54 классический энзим маркер место грамматический определенный член Шанс и Тропинка в грамматический определенный член Запад Азиатский кисть содержать в себе грамматический определенный член северный Caucasoids (кавалькада-Sforza et al. 1994). В еще один народонаселение дерево, основа на 47 классический протеин полиморфизм, грамматический определенный член Пакистанец образец форма высшая отметка за классную работу маленький subcluster в грамматический определенный член Индоевропейский оратор от India ( кавалькада-Sforza et al. 1994).

Грамматический определенный член ИГРЕК хромосома заготовлять высшая отметка за классную работу единственный в своем роде исток яние) от генетический очевидность (Tyler- Кузнец 1999; Безработный и Tyler- Кузнец 2000). Он носильщик грамматический определенный член крупный масштаб nonrecombining часть в грамматический определенный член геноцид и содержать в себе многочисленный стойкий бинарный маркер, включая основа замена (видеть, e.g., Тайно et al. 1997) и retroposon вставление ( молоток 1994; Santos et al. 2000), который мочь быть употребление в сочетании с большой- быстрый развивать маркер, такой как microsatellites (видеть, e.g., Ayub et al. 2000). Следовательно, очень подробность ИГРЕК филогенез мочь быть строить тот позволять мужской- особый вид яние) от генетический история к быть расследовать. Этот быть сильные влияние у грамматический определенный член маленький действительный народонаселение размер яние) от грамматический определенный член ИГРЕК хромосома, ведущий к быстрый генетический медленное течение, и у грамматический определенный член практика яние) от patrilocality в многие общество, ведущий к высокий плоская,горизонтальная поверхность яние) от географический дифференциация яние) от ИГРЕК haplotypes. Несмотря на грамматический определенный член произведение искусства Qamar et al. (1999) на грамматический определенный член анализ яние) от Тявканье+ хромосома ( обнимать ~2.6% яние) от грамматический определенный член весь) и анализ яние) от STR изменение (Ayub et al. 2000; Mohyuddin et al. 2001), маленький работа вспомогательный глагол для образования сложных времен быть носильщик из на Пакистанец ИГРЕК хромосома. Поэтому, мы вспомогательный глагол для образования сложных времен теперь исполнитель сильная форма,грамматически неопределенный член обширный анализ яние) от Пакистанец ИГРЕК происхождение, к устанавливать какой свет они мочь ронять на грамматический определенный член источник и генетический история яние) от грамматический определенный член подгруппа тот пополнять грамматический определенный член Пакистанец народонаселение.


материальный и Метод

образец
Грамматический определенный член ИГРЕК хромосома яние) от 718 несвязанный мужской подчиненный, причастность к 12 этнический группа яние) от Пакистанец, быть анализировать (стол 1 и 2; винная ягода. 1). Осведомленный соглашаться быть получать от весь участник в этот научное занятие. Сильная форма,грамматически неопределенный член Epstein Барак virus–transformed lymphoblastoid тюремная камера шнур быть учрежденный от каждый личный, и DNA быть удалять от этот тюремная камера солдат линейных войск для анализ.


Бинарный Полиморфизм Тип
Мы тип 15 SNPs, сильная форма,грамматически неопределенный член Alu вставление ( молоток 1994; Молоток и Ежечасный 1995), высшая отметка за классную работу Шнур вставление (Santos et al. 2000), и грамматический определенный член 12f2 вычеркивание (Casanova et al. 1985). Грамматический определенный член основа замена быть 92R7 Музыкальная нота до?T (Mathias et al. 1994); M9 Музыкальная нота до?НОТА СОЛЬ ( тайно et al. 1997); SRY-2627 Музыкальная нота до?T (Bianchi et al. 1997); SRY-1532 высшая отметка за классную работунота сольВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) Высшая отметка за классную работу?НОТА СОЛЬ (Seielstad et al. 1994); SRY-8299 Нота соль?Высшая отметка за классную работу (Santos et al. 1999a); Подходящий нота сольВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ ( панда,кошачий медведь et al. 1998); SRY +465 Музыкальная нота до?T ( голень et al. 1999); LLY22g Музыкальная нота до?ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ и Плести кружево T?МУЗЫКАЛЬНАЯ НОТА ДО переход (Zerjal et al. 1997). Вдобавок, грамматический определенный член M17 маркер ( тайно et al. 1997) быть тип, у употребление яние) от грамматический определенный член букварь GTGGTTGCTGGTTGTTACGT и AGCTGACCACAAACTGATGTAGA последователь у AflIII пищеварение яние) от грамматический определенный член PCR продукт; грамматический определенный член наследственный hallelujah быть не средство,способствующее пищеварению Грамматический определенный член M20 маркер (тайно et al. 1997) быть генотип, у употребление яние) от грамматический определенный член букварь CACACAACAAGGCACCATC и GATTGGGTGTCTTCAGTGCT последователь у SspI пищеварение; грамматический определенный член Высшая отметка за классную работу?НОТА СОЛЬ изменение уничтожать грамматический определенный член местоположение в положение 118 в грамматический определенный член 413-bp продукт. M11 (тайно et al. 1997) быть тип, using грамматический определенный член букварь TTCATCACAAGGAGCATAAACAA и CCCTCCCTCTCTCCTTGTATTCTACC последователь у пищеварение с MspI. Грамматический определенный член 215-bp продукт быть средство,способствующее пищеварению к 193-bp и 22-bp обломок в грамматический определенный член происходить hallelujah Грамматический определенный член RPS4Y Музыкальная нота до?T изменение (айсберг et al. 1999) быть открывать у BslI ограничение пищеварение яние) от высшая отметка за классную работу 528-bp PCR продукт получать у употребление яние) от грамматический определенный член букварь CCACAGAGATGGTGTGGGTA и GAGTGGGAGGGACTGTGAGA. Грамматический определенный член наследственный МУЗЫКАЛЬНАЯ НОТА ДО hallelujah содержать в себе два местоположение, и грамматический определенный член происходить T hallelujah содержать в себе один. M48 (тайно et al. 1997), высшая отметка за классную работуНота соль, быть тип у hallelujah- особый PCR using грамматический определенный член отличительный букварь TGACAATTAGGATTAAGAATATTATA и TGACAATTAGGATTAAGAATATTATG и обыкновенный человек букварь AAAATTCCAAGTTTCAGTGTCACATA к порождать особый 145-bp продукт Грамматический определенный член ставить яние) от ИГРЕК бинарный маркер hallelujah носильщик у высшая отметка за классную работу единственный личный воля быть приписывать к как “the Игрек haplogroup.”
Яние) от грамматический определенный член 718 образец, 717 мех в haplogroups ожидать на грамматический определенный член основание яние) от грамматический определенный член знать филогенез, только один Тропинка образец (PKH134) недоставать к расширять в грамматический определенный член SRY –1532 и M17 месторасположение. Он быть уполномоченный к haplogroup 3 на грамматический определенный член основание яние) от альтернатива SRY –1532 букварь ( подробность на просьба) и принадлежащий ему STR профиль.


игрек-STR Тип
Пять trinucleotide- повторять полиморфизм (DYS388, DYS392, DYS425, DYS426, и DYS436), десять tetranucleotide- повторять полиморфизм (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, и DYS439) и один pentanucleotide microsatellite (DYS438) быть тип полностью ИГРЕК хромосома. Три сложный PCR реакция быть исполнитель для весь ИГРЕК-STRs, в a10-µl конечный реакция том содержать в себе 20 ng геноцид DNA, как описывать где-нибудь в другом месте ( Фома et al. 1999; Ayub et al. 2000). PCR продукт быть говорить без умолку сильная форма,грамматически неопределенный член ABI 377 последовательность. ABIGS350 TAMRA быть употребление как грамматический определенный член внутренний узкая дорога знамя. Грамматический определенный член ПРОИСХОЖДЕНИЕ и ГЕНОТИП мягкая древесина тюк быть привыкший собирать грамматический определенный член данные и к анализировать обломок размер ИГРЕК-STR hallelujah быть название согласно к грамматический определенный член число яние) от повторять единица они contain.The некоторое количество повторять единица быть учрежденный через грамматический определенный член употребление яние) от последовательность передача на рассмотрение в другую инстанцию DNA образец. Hallelujah длина для DYS389b быть получать у вычитание яние) от грамматический определенный член DYS389II hallelujah длина от DYS389I.
ИГРЕК-STR удваивание быть закладывать в несколько месторасположение. DYS393 быть двойной в PKH165 (13 и 15) и DYS437 быть двойной в SDH181 (8 и 9). ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ большой сложный образец быть закладывать в DYS425, где два к четыре hallelujah быть закладывать в 36 личный от haplogroups 8, 9, 13, и 21.


данные Анализ
Главный- компонент анализ быть носильщик из на haplogroup частое повторение у употребление яние) от грамматический определенный член Перспектива ( зрительный Статистика) система мягкая древесина, перевод 5.0.2 (молодой и Знамя 1996). Для графический изображение, грамматический определенный член первый и второй главный компонент быть заговорщик у грамматический определенный член Микроскоп Служба Свита Превосходить Тюк на Окно 2000. Biallelic полиморфизм данные для различный мир народонаселение употребление в грамматический определенный член анализ быть получать от Молоток et al. (2001). Примесь быть оценивать у употребление яние) от три другой мера: Длинный вес наименьший- квадрат (WLS) мера ( длинный 1991); мистер, высшая отметка за классную работу наименьший- квадрат оценщик (мантия и Hiorns 1965); и m? (Helgason et al. 2000).
Анализ яние) от молекулярный изменение (AMOVA) быть носильщик из у употребление яние) от грамматический определенный член Arlequin тюк (Schneider et al. 1997). AMOVA мера грамматический определенный член пропорция яние) от изменение расхождение закладывать в и между народонаселение, относящийся к каждому в отдельности. Хотя много яние) от грамматический определенный член изменение в грамматический определенный член быстрый изменение microsatellite месторасположение быть ожидать к вспомогательный глагол для образования сложных времен быть предъявлять в грамматический определенный член другой Пакистанец subpopulations, грамматический определенный член единственный в своем роде изменение случай в грамматический определенный член бинарный месторасположение быть много старый и вспомогательный глагол для образования сложных времен не случай в грамматический определенный член контекст яние) от грамматический определенный член подразделение яние) от грамматический определенный член Пакистанец народонаселение. Мы придумывать грамматический определенный член следующий стратегия к подвиг грамматический определенный член максимум доходить до яние) от уместный изменение информация от грамматический определенный член ИГРЕК- хромосома haplotypes. STR изменение в haplogroups быть привыкший вычислить народонаселение pairwise FST ценность для каждый личный haplogroup. Для каждый народонаселение пара, высшая отметка за классную работу вес захудалый FST быть вычисленный, где грамматический определенный член ценность получать для каждый haplogroup быть вес согласно к грамматический определенный член пропорция яние) от pairwise сравнение завертывать тот haplogroup. В грамматический определенный член отсутствие яние) от высшая отметка за классную работу индивидуальный haplogroup от один народонаселение, Высшая отметка за классную работу, яние) от грамматический определенный член пара ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ и Нота си, FST быть вступать в бой 1, и грамматический определенный член число яние) от pairwise сравнение быть брать как грамматический определенный член число яние) от хромосома везти тот haplogroup в Нота си. Ценность яние) от FST основа на STRs один или на STRs плюс бинарный маркер, с бинарный маркер давать высшая отметка за классную работу 10- складывать высокий вес, быть вычисленный для сравнение. Полностью яние) от этот анализ, грамматический определенный член расстояние матка употребление консистенция яние) от грамматический определенный член число яние) от шаг у который каждый пара яние) от haplotypes разница. Камин испытание для грамматический определенный член значение яние) от соотношение между FST ценность быть носильщик из в Arlequin, и multidimensional скалярный (MDS) участок земли быть строить у употребление яние) от грамматический определенный член SPSS перевод 7.0 мягкая древесина тюк.

Медиана- соединять плетенка быть строить у Плетенка 2.0b ( лента для волос et al. 1999). ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ вес система с высшая отметка за классную работу пять- складывать выстраивать в ряд быть употребление в грамматический определенный член строительство яние) от грамматический определенный член плетенка. Грамматический определенный член вес уполномоченный быть особый для каждый haplogroup и брать в счет грамматический определенный член ИГРЕК-STR изменение поперек грамматический определенный член haplogroup в грамматический определенный член целый Пакистанец народонаселение. Грамматический определенный член следующий вес быть употребление изменение 0-0.09, вес 5; изменение 0.1-0.19, вес 4; изменение 0.2-0.49, вес 3; изменение 0.5-0.99, вес яние) от 2; и изменение 1.00, вес 1. Злоба этот, грамматический определенный член плетенка для haplogroup 1 вместилище многие высокий имеющий измерение куб и быть решать у обращаться грамматический определенный член понижать медиана и медиана соединять плетенка метод являющийся продолжением. понижать медиана алгоритм (лента для волос et al. 1995) быть привыкший порождать высшая отметка за классную работу *.rmf напильник и грамматический определенный член медиана соединять плетенка метод быть прикладной к этот напильник.

BATWING (Wilson и Лысуха 1998), Bayesian Анализ яние) от Дерево С Внутренний Узел Порождение, быть привыкший оценивать грамматический определенный член время к грамматический определенный член наибольший недавний общий предок (TMRCA) яние) от высшая отметка за классную работу ставить яние) от хромосома. Этот программа uses высшая отметка за классную работу Марка цепь Монтаж Крестьянин процедура к порождать филогенез дерево и соединять параметр ценность твердый с ввод данные ( высшая отметка за классную работу ставить яние) от ИГРЕК haplotypes) и генетический и демографический модель Грамматический определенный член генетический модель принимать на себя единственный- шаг изменение яние) от грамматический определенный член STRs и грамматический определенный член демографический модель выбирать быть экспонентный рост от сильная форма,грамматически неопределенный член в начальной стадии постоянный- размер народонаселение, с или без подразделение в другой runs яние) от грамматический определенный член программа Весь 16 STR месторасположение быть употребление; месторасположение- особый изменение норма предшествующий вероятность основа на грамматический определенный член данные яние) от Kayser et al. (Kayser et al. 2000) быть строить для грамматический определенный член месторасположение доступный как гамма,третья буква греческого алфавита распределение яние) от грамматический определенный член форма гамма,третья буква греческого алфавита(, нота си) где высшая отметка за классную работу = (1 + некоторое количество изменение соблюдать законы у Kayser et al.), и нота си = (1 + некоторое количество meioses). Для месторасположение не расследовать у Kayser et al., грамматический определенный член распределение гамма,третья буква греческого алфавита (1,416) быть употребление, который вспомогательный глагол для образования сложных времен высшая отметка за классную работу захудалый яние) от 0.0024. ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ порождение время яние) от 25 очень давно быть принимать на себя. Так грамматический определенный член 95% доверие промежуток времени давать брать в счет неуверенность в изменение норма, народонаселение рост и ( где подходящий) подразделение, только не порождение время.

следовать

игрек- Хромосома Бинарный Полиморфизм
Грамматический определенный член 18 бинарный маркер употребление устанавливать тождество 20 haplogroups в worldwide народонаселение винная ягода 1A), только единственный 11 быть закладывать в Пакистанец, и 5 счет для 92% яние) от грамматический определенный член образец ( винная ягода. 1 и стол 2). Haplogroups 1 и 9 быть присутствующий полностью Пакистанец народонаселение рассматривать, haplogroup 3 быть присутствующий полностью исключать грамматический определенный член Шанс, и haplogroup 28 быть присутствующий полностью исключать грамматический определенный член Шанс и грамматический определенный член Kashmiris. Сильный юго-западный ветер народонаселение показывать высокий частое повторение яние) от hg 9 и грамматический определенный член Тявканье+ haplogroups 21 и 8 чем northeastern народонаселение (figs. 1D–E), только, халат, маленький географический кисть яние) от haplogroup частое повторение быть видимый в грамматический определенный член страна.


Главный- Компонент Анализ
Мы желать к сравнивать грамматический определенный член Пакистанец ИГРЕК haplogroup данные с данные от народонаселение от остальное грамматический определенный член мир. Нет подходящий данные ставить быть доступный для грамматический определенный член полный ставить яние) от 18 маркер, но с другой стороны данные яние) от Молоток et al. (2001) дозволенным образом почти 5 к быть употребление, потому что грамматический определенный член тот же самый или phylogenetically равноценный маркер быть сообщать. главный- компонент анализ винная ягода 2A) показывать некий разница от грамматический определенный член первоначальный анализ яние) от Молоток et al., грамматический определенный член сила один бытие грамматический определенный член меньший отделение яние) от грамматический определенный член Африканец народонаселение. Этот быть должный, к высшая отметка за классную работу большой протяжение, к грамматический определенный член subset яние) от маркер употребление, который оленья кожа не заключать многие яние) от грамматический определенный член Африканец- особый самого. Наибольший Пакистанец народонаселение кисть с Юг Азиатский и Середина Восточный народонаселение, и быть закрытый к Северный Африканец, Центральный Азиатский и Европейский народонаселение, так показывать высшая отметка за классную работу общий сходство с географический закрытый народонаселение. Грамматический определенный член один исключение быть грамматический определенный член Шанс, кто быть вполне отдельный. ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ подобный анализ яние) от грамматический определенный член Пакистанец народонаселение один, using вследствии грамматический определенный член бинарный маркер ( винная ягода. 2B), подтверждать грамматический определенный член разница между грамматический определенный член Шанс и на днях народонаселение и тоже большой ясно показывать грамматический определенный член ясность яние) от грамматический определенный член Kalash и грамматический определенный член Делать грамматический разбор. Он быть ударяться тот грамматический определенный член язык isolate–speaking Burusho и грамматический определенный член Dravidian- говорить Брама не надо выделять в этот анализ.


Примесь Оценивать
Гипотеза кругом народонаселение источник ( стол 1) мочь быть рассматривать как количественный вопрос кругом примесь. Например, к испытание грамматический определенный член возможность тот грамматический определенный член Балясина ИГРЕК хромосома вспомогательный глагол для образования сложных времен высшая отметка за классную работу Сирийский источник, мы мочь спрашивать какой пропорция яние) от грамматический определенный член Балясина Ys быть происходить от Сирийский только о языке и какой пропорция быть от Пакистанец ( рассматривать к быть грамматический определенный член Пакистанец образец лишенный чего-либо грамматический определенный член Балясина). Данные на внушать исток народонаселение быть брать от грамматический определенный член литература и три мера яние) от примесь быть вычисленный. Грамматический определенный член три оценивать давать широко твердый следовать, с маленький систематический разница типичный m? > мистер > Длинный WLS для грамматический определенный член оценивать содействие от грамматический определенный член наружный исток народонаселение ( стол 3). Этот следовать заготовлять очевидность для сильная форма,грамматически неопределенный член наружный содействие к грамматический определенный член Шанс, Kalash, Негрообразный Makrani, и Делать грамматический разбор только не к на днях народонаселение.


ИГРЕК- Хромосома STR Полиморфизм
ИГРЕК-STR полиморфизм быть научное занятие к получать высшая отметка за классную работу большой подробность осмотр яние) от ИГРЕК изменение, среди грамматический определенный член другой Пакистанец этнический группа, тот воля быть меньший уклон у грамматический определенный член маркер- выяснение процедура Грамматический определенный член разнообразие яние) от ИГРЕК-STR haplotypes ( стол 4) быть низший для грамматический определенный член Шанс (0.893) как внушать у предыдущий анализ (Ayub et al. 2000).
Грамматический определенный член 16 ИГРЕК-STRs определять 502 ИГРЕК haplotypes, грамматический определенный член обширный большинство бытие соблюдать законы в единственный личный Грамматический определенный член оставаться haplotypes быть доля у 2–18 личный ( подробность быть давать в грамматический определенный член online- единственный дополнительный стол). В весь случай только один, грамматический определенный член хромосома черенок высшая отметка за классную работу haplotype принадлежать к грамматический определенный член тот же самый haplogroup ( отсюда, 503 соединение haplotypes) и, в наибольший случай, грамматический определенный член личный черенок высшая отметка за классную работу haplotype принадлежать к грамматический определенный член тот же самый народонаселение (стол 5).

Грамматический определенный член GST и касающийся формы размер яние) от грамматический определенный член повторять единица, для весь 16 ИГРЕК-STRs рассматривать в грамматический определенный член Пакистанец народонаселение, быть давать в стол 6. Грамматический определенный член соотношение между маркер heterozygosity и GST быть закладывать не к быть многозначительный (r0.329=; P=.213). Грамматический определенный член касающийся формы размер и изменение яние) от грамматический определенный член 16 ИГРЕК-STRs в haplogroups 1, 2, 3, 8, 9, 10, 21, 26, и 28 быть тоже давать в стол 6. Уверенный haplogroups вспомогательный глагол для образования сложных времен высшая отметка за классную работу другой касающийся формы hallelujah размер, и еще много в придачу пример яние) от этот быть показывать в boldface итальянский в стол 6. Для пример, DYS388 вспомогательный глагол для образования сложных времен 15 повторять в haplogroup 9, сравнивать с 12 повторять в наибольший яние) от на днях haplogroups в Пакистанец. Так же, грамматический определенный член касающийся формы hallelujah для DYS438 быть 9 в haplogroup 9, только 10 или 11 в на днях haplogroups. Грамматический определенный член касающийся формы hallelujah для DYS434 для haplogroup 10 быть 11, который быть ударяться другой от грамматический определенный член hallelujah размер яние) от этот месторасположение в другой haplogroups. Грамматический определенный член полный недостаток яние) от изменчивость для DYS436 в грамматический определенный член 233 мужской подчиненный причастность к haplogroup 3 быть достопримечательный. Haplogroup 10 показываться к вспомогательный глагол для образования сложных времен грамматический определенный член наименьший изменчивость поперек наибольший месторасположение исключать для DYS390 ( стол 6). Этот находка демонстрировать грамматический определенный член сильные структурный яние) от ИГРЕК-STR изменчивость у haplogroup.

Мы недостаток к вычислить высшая отметка за классную работу ИГРЕК- основа мера яние) от генетический расстояние между народонаселение тот воля отражать свет,тепло,звук грамматический определенный член дифференциация тот вспомогательный глагол для образования сложных времен случай в Пакистанец и тот воля не быть непропорциональный господствовать у древний разница тот вспомогательный глагол для образования сложных времен заранее аккумулировать между haplogroups. Грамматический определенный член знамя путь к делать этот воля быть к употребление STR изменение, и стол 7 суммировать народонаселение pairwise ценность яние) от FST на грамматический определенный член основание яние) от STR изменение один ( высшая отметка за классную работу) или яние) от бинарный- маркер плюс STR изменение (нота си), с бинарный- маркер разница вес 10 время высокий чем STR разница. Этот матка быть очень коррелят (r0.95=; P.001<), как май быть ожидать от грамматический определенный член структурный яние) от STR изменение у haplogroup. Как бы ни, этот мера быть многозначительный влияние у древний разница, и мы вспомогательный глагол для образования сложных времен поэтому проявитель высшая отметка за классную работу могущий быть измененным мера. Мы разум столько яние) от грамматический определенный член STR изменение в haplogroups воля вспомогательный глагол для образования сложных времен давать начало недавно и мочь быть употребление для этот purpose.Nous avons поддающийся исчислению,измерениюé donc равенство пара des дол указывает на отделение,лишение народонаселение указывает на отделение,лишение FST, sur шестой тон диатонической гаммы основа du STR изменение dans des haplogroups, et utilisé une moyenne песетаé указывает на отделение,лишение ces последний лить предъявлять une матка простой указывает на отделение,лишение расстояние указывает на отделение,лишение FST ( стол 7C ; артист кордебалета 3) Этот расстояние быть тоже очень коррелят с расстояние основа на STRs один (r0.76=; P.001<) или на STRs плюс бинарный маркер (r0.70=; P.001<), только высшая отметка за классную работу великий пропорция яние) от грамматический определенный член изменение быть видеть между народонаселение (22%, сравнивать с 6% и 7%, относящийся к каждому в отдельности). ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ сравнение яние) от фигура 3 с фигура 2B ( который быть основа на бинарный маркер частое повторение один) открывать высшая отметка за классную работу ударяться халат сходство, с грамматический определенный член Шанс бытие отдельный от весь яние) от на днях народонаселение. На днях выдающийся народонаселение быть грамматический определенный член Kalash и Делать грамматический разбор (как перед), грамматический определенный член Kashmiris (может быть из-за грамматический определенный член маленький образец), и грамматический определенный член Брама, кто быть так большой отдельный в их STR профиль чем haplogroup частое повторение. MDS участок земли яние) от грамматический определенный член расстояние в стол 7A и 7B (не показывать) приводить к каким-либо результатам подобный окончание, только походить фигура 2B большой внимательно в грамматический определенный член путь тот грамматический определенный член Брама не надо выделять так много.


медиана- Соединять Плетенка
Грамматический определенный член генетический родство среди грамматический определенный член другой Пакистанец этнический группа быть исследовать дальше у рисование медиана- соединять плетенка ( лента для волос et al. 1995), и пример быть показывать в фигура 4, 5, и 6. Грамматический определенный член haplogroup 1 плетенка винная ягода 4) открывать значительный изменение, только тоже высшая отметка за классную работу высокий ступень яние) от народонаселение- особый фундамент Например, грамматический определенный член 24 Делать грамматический разбор haplogroup 1 хромосома весь впадать один яние) от три кисть ( винная ягода. 4, зеленый), 19 яние) от 26 Burusho haplogroup 1 хромосома впадать два кисть ( голубой), и 12 яние) от 14 Шанс haplogroup 1 хромосома впадать высшая отметка за классную работу единственный кисть, и весь яние) от этот кисть быть особый к их соответственный народонаселение. Грамматический определенный член haplogroup 10 плетенка винная ягода 5) быть много простой, из-за грамматический определенный член маленький число яние) от хромосома, только снова открывать народонаселение- особый кисть для Burusho и Шанс haplotypes. Грамматический определенный член haplogroup 28 плетенка ( винная ягода. 6) показывать высшая отметка за классную работу ударяться изолировать Делать грамматический разбор- особый кисть, в грамматический определенный член конец яние) от высшая отметка за классную работу длинный ветвь, содержать в себе 15 яние) от 16 Делать грамматический разбор haplogroup 28 хромосома. Кисть яние) от Kalash, Burusho, and—to высшая отметка за классную работу меньший degree—Baluch хромосома быть тоже очевидный, хотя один Балясина haplotype быть доля с Sindhi и Makrani Балясина личный от подле южанин народонаселение.
BATWING TMRCAs быть вычисленный для грамматический определенный член haplogroup 28 плетенка и для отборный происхождение в высшая отметка за классную работу некоторое количество haplogroups. Грамматический определенный член следовать быть суммировать в стол 8.

обсуждение

Мы вспомогательный глагол для образования сложных времен носильщик из грамматический определенный член первый обширный анализ яние) от ИГРЕК разнообразие в Пакистанец, экзаменатор 34 маркер в 718 мужской подчиненный от 12 народонаселение Этот позволять нас к сравнивать Пакистанец ИГРЕК разнообразие вместе с тем заранее сообщать в мир народонаселение, к расследовать разница в Пакистанец, и к оценивать некий яние) от грамматический определенный член внушать народонаселение историк от высшая отметка за классную работу ИГРЕК перспектива.


Сравнение с Worldwide Данные
В высшая отметка за классную работу worldwide сравнение, Пакистанец народонаселение по большей части кисть всюду высшая отметка за классную работу лужа Юг Азиатский образец и ложь закрытый к высшая отметка за классную работу Середина Восточный образец ( винная ягода. 2A). Этот находка быть unsurprising, частично потому что грамматический определенный член Юг Азиатский образец заключать 62 Пакистанец личный (i.e., 32% яние) от 196 весь) и частично потому что ИГРЕК изменение в многие площадь яние) от грамматический определенный член мир быть преобладающий структура у география, не у язык или этнический усыновление (Rosser et al. 2000; Zerjal et al. 2001). Грамматический определенный член великий генетический сходство яние) от Пакистанец народонаселение к тот в грамматический определенный член запад чем к восточный народонаселение быть иллюстрировать у грамматический определенный член обстоятельство тот четыре яние) от грамматический определенный член пять частый haplogroups в Пакистанец (haplogroups 1, 2, 3, и 9, который вместе пополнять 79% яние) от грамматический определенный член весь народонаселение) быть тоже частый в западный Азиатский и Европейский только не в Китайский или Черный лак; обратно, грамматический определенный член haplogroups тот быть частый в Восток Азиатский (e.g., 4, 5, 10, 13, и 20) быть редкий или отсутствующий в Пакистанец, муравьиный единственный 2.5% яние) от грамматический определенный член весь Если, как в некий толкование, сильная форма,грамматически неопределенный член ранний массовый отъезд от Африканец вперед грамматический определенный член южанин морской берег яние) от Азиатский свинец к грамматический определенный член первый анатомический современный человеческий народонаселение в Пакистанец, и этот народ носильщик грамматический определенный член восточный haplogroups или их предтеча, их ИГРЕК хромосома вспомогательный глагол для образования сложных времен теперь быть в значительной степени ставить или класть обратно на место у последующий миграция или ген течь; в самом деле, грамматический определенный член характерный яние) от грамматический определенный член восточный haplogroups в Пакистанец май быть происходить от современный большой чан- миграция, не от древний оставшийся в живых.
Грамматический определенный член пятый haplogroup тот быть общий в Пакистанец, haplogroup 28, различаться от весь грамматический определенный член другой в принадлежащий ему распределение. В Пакистанец, он делать вверх 14% яние) от наш образец и быть присутствующий полностью только два народонаселение ( оба яние) от который вспомогательный глагол для образования сложных времен очень маленький образец размер), так он быть оба общий и широко распространенный Снаружи Пакистанец и грамматический определенный член подле имеющий деревенский вид, как бы ни, он быть редкий. Он вспомогательный глагол для образования сложных времен быть сообщать в India (30%; присутствующий в 3/3 народонаселение), Tajikistan (10%; присутствующий в 5/6 народонаселение), и Uzbekistan (3%; присутствующий в 10/13 народонаселение), только он быть редкий в Русский (0.4%; присутствующий в 1/6 народонаселение) и грамматический определенный член Кавказец (1.4%; присутствующий в 1/6 народонаселение (колодец et al. 2001) и вспомогательный глагол для образования сложных времен не быть закладывать в весь в Китайский или Монгол ( неопубликованный наблюдение BATWING оценивать яние) от грамматический определенный член TMRCA яние) от грамматический определенный член Пакистанец haplogroup 28 хромосома быть ~7,000 (4,000–14,000) очень давно ( стол 8). Так, в этот время период, грамматический определенный член Пакистанец народонаселение вспомогательный глагол для образования сложных времен расходиться от высшая отметка за классную работу общий наследственный народонаселение или вспомогательный глагол для образования сложных времен опытный значительный мужской ген течь между себя или от высшая отметка за классную работу общий исток. С грамматический определенный член оценивать возраст соответствовать к грамматический определенный член ранний Неолитический период, грамматический определенный член размазывать яние) от этот происхождение май быть соединять с грамматический определенный член местный расширение яние) от фермер.


сравнение в Пакистанец
Haplogroup распределение в Пакистанец народонаселение, с грамматический определенный член исключение яние) от грамматический определенный член Шанс ( обсуждать в грамматический определенный член следующий рассечение), быть ударяться подобный к один еще один (figs. 1 и 2), злоба некий достопримечательный лингвистический разница. В самом деле, грамматический определенный член язык изолировать- говорить Burusho, грамматический определенный член Dravidian- говорить Брама, и грамматический определенный член Китаеведение-Tibetan–speaking Baltis делать не выделять от на днях народонаселение в весь в грамматический определенный член haplogroup анализ ( стол 2 и винная ягода. 2), внушать один из двух тот грамматический определенный член лингвистический разница возникать за обыкновенный человек Игрек образец быть учрежденный или тот там вспомогательный глагол для образования сложных времен быть достаточный ИГРЕК ген течь между народонаселение к устранять какой-нибудь начальный разница Еще высшая отметка за классную работу большой подробность анализ яние) от грамматический определенный член ИГРЕК haplotypes (e.g., figs. 3–6) открывать некий отдельный особенность яние) от грамматический определенный член Брама и значительный народонаселение особый; народонаселение- особый кисть яние) от рассказывать haplotypes быть обычно закладывать в этот плетенка Такой кисть воля единственный быть видеть если народонаселение быть изолировать от один еще один. Он май быть тот высшая отметка за классную работу мычать ступень яние) от ген течь между народонаселение над высшая отметка за классную работу длинный время быть достаточный к кончаться подобный haplogroup частое повторение без могущий быть произведенным многие доля кисть.
Народонаселение- особый кисть яние) от haplotypes быть особенно очевидный в некий народонаселение. В грамматический определенный член Шанс, где грамматический определенный член отдельный haplogroup частое повторение знаменитый наверху быть закладывать, наибольший хромосома (19/23; 83%) впадать один яние) от справедливый два колодец- изолировать кисть (figs. 4 и 5), тогда как грамматический определенный член Делать грамматический разбор, грамматический определенный член Kalash, и грамматический определенный член Burusho тоже показывать выступающий кисть. Грамматический определенный член Шанс, Делать грамматический разбор, и Kalash быть грамматический определенный член три народонаселение показывать грамматический определенный член наибольший многозначительный другой народонаселение pairwise FST ценность. Грамматический определенный член высокий ценность яние) от грамматический определенный член Шанс и Делать грамматический разбор мочь частью быть счет для у миграция к Пакистанец от другой место, только высшая отметка за классную работу содействие фактор быть вероятный к быть медленное течение, один из двух должный к высшая отметка за классную работу ограниченный некоторое количество основатель происхождение или случай впоследствии в маленький народонаселение. Tk ценность (Ewens 1972) заготовлять высшая отметка за классную работу путь яние) от сравнение действительный народонаселение размер. Ценность основа на грамматический определенный член STRs для грамматический определенный член Шанс, Делать грамматический разбор, Kalash, и Burushos быть 8.9, 77.5, 25.8, и 74.2, относящийся к каждому в отдельности, сравнивать с высшая отметка за классную работу захудалый яние) от 181.8 для на днях народонаселение с образец размер >20. Действительный народонаселение размер для ИГРЕК хромосома мочь различаться очень от перепись народонаселение размер, только он быть достопримечательный тот грамматический определенный член Делать грамматический разбор и Kalash делать вспомогательный глагол для образования сложных времен грамматический определенный член маленький перепись размер, один- сотый или один- тысячный яние) от наибольший яние) от тот яние) от на днях народонаселение (стол 1), так этот маленький перепись размер май вспомогательный глагол для образования сложных времен быть поддерживать для высшая отметка за классную работу длинный время. В суммарный, многие особенность яние) от сегодня Пакистанец ИГРЕК haplotype распределение мочь быть счет для у высшая отметка за классную работу доля наследственный ген лужа, с ограниченный ген течь между народонаселение и медленное течение в грамматический определенный член маленький самого.


проницательность в Народонаселение Источник
Грамматический определенный член внушать народонаселение источник ( стол 1) мочь теперь быть рассматривать в грамматический определенный член свет яние) от этот ИГРЕК следовать. Информация быть заготовлять у haplogroup частое повторение, который мочь быть привыкший предъявлять примесь оценивать, и этот быть легкий к объяснять если народонаселение быть большой и изолировать и грамматический определенный член исток народонаселение вспомогательный глагол для образования сложных времен другой частое повторение. Когда этот условие быть не встречать, грамматический определенный член присутствие яние) от отдельный ИГРЕК происхождение мочь тихий быть информационный Грамматический определенный член источник яние) от грамматический определенный член Делать грамматический разбор быть колодец- документ (Nanavutty 1997) и так заготовлять высшая отметка за классную работу полезный испытание случай. Они быть последователь яние) от грамматический определенный член Иранский пророк Zoroaster, кто мигрировать к India за грамматический определенный член обвал яние) от грамматический определенный член Sassanian империя в грамматический определенный член 7th столетие a.d. Они скамья - ларь в 900 a.d. в Gujarat, India, где они быть гость грамматический определенный член “Parsi” ( значение “from Иранский). В конечном счете они двигать к Бормотать в India и Karachi в Пакистанец, от где сегодня народонаселение быть образец ( винная ягода. 7). Их частое повторение для haplogroups 3 (8%) и 9 (39%) делать в самом деле походить тот в Иранский большой чем тот яние) от их ходячий сосед в Пакистанец. Они показывать грамматический определенный член низший частое повторение для haplogroup 3 в Пакистанец (не говоря уже о грамматический определенный член Шанс; винная ягода 1C). Грамматический определенный член захудалый для восемь Иранский народонаселение быть 14% (n401=) (пятидневный-Murci et al. 2001), тогда как тот для Пакистанец, исключать грамматический определенный член Делать грамматический разбор, быть 36%. соответственный фигура для haplogroup 9 быть 39% в грамматический определенный член Делать грамматический разбор, 40% в Иранский, и 15% в Пакистанец исключать грамматический определенный член Делать грамматический разбор. Этот фигура приводить к каким-либо результатам сильная форма,грамматически неопределенный член примесь оценивать яние) от 100% от Иранский ( стол 3). Давать грамматический определенный член маленький действительный народонаселение размер яние) от грамматический определенный член Делать грамматический разбор, грамматический определенный член духота яние) от их спичка к грамматический определенный член Иранский данные май быть случайный, и грамматический определенный член присутствие яние) от haplogroup 28 хромосома в 18% (4% в Иранский; Колодец et al. 2001) внушать некий ген течь от грамматический определенный член окружать народонаселение Грамматический определенный член TMRCA для грамматический определенный член Делать грамматический разбор- особый кисть в грамматический определенный член haplogroup 28 плетенка быть 1,800 (600–4,500) очень давно (стол 8), твердый с грамматический определенный член миграция яние) от высшая отметка за классную работу маленький некоторое количество происхождение от иранский Халат, этот следовать демонстрировать высшая отметка за классную работу закрытый спичка между грамматический определенный член исторический рекордсмен и грамматический определенный член ИГРЕК данные, и так внушать тот грамматический определенный член ИГРЕК данные воля быть полезный когда меньший исторический информация быть доступный.
Грамматический определенный член народонаселение то есть genetically наибольший отдельный, грамматический определенный член Шанс, требовать спуск от Genghis Хан армия; их название быть происходить от грамматический определенный член Персидский слово “hazar,” значение “thousand,” потому что транспорт для перевозки войск быть левый сзади в отделение яние) от высшая отметка за классную работу тысяча. Происходящий грамматический определенный член конец яние) от грамматический определенный член 19th столетие, некий Шанс двигать от Afghanistan к грамматический определенный член Khurram Долина в Пакистанец, грамматический определенный член исток яние) от грамматический определенный член образец расследовать здесь Так, их устный история identifies сильная форма,грамматически неопределенный член источник в Монгол и народонаселение bottlenecks ~800 и ~100 очень давно. Яние) от грамматический определенный член два преобладающий ИГРЕК haplogroups присутствующий в этот народонаселение, haplogroup 1 быть широко распространенный в Пакистанец, много яние) от Азиатский, Европейский, и грамматический определенный член Американский, и так заготовлять маленький информация кругом грамматический определенный член место яние) от источник. Haplogroup 10, в противоположность, быть редкий в наибольший Пакистанец народонаселение (1.4%, когда грамматический определенный член Шанс быть исключать) только быть общий в Восток Азиатский, включая Монгол, где он замена вверх над половина яние) от грамматический определенный член народонаселение (неопубликованный следовать). Примесь оценивать ( стол 3) быть твердый с высшая отметка за классную работу реальный содействие от Монгол. BATWING анализ яние) от грамматический определенный член Шанс- особый haplotype кисть в haplogroups 1 и 10 внушать TMRCAs яние) от 400 (120–1,200) и 100 (6–600) очень давно ( стол 8), относящийся к каждому в отдельности Так, грамматический определенный член генетический очевидность быть твердый с грамматический определенный член устный традиция и, ввиду принадлежащий ему независимый природа, заготовлять сильные поддерживать для он ( винная ягода. 7).

Некий другой внушать источник принимать большой ограниченный поддерживать от грамматический определенный член ИГРЕК данные. Грамматический определенный член Негрообразный Makrani, с высшая отметка за классную работу постулировать источник в Африканец, везти грамматический определенный член высокий частое повторение яние) от haplogroup 8 хромосома закладывать в какой-нибудь Пакистанец народонаселение, как знаменитый где-нибудь в другом месте (Qamar et al. 1999). Этот haplogroup быть в значительной степени ограниченный к под--Saharan Африканец, где он составлять кругом половина яние) от грамматический определенный член народонаселение (молоток et al. 2001) и мочь так быть смотреть на кого-либо,что-либо как высшая отметка за классную работу маркер яние) от Африканец ИГРЕК хромосома. Несмотря на, он замена вверх единственный 9% яние) от грамматический определенный член Негрообразный Makrani образец, и haplogroup 28 (вместе другой типичный Пакистанец haplogroups) быть присутствующий в этот народонаселение. Если грамматический определенный член ИГРЕК хромосома быть в начальной стадии Африканец ( винная ягода. 7), наибольший вспомогательный глагол для образования сложных времен впоследствии быть ставить или класть обратно на место: грамматический определенный член халат оценивать яние) от грамматический определенный член Африканец содействие быть ~12% ( стол 3).

Грамматический определенный член Balti быть мысль к вспомогательный глагол для образования сложных времен давать начало в Tibet, где грамматический определенный член преобладающий haplogroups быть 4 и 26. Никакой быть присутствующий в грамматический определенный член образец от этот научное занятие, заготовлять нет поддерживать для высшая отметка за классную работу Tibetan источник яние) от грамматический определенный член ИГРЕК хромосома происхождение и сильная форма,грамматически неопределенный член примесь оценивать яние) от нуль ( стол 3). Как бы ни, этот следовать быть должным быть истолкователь с осторожность, из-за грамматический определенный член маленький образец размер. Три народонаселение вспомогательный глагол для образования сложных времен возможный источник от грамматический определенный член вооружение яние) от Александрийский грамматический определенный член Великий: грамматический определенный член Burusho, грамматический определенный член Kalash, и грамматический определенный член Тропинка. Современный Грек встать с постели умеренный высокая частота яние) от haplogroup 21 (28%; Rosser et al. 2000), только этот haplogroup быть не видеть в один из двух грамматический определенный член Burusho или грамматический определенный член Kalash образец и быть закладывать в единственный 2% яние) от грамматический определенный член Тропинка, тогда как грамматический определенный член местный haplogroup 28 быть присутствующий в 17%, 25%, и 13%, относящийся к каждому в отдельности. Грек- примесь оценивать яние) от 0% быть получать для грамматический определенный член Burusho и грамматический определенный член Тропинка, только фигура яние) от 20–40%% быть соблюдать законы для грамматический определенный член Kalash ( стол 3). В осмотр яние) от грамматический определенный член отсутствие яние) от haplogroup 21, мы приписывать этот следовать один из двух к медленное течение в грамматический определенный член частое повторение яние) от на днях haplogroups, особенно haplogroups 2 и 1, или к грамматический определенный член бедный решение яние) от происхождение в этот haplogroups, следовать в отдельный происхождение бытие классифицировать в грамматический определенный член тот же самый paraphyletic haplogroups. Халат, нет поддерживать для высшая отметка за классную работу Грек источник яние) от их ИГРЕК хромосома быть закладывать, только этот окончание оленья кожа приказывать грамматический определенный член присвоение тот современный Грек быть характерный яние) от Alexander’s вооружение. Два народонаселение, грамматический определенный член Kashmiris и грамматический определенный член Тропинка, тоже светский требовать к высшая отметка за классную работу возможный Еврейский источник Еврейский народонаселение обычно вспомогательный глагол для образования сложных времен высшая отметка за классную работу умеренный частое повторение яние) от haplogroup 21 (e.g., 20%) и высшая отметка за классную работу высокий частое повторение яние) от haplogroup 9 (e.g., 36%; (молоток et al. 2000). Грамматический определенный член частое повторение яние) от оба яние) от этот haplogroups быть мычать в грамматический определенный член Kashmiris и Тропинка, и haplogroup 28 быть присутствующий в 13% в грамматический определенный член Тропинка, так нет поддерживать для высшая отметка за классную работу Еврейский источник быть закладывать, и грамматический определенный член примесь оценивать быть 0% ( стол 3), хотя, снова, этот окончание быть ограниченный оба у грамматический определенный член маленький образец размер доступный от Kashmir и у грамматический определенный член присвоение тот грамматический определенный член современный образец быть характерный яние) от древний народонаселение.

Грамматический определенный член внушать источник яние) от грамматический определенный член Балясина быть в Сирийский только о языке. Сирийский, похожий Иранский, быть характеризовать у высшая отметка за классную работу мычать частое повторение яние) от haplogroup 3 и высшая отметка за классную работу высокая частота яние) от haplogroup 9 (9% и 57%, относящийся к каждому в отдельности; Молоток et al. 2000), тогда как грамматический определенный член соответственный частое повторение в грамматический определенный член Балясина быть 29% и 12%. Этот разница и грамматический определенный член высокая частота яние) от haplogroup 28 в грамматический определенный член Балясина (29%) делать высшая отметка за классную работу преобладающий Сирийский источник для их ИГРЕК хромосома неправдоподобный, и грамматический определенный член примесь оценивать быть 0% (стол 3), хотя грамматический определенный член 8% частое повторение для haplogroup 21, грамматический определенный член высокий identified в Пакистанец до сих пор, оленья кожа показывать некий западный содействие к их ИГРЕК происхождение. Брама вспомогательный глагол для образования сложных времен высшая отметка за классную работу возможный источник в Запад Азиатский (Hughes- Пуля 1991) и он вспомогательный глагол для образования сложных времен быть внушать тот высшая отметка за классную работу размазывать яние) от haplogroup 9 ИГРЕК хромосома быть соединять с грамматический определенный член расширение яние) от Dravidian- говорить фермер ( пятидневный-Murci et al. 2001). Брама вспомогательный глагол для образования сложных времен грамматический определенный член высокий частое повторение яние) от haplogroup 9 хромосома в Пакистанец (28%) за грамматический определенный член Делать грамматический разбор, заготовлять некий поддерживать для этот гипотеза, только их высокий частое повторение яние) от haplogroup 3 (39%) быть не типичный яние) от грамматический определенный член Плодородный Полумесяц ( пятидневный-Murci et al. 2001) и внушать высшая отметка за классную работу большой сложный источник, возможно с примесь от более поздний миграция, такой как тот яние) от Indo- Иранский оратор от грамматический определенный член степь яние) от Центральный Азиатский и другой от дальше восток Этот возможность быть сторонник у грамматический определенный член открытие яние) от мычать частое повторение яние) от haplogroups 10, 12, и 13 в грамматический определенный член Брама, весь редкий в Пакистанец и типичный яние) от Восток Азиатский, Восток и северный Азиатский, и Сильный южный ветер Азиатский, относящийся к каждому в отдельности.

Грамматический определенный член недостаток к находить высшая отметка за классную работу ИГРЕК звено с высшая отметка за классную работу внушать народонаселение яние) от источник оленья кожа не опровергать высшая отметка за классную работу исторический соединение, только он оленья кожа демонстрировать тот грамматический определенный член ИГРЕК хромосома происходить от такой исторический случай вспомогательный глагол для образования сложных времен быть потерявший или ставить или класть обратно на место. Анализ яние) от mitochondrial DNA и другой месторасположение воля помогать к объяснять грамматический определенный член народонаселение историк и воля быть особенно интересный в народонаселение похожий грамматический определенный член Негрообразный Makrani и грамматический определенный член Balti, в который там быть высшая отметка за классную работу противоположность между грамматический определенный член phenotype и грамматический определенный член типичный Пакистанец ИГРЕК haplotypes.



Acknowledgments


Этот работа быть сторонник у высшая отметка за классную работу Wellcome Доверие Сотрудничество Исследование Почин Соглашаться к S.Q.M. T.Z. быть тоже сторонник у Грамматический определенный член Wellcome Доверие, и C.T.-предмет,линия в виде буквы S у грамматический определенный член Рак Исследование Поход. Мы выражать наш оценка к грамматический определенный член первоначальный DNA жертвователь кто делать этот научное занятие возможный. Грамматический определенный член Отдел яние) от Здоровье яние) от грамматический определенный член Правительство яние) от Baluchistan и грамматический определенный член Балясина Студент Федерация, Кетсаль, Пакистанец, помогать в грамматический определенный член собирание яние) от грамматический определенный член Брама и Балясина образец. Тропинка образец быть собранный с грамматический определенный член помощь яние) от грамматический определенный член Отдел яние) от Педиатрия, Знатная дама Читать Столб Располагать в последовательно порядке Врачебный Больница, Peshawar, пакистанец Мы быть тоже благодарный к Dr. я Kazmi и грамматический определенный член Aga Хан Фундамент Сельский Здоровье Поддерживать Программа для их помощь в грамматический определенный член собирание яние) от Burusho образец. Dr. нота фа Sethna заготовлять ценный помощь в грамматический определенный член собирание яние) от грамматический определенный член Делать грамматический разбор образец. Мы благодарить Luis Пятидневный-Murci для принадлежащий ему замечание на грамматический определенный член рукопись.


электронный- Поддающийся датировке Информация

URLs для данные в этот статья быть следующее:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Плетенка 2.0, http:/www.fluxus-engineering.com/.
/ Перспектива, http:/forrest.psych.unc.edu/.
/
передача на рассмотрение в другую инстанцию

Ahmad AKN (1952) Иисус в небо на земле. Грамматический определенный член Гражданский и Военный Газета Ltd, Lahore, Пакистанец.
Ayub Q, Mohyuddin Высшая отметка за классную работу, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (2000) Отождествление и characterisation яние) от новый человеческий ИГРЕК- хромосома microsatellites от последовательность поддающийся датировке информация. Ядро Кислый Res 28e8: [ свободный Полный текст в PMC].
Ответный удар PC (1992) Balti. в Ответный удар PC, Radloff CF (eds) Sociolinguistic обозревать яние) от северный Пакистанец. Vol 2, Язык яние) от северный площадь Национальный Общественно установленный закон,обычай яние) от Пакистанец Научное занятие, Islamabad, pp 3–27.
Лента для волос HJ, Оставлять P, Rohl ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ (1999) Медиана- соединять плетенка для могущий быть сделанным как вывод,заключение intraspecific филогенез Mol Биологический Насильственное извлечение 1637–48: [PubMed] [ свободный Полный Текст].
Лента для волос HJ, Оставлять P, Sykes BC, Воображаемый ответчик в судебном процессе MB (1995) Mitochondrial портрет яние) от человеческий народонаселение using медиана плетенка. Генетика 141743–753: [PubMed] [ свободный Полный Текст].
Красавица HW (1979) Грамматический определенный член состязание в скорости яние) от Afghanistan. Петь- нота ми-Meel Опубликование, Lahore, Пакистанец.
Красавица HW (1998) Сильная форма,грамматически неопределенный член вопрос в грамматический определенный член этнография яние) от Afghanistan. Головной отряд Книга, Lahore, Пакистанец.
Айсберг Шило, Добиться МУЗЫКАЛЬНАЯ НОТА ДО- Игрек, Tsai J, Jefferson K, Dey Музыкальная нота до, Кузнец KD, Парк ПРЕДМЕТ,ЛИНИЯ В ВИДЕ БУКВЫ S- Музыкальная нота до, Tsai ПРЕДМЕТ,ЛИНИЯ В ВИДЕ БУКВЫ S-J, Золото НОТА РЕ (1999) Сильная форма,грамматически неопределенный член Asian–Native Американский отцовский происхождение identified у RPS4Y resequencing и у microsatellite haplotyping. Ann Жужжать Генетта 6363–80: [PubMed] [полный Текст].
Bianchi Нет, Bailliet Нота соль, Хвастовство CM, Резня RF, Rothhammer Нота фа, Человек строгой военной дисциплины- Ноготки VL, Уголовный SD (1997) Источник яние) от Amerindian ИГРЕК- хромосома как могущий быть сделанным как вывод,заключение у грамматический определенный член анализ яние) от шесть полиморфизм маркер. Быть J Медицина Человекообразный 10279–89: [PubMed] [ полный Текст].
Biddulph J (1977) Член рода яние) от грамматический определенный член Индусский Koosh. Indus Опубликование, Karachi, Пакистанец.
Ноша RF (1851) Sindh и грамматический определенный член состязание в скорости тот жить грамматический определенный член долина яние) от грамматический определенный член Indus. WH Allen и Co Ltd, Лондонец.
Веселая песнь НУЛЬ (1958) Грамматический определенный член Тропинка. Полуботинок Университет Жать, Karachi, Пакистанец.
Casanova M, Leroy P, Boucekkine Музыкальная нота до, Weissenbach J, Епископ Музыкальная нота до, Обод или косяк M, Желтое красящее вещество,употребляемое в Индии,в Китае M, Фиорд Нота соль, Siniscalco M (1985) ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ человеческий ИГРЕК- звено DNA полиморфизм и принадлежащий ему потенциальный для суждение генетический и эволюционный расстояние Наука 2301403–1406: [PubMed].
Кавалькада-Sforza LL, Menozzi P, Базарная площадь ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ (1994) Грамматический определенный член история и география яние) от человеческий происхождение. Принц Университет Жать, Принц.
Житель горных долин GF (1991) Грамматический определенный член явление яние) от грамматический определенный член Indus цивилизация. в Янсенизм M, Грязь M, Городской НОТА СОЛЬ (eds) Забывать придавать городской вид на грамматический определенный член Indus: ранний цивилизация в Пакистанец от грамматический определенный член 8th к грамматический определенный член 2nd тысячелетие BC. Verlag Филиппика von Zabern, Сила, Германский, pp 129–144.
Палуба KD (1992) Sociolinguistic обозревать яние) от Северный Пакистанец. Vol 5, Язык яние) от Ребенок. Национальный Общественно установленный закон,обычай яние) от Пакистанец Научное занятие, Islamabad.
Ewens WJ (1972) Грамматический определенный член образец теория яние) от отбирающий нейтральный hallelujah Теорб Народ Биологический 387–112: [PubMed].
Глубоко въевшаяся грязь,сажа BF (1992) Этнологический: язык яние) от грамматический определенный член мир. Лето Общественно установленный закон,обычай яние) от Лингвистика, Плита.
Молоток MF (1994) ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ недавний вставление яние) от сильная форма,грамматически неопределенный член Alu элемент на грамматический определенный член ИГРЕК хромосома быть высшая отметка за классную работу полезный маркер для человеческий народонаселение научное занятие. Mol Биологический Насильственное извлечение 11749–761: [PubMed] [свободный Полный Текст].
Молоток MF, Ежечасный ПРЕДМЕТ,ЛИНИЯ В ВИДЕ БУКВЫ S (1995) ИГРЕК хромосома DNA изменение и грамматический определенный член народ яние) от Черный лак. Быть J Жужжать Генетта 56951–962: [PubMed].
Молоток MF, Karafet TM, Окрашивать в красный цвет AJ, Jarjanazi H, Santachiara-Benerecetti Предмет,линия в виде буквы S, Soodyall H, Zegura SL (2001) Hierarchical образец яние) от мировой человеческий ИГРЕК- хромосома разнообразие Mol Биологический Насильственное извлечение 181189–1203: [PubMed] [ свободный Полный Текст].
Молоток MF, Окрашивать в красный цвет AJ, Лес ET, Бонна Мистер, Jarjanazi H, Karafet T, Santachiara-Benerecetti Предмет,линия в виде буквы S, Oppenheim Высшая отметка за классную работу, Безработный Мама, Jenkins T, Ostrer H, Бонна- Тамил НОТА СИ (2000) Еврейский и Середина Восточный non- Еврейский народонаселение доля высшая отметка за классную работу общий лужа яние) от ИГРЕК- хромосома biallelic haplotypes. Proc Natl Академический Sci USA 976769–6774: [ свободный Полный текст в PMC].
Helgason Высшая отметка за классную работу, Sigurdardottir Предмет,линия в виде буквы S, Nicholson J, Sykes Нота си, Холм EW, Гвоздь без шляпки DG, Bosnes Конусообразный, Узкое глубокое ущелье JR, Опека R, Stefansson K (2000) Суждение Скандинавский и Гэльский предки в грамматический определенный член мужской поселенец яние) от Исландец. Быть J Жужжать Генетта 67697–717: [PubMed] [ свободный Полный Текст].
Hughes- Пуля R (1991) Имперский географический справочник яние) от India: провинциальный ряд, Baluchistan. Петь- нота ми-Meel, Lahore, Пакистанец.
Гусар J (1997) ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ история яние) от грамматический определенный член народ яние) от Пакистанец к независимость. Полуботинок Университет Жать, Karachi, Пакистанец.
Ibbetson НОТА РЕ (1883) Panjab каста Петь- нота ми-Meel, Lahore, Пакистанец.
Резкий JF (1991) Mehrgarh: принадлежащий ему место в грамматический определенный член развитие яние) от древний культура в Пакистанец. в Янсенизм M, Грязь M, Городской НОТА СОЛЬ (eds) Забывать придавать городской вид на грамматический определенный член Indus: ранний цивилизация в Пакистанец от грамматический определенный член 8th к грамматический определенный член 2nd тысячелетие BC. Verlag Филиппика von Zabern, Сила, Германский, pp 34–50.
Безработный Мама, Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (2000) Новый uses для новый haplotypes: грамматический определенный член человеческий Игрек хромосома, болезнь и выбор Отклоняться Генетта 16356–362: [PubMed] [ полный Текст].
Karafet TM, Zegura SL, Posukh Нуль, Osipova L, Айсберг Высшая отметка за классную работу, Длинный J, Золото Нота ре, Klitz W, Harihara Предмет,линия в виде буквы S, указывает на отделение,лишение Knijff P, Wiebe Конусообразный, Грифон RC, Шаблон AR, Молоток MF (1999) Наследственный Азиатский исток() яние) от новый мир ИГРЕК- хромосома основатель haplotypes. Быть J Жужжать Генетта 64817–831: [PubMed] [свободный Полный Текст].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer Предмет,линия в виде буквы S, Kruger Музыкальная нота до, Krawczak M, Nagy M, Dobosz T, Szibor R, указывает на отделение,лишение Knijff P, Stoneking M, Sajantila ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ (2000) Характерный и частое повторение яние) от germline изменение в microsatellite месторасположение от грамматический определенный член человеческий ИГРЕК хромосома, как открывать у руководить наблюдение в отец/ сын пара. Быть J Жужжать Генетта 661580–1588: [PubMed] [ свободный Полный Текст].
Kwok Музыкальная нота до, Tyler- Кузнец Музыкальная нота до, Mendonca BB, Hughes Я, Berkovitz GD, Goodfellow PN, Ястреб JR (1996) Изменение анализ яние) от грамматический определенный член 2 kb 5' к SRY в XY женского пола и XY пересекать подчиненный J Med Генетта 33465–468: [PubMed].
Длинный JC (1991) Грамматический определенный член генетический структура яние) от примешивать народонаселение. Генетика 127417–428: [PubMed] [свободный Полный Текст].
Mathias Неопределенная величина, Bayes M, Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (1994) Очень информационный составной haplotypes для грамматический определенный член человеческий ИГРЕК хромосома. Жужжать Mol Генетта 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Поташ Предмет,линия в виде буквы S, Мансардная крыша Высшая отметка за классную работу, Ismail M, Молоток MF, Тайно Папа, Кавалькада-Sforza LL (1999) Грамматический определенный член источник яние) от Пакистанец народонаселение очевидность от ИГРЕК хромосома маркер. в Papiha SS, Deka R, Chakraborty R (eds) Геноцид разнообразие: заявление в человеческий народонаселение генетика Kluwer Академический/ Пленум Издатель, Новый Сторонник Йоркской династии, pp 83–90.
Mohyuddin Высшая отметка за классную работу, Ayub Q, Qamar R, Zerjal T, Helgason Высшая отметка за классную работу, Mehdi SQ, Tyler- Кузнец Музыкальная нота до (2001) ИГРЕК- хромосома STR haplotypes в Пакистанец народонаселение Судебный Sci Int 118141–146: [PubMed] [полный Текст].
Nanavutty P (1997) Грамматический определенный член Делать грамматический разбор. Национальный Книга Доверие, Новый Delhi, India.
Панда,кошачий медведь Высшая отметка за классную работу, Король TE, Santos FR, Taylor PG, Thangaraj K, Петь L, Безработный Мама, Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (1998) ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ полиморфизм человеческий ИГРЕК- хромосома НОТА СОЛЬ к ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ переход закладывать в India. Ind J Жужжать Генетта 452–61:.
Qamar R, Ayub Q, Калиф Предмет,линия в виде буквы S, Мансардная крыша Высшая отметка за классную работу, Karafet T, Mehdi SQ, Молоток MF (1999) Африканец и Житель Леванта источник яние) от Пакистанец Тявканье+ ИГРЕК хромосома. Жужжать Биологический 71745–755: [PubMed].
Quddus SA (1990) Грамматический определенный член племенной Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Пакистанец.
Пятидневный-Murci L, Немец Музыкальная нота до, Zerjal T, Sayar SH, Молоток MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin Высшая отметка за классную работу, Radhakrishna U, Безработный Мама, Tyler- Кузнец Музыкальная нота до, McElreavey K (2001) ИГРЕК- хромосома происхождение след распространение яние) от народ и язык в сильный юго-западный ветер Азиатский. Быть J Жужжать Генетта 68537–542: [PubMed] [свободный Полный Текст].
Мантия DF, Hiorns R (1965) Метод яние) от анализ яние) от грамматический определенный член генетический составление яние) от высшая отметка за классную работу гибрид народонаселение. Жужжать Биологический 3738–43:.
Robertson GS (1896) Грамматический определенный член Кафр яние) от грамматический определенный член Индусский-Kush. Полуботинок Университет Жать, Karachi, Пакистанец.
Rosser ZH, Zerjal T, Ирландский хоккей на траве Меня, Adojaan M, Alavantic Нота ре, Аморальный Высшая отметка за классную работу, Amos W, et al (2000) ИГРЕК- хромосома разнообразие в Европейский быть прибивать гвоздем,забивая его шляпку и влияние первоначально у география, скорее чем у язык. Быть J Жужжать Генетта 671526–1543: [PubMed] [ свободный Полный Текст].
Santos FR, Carvalho- Лесной DR, Уголовный SDJ (1999a) PCR- основа DNA профиль яние) от человеческий Игрек хромосома в Epplen JT, Lubjuhn T (eds) Метод и рабочий в biosciences и медицина. Birkhauser Verlag, Необоснованный, Switzerland, pp 133–152.
Santos FR, Панда,кошачий медведь Высшая отметка за классную работу, Kayser M, Mitchell RJ, Liu Высшая отметка за классную работу, Петь L, Уничтожать- Бизон Нота соль, Novelletto Высшая отметка за классную работу, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (2000) ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ полиморфизм L1 retroposon вставление в грамматический определенный член centromere яние) от грамматический определенный член человеческий ИГРЕК хромосома. Жужжать Mol Генетта 9421–430: [PubMed] [ свободный Полный Текст].
Santos FR, Панда,кошачий медведь Высшая отметка за классную работу, Tyler- Кузнец Музыкальная нота до, Уголовный SD, Schanfield M, Львиный WR, Osipova L, Речной рак MH, Mitchell RJ (1999b) Грамматический определенный член центральный Сибирский источник для родной Американский ИГРЕК хромосома. Быть J Жужжать Генетта 64619–628: [PubMed] [ свободный Полный Текст].
Schneider Предмет,линия в виде буквы S, Kueffer J-M, Roessli Нота ре, Excoffier L (1997) Arlequin ver 1.1: высшая отметка за классную работу мягкая древесина для народонаселение генетический данные анализ Генетика и Биометрия Лаборатория, Университет яние) от Джин, Switzerland.
Seielstad MT, Кельнерша JM, Lin AA, Тайно Папа, Ibrahim M, Vollrath Нота ре, Кавалькада-Sforza LL (1994) Строительство яние) от человеческий ИГРЕК- хромосома haplotypes using высшая отметка за классную работу новый полиморфизм ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ к НОТА СОЛЬ переход. Жужжать Mol Генетта 32159–1261: [PubMed].
Голень T, Tomita K, Сегодня T, Kotliarova SE, Защита J, Kuroki Игрек, Jin DK, Tokunaga K, Nakamura H, Nakahori ИГРЕК (1999) Генетический изменение на грамматический определенный член ИГРЕК хромосома в грамматический определенный член Японский народонаселение и вовлечение для современный человеческий ИГРЕК хромосома происхождение. J Жужжать Генетта 44240–245: [PubMed].
Фома MG, Гвоздь без шляпки Неопределенная величина, Вздрагивать HM (1999) Высокий через анализ яние) от 10 microsatellite и 11 diallelic полиморфизм на грамматический определенный член человеческий ИГРЕК- хромосома. Жужжать Генетта 105577–581: [PubMed] [полный Текст].
Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (1999) ИГРЕК- хромосома DNA маркер. в Papiha SS, Deka R, Chakraborty R (eds) Геноцид разнообразие: заявление в человеческий народонаселение генетика Kluwer Академический/ Пленум Издатель, Новый Сторонник Йоркской династии, pp 65–73.
Тайно Папа, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath Нота ре, Шлюпбалка RW, Кавалькада-Sforza LL, Oefner PJ (1997) Открытие яние) от многочисленный ИГРЕК хромосома biallelic полиморфизм у denaturing высокий- исполнение жидкий chromatography. Геноцид Res 7996–1005: [PubMed] [свободный Полный Текст].
Колодец RS, Yuldasheva Неопределенная величина, Ruzibakiev R, Тайно Папа, Evseeva Я, Голубой- Кузнец J, Jin L, et al (2001) Грамматический определенный член Евразийский глубокий тыл: высшая отметка за классную работу континентальный перспектива на ИГРЕК- хромосома разнообразие Proc Natl Академический Sci USA 9810244–10249: [ свободный Полный текст в PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Последовательность изменение яние) от грамматический определенный член человеческий Игрек хромосома Природа 378379–380: [PubMed] [ полный Текст].
Wilson IJ, Лысуха DJ (1998) Родословный вывод от microsatellite данные. Генетика 150499–510: [PubMed] [ свободный Полный Текст].
Wolpert ПРЕДМЕТ,ЛИНИЯ В ВИДЕ БУКВЫ S (2000) ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ новый история яние) от India. Полуботинок Университет Жать, Новый Сторонник Йоркской династии.
Молодой FW, Знамя CM (1996) ВЫСШАЯ ОТМЕТКА ЗА КЛАССНУЮ РАБОТУ зрительный статистика система. в Жалить RA, Лисица J (eds) Статистический исчислимый окружение для общественный исследователь. Шалфей Опубликование, Новый Сторонник Йоркской династии, pp 207–236.
Zerjal T, Кивок L, Кивок Нота соль, Mikelsaar AV, Krumina Высшая отметка за классную работу, Kucinskas Конусообразный, Ирландский хоккей на траве Меня, Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (2001) Географический, лингвистический, и культурный влияние на генетический разнообразие: ИГРЕК- хромосома распределение в Северный Европейский народонаселение. Mol Биологический Насильственное извлечение 181077–1087: [PubMed] [ свободный Полный Текст].
Zerjal T, Dashnyam Нота си, Панда,кошачий медведь Высшая отметка за классную работу, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Резное или лепное украшение Неопределенная величина, Безработный Мама, Harihara Предмет,линия в виде буквы S, Клин K, Semjidmaa Нота ре, Sajantila Высшая отметка за классную работу, Гостиная P, Речной рак MH, Ginter EK, Evgrafov OV, Tyler- Кузнец МУЗЫКАЛЬНАЯ НОТА ДО (1997) Генетический родство яние) от Азиатский и Северный Европейский, открывать у ИГРЕК- хромосома DNA анализ. Быть J Жужжать Генетта 601174–1183: [PubMed].

 

 

 

 

 

Последнее страницы уточнило: Saturday, February 04, 2006 16:05:35 -0500