Genetyka

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Dotyczacy chromosomu DNA Zmiennosc w Pakistanski
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Krewni ze strony ojca Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Krzyzmo Tyler- Kowal i S. Qasim Mehdi1

1Biomedical i Genetyka Technika Wydzial, Dr. pewien Q. Chan Badanie Laboratoryjne, Islamabad; 2Cancer Badanie Kampania, Chromosomy Molekularny Biologia Koncern, Wydzial od Biochemia, i 3Institute od Biologiczny Antropologia, Uniwersytet od Oxford, Oxford, Zjednoczony Królestwo; i odczytac kod Genetyka, Reykjavik.


Abstrakcyjny

Osiemnascie podwójny polimorficzny i 16 multiallelic, krótki- tandem- powtarzac (STR) miejsca z nonrecombining porcja od ten ludzki Y chromosomy bylismy napisal na maszynie w 718 meski motywy przynaleznosc do 12 etniczny grupy od Pakistanski. Tych utozsamic 11 stajnia haplogroups i 503 kombinacja podwójny markier/STR haplotypes. Haplogroup czestotliwosci bylismy zwykle podobny wobec ów w sasiadujacy geograficzny dzielnice, i ten Pakistanski ludnosc rozmawianie pewien jezyk separowac ( ten Burushos), pewien Dravidian jezyk ( ten Bramin), albo pewien Sino- Tybetanski jezyk ( ten Baltycki) byl podobny ten Zyrowac-European–speaking wiekszosc Mimo wszystko, mediana- laczacy sieci od haplotypes odsloniety znaczny podloze od Y zmiennosc rezygnowac Pakistanski, rezygnowac duzo ludnosc przedstawienie rózny grona od haplotypes. Tych wzory moga byc wyliczony pod katem przy pewien wspólny kaluza od Y rody, rezygnowac znaczny izolacja pomiedzy ludnosc i ped w ten mniejszy ci Malo porównawczy genetyka albo dane chronologiczne jestescie rozporzadzalny pod katem najliczniejszy ludnosc, oprócz ten wyniki moga byc porównany rezygnowac ustny tradycje okolo genezy Ten Y dane poprzec ten dobrze- zakladac poczatek od ten Felietonisci w Iran, ten zasugerowany zejscie od ten Hazard z Genghis Chan armia, i ten poczatek od ten Murzyn Makrani w Afryka, oprócz czynic nie poprzec tradycje od Tybetanski, Syryjczyk, Grecki, albo Zydowski genezy pod katem inny ludnosc.


Wprowadzenie

Ten najwczesniej swiadczyc od Paleolityczny ludzki obecnosc w ten Na poludnie Azja sklada sie z kamienia narzedzia ufundowac rozrzucony wokolo ten Soan Rzeka Dolina w pólnocny Pakistanski ( huzar 1997). Wyslac ten brak od skamienialosc swiadczyc, tych narzedzia ukazywac sie wobec wskazywac ten obecnosc od powracajacy do domu w ten Na poludnie Azja juz w 200,000–400,000 lata przed (Wolpert 2000) i tak jestescie prawdopodobny wobec miec byl zlaczony rezygnowac archaiczny Homoseksualista gatunek. Pakistanski lies od postulowany poludniowy przybrzezny trasa nastapil przy anatomicznie nowoczesny Homoseksualista Przemadrzalosc z Afryka, i tak maj zostaly zamieszkaly przy nowoczesny ludzie juz w równie 60,000–70,000 lata przed. Tu jest swiadczyc od jaskinia mieszkancy w Pakistanski pólnocno-zachodni granica, oprócz skamienialosc swiadczyc z Paleolityczny ma byl fragmentaryczny ( huzar 1997). Swiadczyc ma byl odslaniac przy Mehrghar, w poludniowo-zachodni Pakistanski, wskazywanie Neolityczny osady z równie dawno temu równie 7,000 b.c. (zgrzytanie 1991), który bylismy nastapil a propos Indus Dolina cywilizacje ( wliczajac w to ten handlowy od Przemowa i Mohenjodaro) ów zakwitniety w ten 3d i 2d milenia b.c. (kotliny 1991). Wokolo 1500 b.c., ten Zyrowac-European–speaking koczowniczy pastuszy plemiona z wyzsza oferta north—often wywolany ten Aryans—crossed ten Karakorum Góry w ten Na poludnie Azja. Wynikajacy z historyczny wypadki zawierac ten inwazja od Aleksander ten Wielki (327–325 b.c.) i ten Arab i Muzulmanin zdobycie z 711 a.d. ku przodom (Wolpert 2000).

Ten obecny zaludnienie od Pakistanski sklada sie od wiecej niz 160 milion indywidua ( odpowiednio wobec 2005 KTÓRY figury) który nalezec do przy najmniejszy 18 etniczny grupy i mówic wiecej niz 60 jezyki ( brudy 1992). Wiekszosc z tych jezyki jestescie Zyrowac- Europejski, oprócz oni takze zawierac an separowac, Burushaski; pewien Dravidian jezyk, Bramin; i pewien Sino- Tybetanski jezyk, Baltycki. Punjabi- rozmawianie indywidua wchodza w sklad ten wiekszosc zaludnienie od Pakistanski, oprócz oni przedstawiac pewien zlozony domieszka od etniczny grupy (Ibbetson 1883) i nie sa zanalizowany tutaj; 12 etniczny grupy jestescie zawarty w ten obecny przeglad. informacja rozporzadzalny okolo im jest zreasumowany w stól 1, razem z hipoteki okolo ich genezy (Mehdi et aluminium. 1999). Chociaz niektórzy od tych hipoteki jestescie dobrze- dostawca ( na przyklad, ten poczatek od ten Felietonisci w Iran), najliczniejszy jestescie oparty u ustny tradycje i miec nie byl testowany w stosunku do inny zródla od swiadczyc.

Niedostateczny genetyka dane jestescie rozporzadzalny pod katem tych Pakistanski etniczny grupy Wczesniej studia od ten ABO krew grupy i klasyfikator bialko markierzy zrobil nie zawierac wszystko grupy i po najwiekszej czesci klasyfikator im zgodnie z ich miejsce od mieszkanie. PEWIEN zaludnienie drzewo oparty u 54 klasyczny enzym markierzy miejsca ten Hazard i Sciezka w ten Zachód Azjatycki grono zawieranie ten pólnocny Caucasoids (kawalkada-Sforza et aluminium. 1994). W inny zaludnienie drzewo, oparty u 47 klasyfikator bialko polimorficzny, ten Pakistanski próbki wchodza w sklad pewien maly subcluster rezygnowac ten Zyrowac- Europejski mówiacy z Indie ( kawalkada-Sforza et aluminium. 1994).

Ten Y chromosomy dostarcza pewien jedyny w swym rodzaju zródlo od genetyka swiadczyc (Tyler- Kowal 1999; Bezrobotny i Tyler- Kowal 2000). Ono przewozi ten najwiekszy nonrecombining segment w ten genua i zawiera liczny stajnia podwójny markierzy, wliczajac w to opierac sie substytucja (zobaczyc, na przyklad, Skryty et aluminium 1997) i retroposon wstawienia ( uderzac 1994; Santok et aluminium. 2000), który moga byc uzywany w kombinacja rezygnowac liczniejszy- szybko rozwijajacy markierzy, taki jak microsatellites (zobaczyc, na przyklad, Ayub et aluminium. 2000). Wskutek tego, bardzo szczególowy Y filogenia puszka metalowa byc skonstruowany ów uznawac meski- specyfik miny od genetyka historia zostac zbadany. Tych jestescie silnie wplywal a propos maly skuteczny zaludnienie rozmiar od ten Y chromosomy, wiodacy wobec szybki genetyka ped, i a propos zwyczaje handlowe od patrilocality w duzo spoleczenstwa, wiodacy wobec wysoki plaszczyzny od geograficzny róznicowanie od Y haplotypes. Pomimo ten praca od Qamar et aluminium. (1999) od analiza od Wrzaskliwie zaszczekac+ chromosomy ( zawierajacy ~2.6% od ten calkowity) i analizy od STR zmiennosc (Ayub et aluminium. 2000; Mohyuddin et aluminium. 2001), maly praca ma byl przeprowadzane u Pakistanski Y chromosomy. Wiec, mamy teraz spelniony an obszerny analiza od Pakistanski Y rody, wobec ustalic co swiatlo oni puszka metalowa zrzucac od genezy i genetyka historia od ten podgrupy ów zrobic w górze ten Pakistanski zaludnienie.


Materialny i Metody

Próbki
Ten Y chromosomy od 718 bez zwiazku meski motywy, przynaleznosc do 12 etniczny grupy od Pakistanski, bylismy zanalizowany (tabele 1 i 2; figa. 1). Zawiadomiony zgodzic sie byl otrzymany z wszystko uczestnicy w ten studiowac. An Epstein Barateria virus–transformed lymphoblastoid komórka specjalnosc byl zalozony z kazdy indywidualny, i DNA byl wyciagany z tych komórka linie pod katem analiza.


Podwójny Polimorficzny Piszac na maszynie
My napisal na maszynie 15 SNPs, an Alu wstawka ( uderzac 1994; Uderzac i Horacy 1995), pewien Specjalnosc wstawka ( Santok et aluminium. 2000), i ten 12f2 skreslenie ( Casanova et aluminium. 1985). Ten opierac sie substytucja bylismy 92R7 C?T ( matematyka et aluminium. 1994); M9 C?G ( skryty et aluminium. 1997); SRY-2627 C?T (pusty et aluminium. 1997); SRY-1532 pewienG?PEWIEN (Whitfield et aluminium. 1995; Kwok et aluminium. 1996; Santok et aluminium. 1999b); sY81 (DYS271) Pewien?G (Seielstad et aluminium. 1994); SRY-8299 G?Pewien (Santok et aluminium. 1999a); Zdolny G?PEWIEN ( chinska zlota moneta zawierajaca 1 uncje czystego zlota=100 yuan et aluminium. 1998); SRY +465 C?T ( golen et aluminium 1999); LLY22g C?PEWIEN i Tat T?C przejezdzajac tranzytem (Zerjal et aluminium. 1997). W dodatek, ten M17 markier ( skryty et aluminium. 1997) byl napisal na maszynie, przy uzywac od ten elementarze GTGGTTGCTGGTTGTTACGT i AGCTGACCACAAACTGATGTAGA nastapil przy AflIII trawienie od ten PCR produkt; ten dziedziczny alleluja byl nie trawil Ten M20 markier (skryty et aluminium. 1997) byl genotyp, przy uzywac od ten elementarze CACACAACAAGGCACCATC i GATTGGGTGTCTTCAGTGCT nastapil przy SspI trawienie; ten Pewien?G mutacja burzy ten umiejscowienie przy polozenie 118 w ten 413-bp produkt. M11 (skryty et aluminium. 1997) byl napisal na maszynie, przy pomocy ten elementarze TTCATCACAAGGAGCATAAACAA i CCCTCCCTCTCTCCTTGTATTCTACC nastapil przy trawienie rezygnowac MspI. Ten 215-bp produkt byl trawil wobec 193-bp i 22-bp fragmenty w ten pochodny alleluja Ten RPS4Y C?T mutacja (Bergen et aluminium. 1999) byl wykryte przy BslI ograniczenie trawienie od pewien 528-bp PCR produkt otrzymany przy uzywac od ten elementarze CCACAGAGATGGTGTGGGTA i GAGTGGGAGGGACTGTGAGA. Ten dziedziczny C alleluja zawiera dwa tereny, i ten pochodny T alleluja nawiazywac kontakt jeden. M48 (skryty et aluminium. 1997), pewienG, byl napisal na maszynie przy alleluja- specyfik PCR przy pomocy ten wyrózniajacy elementarze TGACAATTAGGATTAAGAATATTATA i TGACAATTAGGATTAAGAATATTATG i ten wspólny elementarz AAAATTCCAAGTTTCAGTGTCACATA wobec wytwarzac specyfik 145-bp produkty Ten komplet Y podwójny markier alleluja przewozacy przy pewien pojedyncza osoba wola byc powolujacy sie na równie “the Y haplogroup.”
Od ten 718 próbki, 717 futro w haplogroups oczekiwany na podstawie ten wiedzial filogenia, oprócz jeden Sciezka próbka (PKH134) zepsuty wobec rozszerzac przy ten SRY –1532 i M17 miejsca. On byl przydzielony wobec haplogroup 3 na podstawie od zmienny SRY –1532 elementarze ( blizsze dane u prosba) i jego STR zysk.


Y-STR Piszac na maszynie
Piec trinucleotide- powtarzac polimorficzny (DYS388, DYS392, DYS425, DYS426, i DYS436), dziesiec tetranucleotide- powtarzac polimorficzny (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, i DYS439) i jeden pentanucleotide microsatellite (DYS438) bylismy napisal na maszynie w wszystko Y chromosomy. Trzy wielokrotny PCR reakcje bylismy spelniony mimo Y-STRs, w a10-µl koncowy reakcja tom zawieranie 20 ng genua DNA, równie opisywal gdzie indziej ( Tomasz et aluminium. 1999; Ayub et aluminium. 2000). PCR produkty bylismy biegac u an ABI 377 sekwencer. ABIGS350 TAMRA byl uzywany równie ten wewnetrzny droga polna wzorzec. Ten GENY i GENOTYP oprogramowanie pakunki bylismy uzywany do kolega ten dane i wobec analizowac fragment sortuje Y-STR alleluja bylismy wspomniany zgodnie z ten liczba od powtarzac jednostki oni contain.The liczba od powtarzac jednostki byl zakladac przez ten uzywac od ten który nastepuje powolywanie sie na DNA próbki. Alleluja dlugosci pod katem DYS389b bylismy otrzymany przy odejmowanie od ten DYS389II alleluja dlugosc z DYS389I.
Y-STR powielenia bylismy ufundowac przy osobisty miejsca. DYS393 byl kopiowany w PKH165 (13 i 15) i DYS437 byl kopiowany w SDH181 (8 i 9). PEWIEN liczniejszy zlozony wzór byl ufundowac w DYS425, gdzie dwa wobec cztery alleluja bylismy ufundowac w 36 indywidua z haplogroups 8, 9, 13, i 21.


Dane Analiza
Kapital- skladowy analiza byl przeprowadzane u haplogroup czestotliwosci przy uzywac od ten Widok perspektywiczny ( wzrokowy Statystyka) system oprogramowanie, wersja 5.0.2 (mlody i Sztandar 1996). Pod katem graficzny reprezentacja, ten pierwszy i drugi kapital skladowy bylismy uknuty a propos Mikroskop Wydzial Swita Przewyzszac Wagon drobnicowy u Windows 2000. Biallelic polimorficzny dane pod katem rózny swiat ludnosc uzywany w ten analiza bylismy otrzymany z Uderzac et aluminium (2001). Domieszka byl oszacowany przy uzywac od trzy rózny miary: Dlugi ustawiony najmniejszy- kwadraty (WLS) miara ( dlugi 1991); mR, pewien najmniejszy- kwadraty oceniac (Robert i Hiorns 1965); i m? (Helgason et aluminium. 2000).

Analiza od molekularny zmiana (AMOVA) byl przeprowadzane przy uzywac od ten Arlequin wagon drobnicowy (Schneider et aluminium. 1997). AMOVA miary ten proporcje rozmiary od mutacyjny rozbieznosc ufundowac rezygnowac i pomiedzy ludnosc, poszczególnie. Chociaz duzo od ten zmiennosc przy ten szybko mutowanie microsatellite miejsca jest oczekiwany wobec zostaly przedstawic w ten rózny Pakistanski subpopulations, ten jedyny w swym rodzaju mutacja wypadki przy ten podwójny miejsca jestescie duzo starszy i miec nie wydarzylo sie w ten nawiazywac kontakt od ten podzial od ten Pakistanski zaludnienie. My zapisany w testamencie ten kolejne strategia wobec eksploatowac ten suma maksymalna od zwiazany mutacyjny informacja z ten Y- chromosomy haplotypes. STR zmiennosc rezygnowac haplogroups byl uzywany do obliczac zaludnienie pairwise FST wartosc pod katem kazdy indywidualny haplogroup. Pod katem kazdy zaludnienie para, pewien ustawiony srednia arytmetyczna FST byl obliczac, gdzie ten wartosc otrzymany pod katem kazdy haplogroup byl ustawiony zgodnie z ten stosunek od pairwise zestawienia zwijanie ów haplogroup. Z braku od pewien szczególny haplogroup z jeden zaludnienie, Pewien, od ten para PEWIEN i B, FST byl umieszczac wobec 1, i ten liczba od pairwise zestawienia byl wziac równie ten liczba od chromosomy noszenie ów haplogroup w B. Wartosci od FST oparty u STRs sam albo u STRs wiecej podwójny markierzy, rezygnowac podwójny markierzy ustalony pewien 10- teczka wyzsza oferta uprzywilejowanie, bylismy obliczac pod katem porównanie. W wszystko od tych analizy, ten rezerwa matryca uzywany zlozony z od ten liczba od kroki przy który kazdy para od haplotypes rózniacy sie. Plaszcz testy pod katem ten znaczenie od korelacje pomiedzy FST wartosc bylismy przewozacy na zewnatrz w Arlequin, i wielowymiarowy skalowanie (MDS) dzialki bylismy skonstruowany przy uzywac od ten SPSS wersja 7.0 oprogramowanie wagon drobnicowy.

Mediana- laczacy kapital wlascicieli bylismy skonstruowany przy Kapital wlascicieli 2.0b ( wstega et aluminium. 1999). PEWIEN uprzywilejowanie spiskowac rezygnowac pewien piec- teczka rzad byl uzywany w ten zabudowanie od ten kapital wlascicieli. Ten gramatura pelnomocnik bylismy specyfik pod katem kazdy haplogroup i bral w uwazac ten Y-STR zmiennosc przez ten haplogroup w cale Pakistanski zaludnienie. Ten kolejne gramatura bylismy uzywany zmiana 0-0.09, waga 5; zmiana 0.1-0.19, waga 4; zmiana 0.2-0.49, waga 3; zmiana 0.5-0.99, waga od 2; i zmiana 1.00, waga 1. Wyslac ten, ten kapital wlascicieli pod katem haplogroup 1 zawierany duzo wysoki wymiarowy kostki i byl stanowczy przy zwracajacy sie ten zredukowany mediana i mediana laczacy siec metody ciagle. zredukowany mediana algorytm (wstega et aluminium. 1995) byl uzywany do wytwarzac pewien *.rmf umiescic w teczce z dokumentami i ten mediana laczacy kapital wlascicieli metoda byl stosowany wobec ten umiescic w teczce z dokumentami.

BATWING (podczas i Lysienie 1998), Bayesian Analiza od Drzewa Rezygnowac Wewnetrzny Wierzcholek Pokolenie, byl uzywany do oceniac ten czas do najliczniejszy swiezy wspólny przodek (TMRCA) od pewien komplet chromosomy. Ten program uzywa pewien Markowa lancuch Montaz Ladunek calowagonowy zasady postepowania wobec wytwarzac phylogenetic drzewa i zlaczony parametr wartosc zgodny z podatek pobierany we wczesniejszych fazach obrotu dane ( pewien komplet Y haplotypes) i genetyka i demograficzny modele Ten genetyka model przyjmuje pojedynczy- krok mutacje od ten STRs i ten demograficzny model wybrany byl wykladniczy wzrost z an poczatkowo staly- sklejony zaludnienie, rezygnowac albo rezygnowac podzial w rózny biegi od ten program Wszystko 16 STR miejsca bylismy uzywany; miejsce geometryczne- specyfik mutacja ustalona cena wczesniejszy prawdopodobienstwa oparty od dane od Kayser et aluminium. (Kayser et aluminium. 2000) bylismy skonstruowany pod katem ten miejsca rozporzadzalny równie gamma rozprowadzenie od ten wchodza w sklad gamma(, b) gdzie pewien = (1 + liczba od mutacje zaobserwowany przy Kayser et al.), i b = (1 + liczba od meioses). Pod katem miejsca nie zbadany przy Kayser et al., ten repartycja gamma (1,416) byl uzywany, który ma pewien srednia arytmetyczna od 0.0024. PEWIEN pokolenie czas od 25 lata byl przybrany. Tak ten 95% zaufanie interwaly ustalony wziac w uwazac niepewnosc w mutacja ustalona cena, zaludnienie wzrost i ( gdzie wlasciwy) podzial, oprócz nie pokolenie czas.

Wyniki

Chromosom Y Podwójny Polimorficzny
Ten 18 podwójny markierzy uzywany zidentyfikowac 20 haplogroups w swiatowy ludnosc figa 1A), oprócz tylko 11 bylismy ufundowac w Pakistanski, i 5 uwazac pod katem 92% od ten próbka ( figa. 1 i stól 2). Haplogroups 1 i 9 bylismy obecny w wszystko Pakistanski ludnosc przebadany, haplogroup 3 byl obecny w wszystko wykluczyc ten Hazard, i haplogroup 28 byl obecny w wszystko wykluczyc ten Hazard i ten Kaszmir. Poludniowo-zachodni ludnosc uwidocznic wyzsza oferta czestotliwosci od hg 9 i ten Wrzaskliwie zaszczekac+ haplogroups 21 i 8 niz pólnocno-wschodni ludnosc ( figi. 1D–E), oprócz, od poczatku do konca, maly geograficzny zgromadzony od haplogroup czestotliwosci jest oczywisty rezygnowac ten kraj.


Kapital- Podzespoly Analiza
My zyczyl sobie wobec towarzystwa ten Pakistanski Y haplogroup dane rezygnowac dane z ludnosc z odnawiac zapas towarów od ten swiat. Nie odpowiedni dane umieszczac byl wazny do ten caly komplet 18 markierzy, ale z drugiej strony dane od Uderzac et aluminium. (2001) dozwolony prawie 5 zostac uzywany, poniewaz ten sam albo phylogenetically równowazny markierzy bylismy zameldowany. kapital- skladowy analiza figa 2A) pokazuje niektórzy róznica kursów wedlug oryginalu analiza od Uderzac et al., ten glówny jeden trwajacy ten najemca rozdzielenie od ten Afrykanin ludnosc. Ten jest z powodu, pewien duzy rozmiar, do nalezy od markierzy uzywany, który nie wymaga nie zawierac duzo od ten Afryka- specyfik ci. Najliczniejszy Pakistanski ludnosc grono rezygnowac Na poludnie Azjatycki i Srodek Wschodni ludnosc, i jestescie zawrzec wobec Pólnocny Afrykanin, Srodkowy Azjatycki i Europejski ludnosc, tak przedstawienie pewien ogólny podobienstwo rezygnowac geograficznie zawrzec ludnosc. Ten jeden wyjatek jest ten Hazard, który jestescie zupelnie rózny. PEWIEN podobny analiza od ten Pakistanski ludnosc sam, przy pomocy wszystko od ten podwójny markierzy ( figa. 2B), potwierdza ten róznica pomiedzy ten Hazard i inny ludnosc i takze liczniejszy rozliczac pokazuje ten jasnosc od ten Kalash i ten Felietonisci. Ono jest uderzajacy ów ten jezyk isolate–speaking Burundi i ten Dravidian- rozmawianie Bramin czynic nie stoisko na zewnatrz w tych analizy.


Domieszka Dane szacunkowe
Hipoteki okolo zaludnienie genezy ( stól 1) moga byc uwazane równie ilosciowy pytania okolo domieszka. Na przyklad, wobec test ten mozliwosc ów ten Balucz Y chromosomy miec pewien Syryjczyk poczatek, my puszka metalowa zapytac co stosunek od ten Balucz Ys jestescie pochodny z Syryjczyk i co stosunek jestescie z Pakistanski ( uwazane zostac ten Pakistanski próbka minus ten Balucz). Dane u zasugerowany zródlo ludnosc bylismy wziac z literatura i trzy miary od domieszka bylismy obliczac. Czytanie, pisanie i arytmetyka dane szacunkowe dal ogólnie zgodny wyniki, rezygnowac maly systematyczny róznica kursów typowo m? > mR > Dlugi WLS pod katem ten oszacowany wklad z zewnetrzny zródlo zaludnienie ( stól 3). Tych wyniki zapewnic swiadczyc pod katem an zewnetrzny wklad do Hazard, Kalash, Murzyn Makrani, i Felietonisci oprócz nie do inny ludnosc.


Y- Chromosomy STR Polimorficzny
Y-STR polimorficzny bylismy zbadany uzyskac pewien liczniejszy szczególowy widok od Y zmiennosc, posród ten rózny Pakistanski etniczny grupy, ów bylby byc najemca stronniczy a propos markier- ustalenie zasady postepowania Ten rozmaitosc od Y-STR haplotypes ( stól 4) byl najnizszy pod katem ten Hazard (0.893) równie zasugerowany przy poprzedni analizy (Ayub et aluminium. 2000).
Ten 16 Y-STRs definiowal 502 Y haplotypes, ten obszerny wiekszosc trwajacy zaobserwowany w pojedynczy indywidua Ten pozostawiajacy haplotypes bylismy podzielony przy 2–18 indywidua ( blizsze dane jestescie ustalony w ten online- tylko uzupelniajacy stól). W wszystko cases oprócz jeden, ten chromosomy dzielenie pewien haplotype odpowiedni do ten sam haplogroup ( stad, 503 kombinacja haplotypes) i, w najliczniejszy cases, ten indywidua dzielenie pewien haplotype odpowiedni do ten sam zaludnienie (stól 5).

Ten GST i modalny rozmiar od ten powtarzac jednostka, mimo 16 Y-STRs przebadany w ten Pakistanski zaludnienie, jestescie ustalony w stól 6. Ten wspólzaleznosc pomiedzy markier heterozygosity i GST byl ufundowac nie wobec byc znaczacy (r0.329=; P=.213). Ten modalny rozmiar i zmiana od ten 16 Y-STRs rezygnowac haplogroups 1, 2, 3, 8, 9, 10, 21, 26, i 28 jest takze ustalony w stól 6. Pewny haplogroups miec pewien rózny modalny alleluja rozmiar, i niektórzy przyklady od ten jestescie pokazal w zuchwalstwo kursywa w stól 6. Pod katem instancja, DYS388 ma 15 powtarza w haplogroup 9, towarzystwa rezygnowac 12 powtarza w wiekszosc z inny haplogroups w Pakistanski. Podobnie, ten modalny alleluja pod katem DYS438 jest 9 w haplogroup 9, oprócz 10 albo 11 inaczej haplogroups. Ten modalny alleluja pod katem DYS434 pod katem haplogroup 10 jest 11, który jest uderzajaco rózny z alleluja rozmiar od ten miejsce geometryczne w inny haplogroups. Ten zglaszac reklamacje brak od zmiennosc pod katem DYS436 w ten 233 meski motywy przynaleznosc do haplogroup 3 jest godny uwagi. Haplogroup 10 ukazuje sie wobec miec ten najmniejszy zmiennosc przez najliczniejszy miejsca z wyjatkiem DYS390 ( stól 6). Tych wyniki przeprowadzonych badan wykazywac ten silny budowanie od Y-STR zmiennosc przy haplogroup.

My potrzebowal wobec obliczac pewien Y- oparty miara od genetyka rezerwa pomiedzy ludnosc ów bylby odbijac ten róznicowanie ów mial wydarzylo sie rezygnowac Pakistanski i ów bylby nie byc nieproporcjonalnie dominowal przy stary róznica kursów ów mial poprzednio akumulowany pomiedzy haplogroups. Ten wzorzec droga wobec czynic ten bylby byc wobec uzywac STR zmiennosc, i stól 7 reasumuje zaludnienie pairwise wartosc od FST od podstawa od STR zmiennosc sam ( pewien) albo od podwójny- markier wiecej STR zmiennosc (B), rezygnowac podwójny- markier róznica kursów ustawiony 10 czasy wyzsza oferta niz STR róznica kursów. Tych macica jestescie wysoko skorelowany (r0.95=; P.001<), równie moga byc oczekiwany z budowanie od STR zmiennosc przy haplogroup. Jednakze, tych miary jestescie znaczaco wplywal przy stary róznica kursów, i my miec wiec rozwijal pewien zmodyfikowany miara. My rozsadny ów duzo od ten STR zmiennosc rezygnowac haplogroups bylby miec dal poczetek swiezo i mogloby byc uzywany pod katem ten purpose.Nous avons dajacy sie obliczycé donc parytet dobrany do pary des dolina de zaludnienie de FST, rozdzial koranu la opierac sie du STR zmiennosc dans des haplogroups, et utilisé une moyenne peseé de ces derniers lac przedstawic une macica prosty de rezerwa de FST ( stól 7C ; figue. 3) Tych odleglosci jestescie takze wysoko skorelowany rezygnowac odleglosci oparty u STRs sam (r0.76=; P.001<) albo u STRs wiecej podwójny markierzy (r0.70=; P.001<), oprócz pewien wiekszy stosunek od ten zmiennosc jest widzial pomiedzy ludnosc (22%, towarzystwa rezygnowac 6% i 7%, poszczególnie). PEWIEN porównanie od obliczac 3 rezygnowac obliczac 2B ( który byl oparty u podwójny markier czestotliwosci sam) przychód pewien uderzajacy od poczatku do konca podobienstwo, rezygnowac ten Hazard trwajacy rózny z wszystko od inny ludnosc. Inny zalegly ludnosc jestescie ten Kalash i Felietonisci (równie przed), ten Kaszmir (moze byc z powodu ten maly próbka), i ten Bramin, który jestescie tak liczniejszy rózny w ich STR profile niz haplogroup czestotliwosci. MDS dzialki od ten odleglosci w tabele 7A i 7B (nie pokazal) dowodzic wobec podobny konkluzje, oprócz byc podobnym obliczac 2B liczniejszy scisle w ten droga ów ten Bramin czynic nie stoisko na zewnatrz tak duzo.


Mediana- Laczacy Kapital wlascicieli
Ten genetyka zwiazki posród ten rózny Pakistanski etniczny grupy bylismy odkrywany wyzsza oferta przy rysunek mediana- laczacy kapital wlascicieli ( wstega et aluminium. 1995), i przyklady jestescie pokazal w figury 4, 5, i 6. Ten haplogroup 1 siec figa 4) przychód znaczny zmiennosc, oprócz takze pewien wysoki stopien od zaludnienie- specyfik podloze Na przyklad, ten 24 Felietonisci haplogroup 1 chromosomy wszystko stac sie platnym w jednej z trzy grona ( figa. 4, zielen), 19 od 26 Burundi haplogroup 1 chromosomy stac sie platnym w dwa grona ( niebieski), i 12 od 14 Hazard haplogroup 1 chromosomy stac sie platnym w pewien pojedynczy grono, i wszystko od tych grona jestescie specyfik wobec ich indywidualny ludnosc. Ten haplogroup 10 siec figa 5) jest duzo prosty, z powodu ten mniejszy liczba od chromosomy, oprócz znowu przychód zaludnienie- specyfik zgromadzony pod katem Burundi i Hazard haplotypes. Ten haplogroup 28 kapital wlascicieli ( figa. 6) pokazuje pewien uderzajacy odizolowany Felietonisci- specyfik grono, przy ten konczyc od pewien dlugi galaz, zawieranie 15 od 16 Felietonisci haplogroup 28 chromosomy. Grona od Kalash, Burundi, and—to pewien najemca degree—Baluch chromosomy jestescie takze oczywisty, chociaz jeden Balucz haplotype jest podzielony rezygnowac Syndyk i Makrani Balucz indywidua z pobliski poludniowy ludnosc.
BATWING TMRCAs bylismy obliczony pod katem ten haplogroup 28 siec i pod katem wybrany rody rezygnowac pewna ilosc haplogroups. Ten wyniki jestescie zreasumowany w stól 8.

Dyskusja

Mamy przeprowadzane ten pierwszy obszerny analiza od Y rozmaitosc rezygnowac Pakistanski, badajacy 34 markierzy w 718 meski motywy z 12 ludnosc Ten pozwala nam wobec towarzystwa Pakistanski Y rozmaitosc po czym poprzednio zameldowany w swiat ludnosc, wobec badac róznica kursów rezygnowac Pakistanski, i wobec oszacowany niektórzy od ten zasugerowany zaludnienie historie z pewien Y perspektywa.


Zestawienia rezygnowac Swiatowy Dane
W pewien swiatowy porównanie, Pakistanski ludnosc po najwiekszej czesci grono wokolo pewien zbieral Na poludnie Azjatycki próbka i lezec zawrzec wobec pewien Srodek Wschodni próbka ( figa. 2A). Ten odkrycie jest niezaskoczony, w czesci poniewaz ten Na poludnie Azjatycki próbka zawarty 62 Pakistanski indywidua ( to jest, 32% od 196 calkowity) i w czesci poniewaz Y zmiennosc w duzo dzielnice od ten swiat jest przewaznie zbudowany przy geografia, nie przy jezyk albo etniczny przynaleznosc ( Rossosz et aluminium. 2000; Zerjal et aluminium. 2001). Ten wiekszy genetyka podobienstwo od Pakistanski ludnosc wobec ów w ten zachód niz wobec wschodni ludnosc jest zilustrowany a propos faktor ów cztery od ten piec czesty haplogroups w Pakistanski (haplogroups 1, 2, 3, i 9, który razem zrobic w górze 79% od ten calkowity zaludnienie) jestescie takze czesty w zachodni Azja i Euroobligacja oprócz nie w Porcelana albo Japonia; na odwrót, ten haplogroups ów jestescie czesty w Wschód Azja ( na przyklad, 4, 5, 10, 13, i 20) jestescie rzadki albo nieobecny w Pakistanski, ksztaltowanie tylko 2.5% od ten calkowity Jesli, równie w niektórzy interpretacje, an wczesniej masowe wedrowanie z Afryka naprzód ten poludniowy zeglowac wzdluz wybrzeza od Azja poprowadzony do pierwszy anatomicznie nowoczesny ludzki ludnosc w Pakistanski, i tych spoleczenstwo przewozacy ten wschodni haplogroups albo ich poprzednicy, ich Y chromosomy miec teraz byl wielce wymienione przy wynikajacy z migracje albo gen plynac; rzeczywiscie, ten przedstawiajacy od ten wschodni haplogroups w Pakistanski maj byc pochodny z nowoczesny w tyl- migracja, nie z stary pozostali przy zyciu.

Ten piaty haplogroup ów jest wspólny w Pakistanski, haplogroup 28, rózni sie z wszystko ten drudzy w jego repartycja. Rezygnowac Pakistanski, ono wykonane w górze 14% od nasz próbka i byl obecny w prawie dwa ludnosc ( my oboje który mial bardzo maly próbka sortuje), tak jest istotnie obydwaj wspólny i powszechny Zewnatrz Pakistanski i ten pobliski kraje, jednakze, to jest rzadki. Ono ma byl zameldowany w Indie (30%; obecny w 3/3 ludnosc), Tadzykistan (10%; obecny w 5/6 ludnosc), i Uzbekistan (3%; obecny w 10/13 ludnosc), oprócz to jest rzadki w Rosja (0.4%; obecny w 1/6 ludnosc) i ten Kaukaz (1.4%; obecny w 1/6 ludnosc (zródla mineralne et aluminium. 2001) i ma nie byl ufundowac wcale w Porcelana albo Mongolia ( nie wydany obserwacje BATWING dane szacunkowe od ten TMRCA od ten Pakistanski haplogroup 28 chromosomy bylismy ~7,000 (4,000–14,000) lata ( stól 8). Tak, wewnatrz ten czas okres, ten Pakistanski ludnosc miec rozchodzil sie z pewien wspólny dziedziczny zaludnienie albo miec doswiadczony znaczny meski gen plynac pomiedzy osobiscie albo z pewien wspólny zródlo. Skoro ten oszacowany wiek koresponduje do wczesniej Neolityczny okres, ten rozpietosc cen od ten rodowód moga byc zlaczony rezygnowac ten miejscowy rozprzestrzenienie od rolnicy.


Zestawienia rezygnowac Pakistanski
Haplogroup rozprowadzenie w Pakistanski ludnosc, z wyjatkiem ten Hazard ( dyskutowal w ten najblizszy rozcinanie), jestescie uderzajaco podobny wobec nawzajem ( figi. 1 i 2), wyslac niektórzy godny uwagi jezykoznawczy róznica kursów. Rzeczywiscie, ten jezyk separowac- rozmawianie Burundi, ten Dravidian- rozmawianie Bramin, i ten Sino-Tibetan–speaking Baltycki zrobil nie stoisko na zewnatrz z inny ludnosc wcale w ten haplogroup analizy ( stól 2 i figa. 2), sugerowanie obaj ów ten jezykoznawczy róznica kursów powstawac za ten wspólny Y wzór byl zalozony albo ów tam ma byl wystarczy Y gen plynac pomiedzy ludnosc wobec usuwac wszelki poczatkowy róznica kursów Jeszcze pewien liczniejszy szczególowy analiza od ten Y haplotypes ( na przyklad, figi. 3–6) przychód niektórzy rózny rysy twarzy od ten Bramin i znaczny zaludnienie specyfika; zaludnienie- specyfik grona od pokrewny haplotypes jestescie wspólnie ufundowac w tych kapital wlascicieli Taki grona wola tylko do zobaczenia jesli ludnosc jestescie odizolowany z nawzajem. Byc moze ze pewien niski stopien od gen plynac pomiedzy ludnosc przez pewien dawno jest wystarczy wobec skonczyc sie czyms podobny haplogroup czestotliwosci rezygnowac produkowanie duzo podzielony grona.

Zaludnienie- specyfik grona od haplotypes jestescie szczególnie oczywisty w niektórzy ludnosc. W ten Hazard, gdzie ten rózny haplogroup czestotliwosci skrypt dluzny powyzszy jestescie ufundowac, najliczniejszy chromosomy (19/23; 83%) stac sie platnym w jednej z just dwa dobrze- odizolowany grona ( figi. 4 i 5), skoro ten Felietonisci, ten Kalash, i ten Burundi takze uwidocznic wystajacy grona. Ten Hazard, Felietonisci, i Kalash bylismy ten trzy ludnosc przedstawienie ten najliczniejszy znaczaco rózny zaludnienie pairwise FST wartosc. Ten wysoki wartosci od ten Hazard i Felietonisci puszka metalowa czesciowo byc wyliczony pod katem przy migracja wobec Pakistanski z inny miejsca, oprócz pewien czynnik dodatkowy jest prawdopodobny zostac ped, obaj nalezny wobec pewien spólka z ograniczona odpowiedzialnoscia liczba od zalozyciel rody albo wystepujacy nastepnie rezygnowac maly ludnosc. Tk wartosc (Ewens 1972) zapewnic pewien droga od porównywanie skuteczny zaludnienie sortuje. Wartosci oparty od STRs pod katem ten Hazard, Felietonisci, Kalash, i Burushos bylismy 8.9, 77.5, 25.8, i 74.2, poszczególnie, towarzystwa rezygnowac pewien srednia arytmetyczna od 181.8 pod katem inny ludnosc rezygnowac próbka sortuje >20. Skuteczny zaludnienie rozmiar pod katem Y chromosomy puszka metalowa róznic sie wielce z spis zaludnienie rozmiar, oprócz to jest godny uwagi ów ten Felietonisci i Kalash czynic miec ten najmniejszy spis sortuje, jeden- setny albo jeden- tysieczny od wiekszosc z ów od inny ludnosc (stól 1), tak tych maly spis sortuje maj zostaly konserwowac dlugi czas. W zbiorczy, duzo rysy twarzy od ten obecny Pakistanski Y haplotype rozprowadzenie moga byc uwazac pod katem przy pewien podzielony dziedziczny gen kaluza, rezygnowac spólka z ograniczona odpowiedzialnoscia gen plynac pomiedzy ludnosc i ped w ten mniejszy ci.


Wnikliwosci w Zaludnienie Genezy
Ten zasugerowany zaludnienie genezy ( stól 1) puszka metalowa teraz byc uwazane w ten swiatlo od tych Y wyniki. Informacja jest zaopatrzony przy haplogroup czestotliwosci, który moga byc uzywany do przedstawic domieszka dane szacunkowe, i tych jestescie latwy wobec tlumaczyc jesli ludnosc jestescie duzy i odizolowany i ten zródlo ludnosc miec rózny czestotliwosci. Podczas tych warunki nie sa spotkal, ten obecnosc od rózny Y rody puszka metalowa wciaz byc informacyjny Ten genezy od ten Felietonisci jestescie dobrze- udokumentowal (Nanavutty 1997) i tak zapewnic pewien pozyteczny test case. Oni sa stronnicy od ten Iranski prorok Zoroaster, który wedrowal wobec Indie za ten zalamac sie od ten Sassanian imperium w ten 7th stulecie a.d. Oni osiedlac w 900 a.d. w Gujarat, Indie, gdzie oni bylismy wywolany ten “Parsi” ( znaczenie “from Iran). Ostatecznie oni poruszony wobec Mamrotac w Indie i Karakul w Pakistanski, skad ten obecny zaludnienie byl spróbowany ( figa. 7). Ich czestotliwosci pod katem haplogroups 3 (8%) i 9 (39%) czynic rzeczywiscie byc podobnym ów w Iran liczniejszy niz ci od ich rozpowszechniony sasiad w Pakistanski. Oni uwidocznic ten najnizszy czestotliwosc pod katem haplogroup 3 w Pakistanski (oprócz ten Hazard; figa 1C). Ten srednia arytmetyczna pod katem osiem Iranski ludnosc byl 14% (n401=) (kwintal-Murci et aluminium. 2001), skoro ów pod katem Pakistanski, wylaczajac ten Felietonisci, byl 36%. odpowiedni figury pod katem haplogroup 9 bylismy 39% w ten Felietonisci, 40% w Iran, i 15% w Pakistanski wylaczajac ten Felietonisci. Tych figury dowodzic wobec an domieszka oceniac od 100% z Iran ( stól 3). Ustalony ten maly skuteczny zaludnienie rozmiar od ten Felietonisci, ten bliskosc od ich zapalka do Iranski dane maj byc przypadkowy, i ten obecnosc od haplogroup 28 chromosomy przy 18% (4% w Iran; Zródla mineralne et aluminium. 2001) sugeruje niektórzy gen plynac z otaczanie ludnosc Ten TMRCA pod katem ten Felietonisci- specyfik grono w ten haplogroup 28 sieci byl 1,800 (600–4,500) lata (stól 8), zgodny z ten migracja od pewien maly liczba od rody z Iran Od poczatku do konca, tych wyniki wykazywac pewien zawrzec zapalka pomiedzy ten historyczny dokumentacja i ten Y dane, i tak zasugerowac ów ten Y dane maja byc pozyteczny podczas najemca historyczny informacja jest rozporzadzalny.
Ten zaludnienie czyli genetycznie najliczniejszy rózny, ten Hazard, zadac zejscie z Genghis Chan armia; ich wymienic jest pochodny z Perski wyraz “hazar,” znaczenie “thousand,” poniewaz gromady bylismy zostawiac z tylu w odlaczenia od tysiac. Ku ten konczyc od ten 19th stulecie, niektórzy Hazard poruszony z Afganistan do Khurram Dolina w Pakistanski, ten zródlo od ten próbki zbadany tutaj Tak, ich ustny historia utozsamia an poczatek w Mongolia i zaludnienie szyjki butelek ~800 i ~100 lata przed. Od ten dwa przewazajacy Y haplogroups obecny w ten zaludnienie, haplogroup 1 jest powszechny w Pakistanski, duzo od Azja, Euroobligacja, i ten Ameryki, i tak dostarcza maly informacja okolo ten miejsce od poczatek. Haplogroup 10, w wyksiegowac, jest rzadki w najliczniejszy Pakistanski ludnosc (1.4%, podczas ten Hazard jestescie dzien wylaczony ze swiadczen) oprócz jest wspólny w Wschód Azja, wliczajac w to Mongolia, gdzie ono wyroby w górze przez polowa od ten zaludnienie (nie wydany wyniki). Domieszka dane szacunkowe ( stól 3) jestescie zgodny z pewien znaczny wklad z Mongolia. BATWING analiza od ten Hazard- specyfik haplotype grona w haplogroups 1 i 10 zasugerowany TMRCAs od 400 (120–1,200) i 100 (6–600) lata ( stól 8), poszczególnie Tak, ten genetyka swiadczyc jest zgodny rezygnowac ten ustny tradycja i, wobec jego niezawisly natura, dostarcza silny poparcie dla ono ( figa. 7).

Niektórzy inny zasugerowany genezy otrzymywac liczniejszy spólka z ograniczona odpowiedzialnoscia poprzec z Y dane. Ten Murzyn Makrani, rezygnowac pewien postulowany poczatek w Afryka, uchwalac ten najwyzszy czestotliwosc od haplogroup 8 chromosomy ufundowac w wszelki Pakistanski zaludnienie, równie skrypt dluzny gdzie indziej (Qamar et aluminium. 1999). Ten haplogroup jest wielce ograniczony wobec pod-- Dotyczacy Sahary Afryka, gdzie ono okreg wyborczy okolo polowa od ten zaludnienie (uderzac et aluminium. 2001) i puszka metalowa tak byc traktowany równie pewien markier od Afrykanin Y chromosomy. Mimo wszystko, ono wyroby w górze tylko 9% od ten Murzyn Makrani próbka, i haplogroup 28 (wraz z inny charakterystyczny Pakistanski haplogroups) jest obecny w ten zaludnienie. Jesli ten Y chromosomy bylismy poczatkowo Afrykanin ( figa. 7), najliczniejszy miec nastepnie byl wymienione: ten od poczatku do konca oceniac od ten Afrykanin wklad jest ~12% ( stól 3).

Ten Baltycki jestescie mysl wobec miec dal poczetek w Tybet, gdzie ten przewazajacy haplogroups jestescie 4 i 26. Ani jeden byl obecny w ten próbka z ten studiowac, dostarczanie nie poparcie dla pewien Tybetanski poczatek od ten Y chromosomy rody i an domieszka oceniac od zero ( stól 3). Jednakze, ten wyniknac musi byc interpretowany ostroznie, z powodu ten maly próbka rozmiar. Trzy ludnosc miec mozliwy genezy z zbroi od Aleksander ten Wielki: ten Burundi, ten Kalash, i ten Sciezka. Nowoczesny Grecy uwidocznic pewien spokojnie wysoki czestotliwosc od haplogroup 21 (28%; Rossosz et aluminium. 2000), oprócz ten haplogroup byl nie widzial w obaj ten Burundi albo ten Kalash próbka i byl ufundowac w tylko 2% od ten Sciezka, skoro ten miejscowy haplogroup 28 byl obecny przy 17%, 25%, i 13%, poszczególnie. Grecki- domieszka dane szacunkowe od 0% bylismy otrzymany pod katem ten Burundi i ten Sciezka, oprócz figury od 20–40%% bylismy zaobserwowany pod katem ten Kalash ( stól 3). W widok od ten nieobecnosc od haplogroup 21, my przypisywac ten wyniknac obaj wobec ped w ten czestotliwosci od inny haplogroups, szczególnie haplogroups 2 i 1, albo do biedny uchwala od rody wewnatrz tych haplogroups, wynikajacy w rózny rody trwajacy klasyfikator w ten sam paraphyletic haplogroups. Od poczatku do konca, nie poparcie dla pewien Grecki poczatek od ich Y chromosomy byl ufundowac, oprócz ten zawarcie nie wymaga zadac ten zalozenie ów nowoczesny Grecy jestescie symbolizujacy od Aleksander zbroi. Dwa ludnosc, ten Kaszmir i ten Sciezka, takze klasc zadac wobec pewien mozliwy Zydowski poczatek Zydowski ludnosc wspólnie miec pewien pohamowac czestotliwosc od haplogroup 21 (na przyklad, 20%) i pewien wysoki czestotliwosc od haplogroup 9 (na przyklad, 36%; ( uderzac et aluminium 2000). Ten czestotliwosci od obydwaj od tych haplogroups jestescie niski w ten Kaszmir i Sciezka, i haplogroup 28 jest obecny przy 13% w ten Sciezka, tak nie poprzec pod katem pewien Zydowski poczatek jest ufundowac, i ten domieszka oceniac byl 0% ( stól 3), chociaz, znowu, ten zawarcie jest spólka z ograniczona odpowiedzialnoscia obydwaj a propos maly próbka rozmiar rozporzadzalny z Kaszmir i przy ten zalozenie ów ten nowoczesny próbki jestescie symbolizujacy od stary ludnosc.

Ten zasugerowany poczatek od ten Balucz jest w Syryjczyk. Syryjczycy, podobny Iranski, jestescie scharakteryzowany przy pewien niski czestotliwosc od haplogroup 3 i pewien wysoki czestotliwosc od haplogroup 9 (9% i 57%, poszczególnie; Uderzac et aluminium 2000), skoro ten odpowiedni czestotliwosci w ten Balucz jestescie 29% i 12%. Ten róznica i ten wysoki czestotliwosc od haplogroup 28 w ten Balucz (29%) zrobic pewien przewaznie Syryjczyk poczatek pod katem ich Y chromosomy nieprawdopodobny, i ten domieszka oceniac byl 0% (stól 3), chociaz ten 8% czestotliwosc pod katem haplogroup 21, ten najwyzszy utozsamic w Pakistanski tak daleki, nie wymaga wskazywac niektórzy zachodni wklad wobec ich Y rody. Bramin miec pewien mozliwy poczatek w Zachód Azja (Hughes- Grajacy na zwyzke 1991) i to bylo zasugerowany ów pewien rozpietosc cen od haplogroup 9 Y chromosomy byl zlaczony rezygnowac ten rozprzestrzenienie od Dravidian- rozmawianie rolnicy ( kwintal-Murci et aluminium. 2001). Bramin miec ten najwyzszy czestotliwosc od haplogroup 9 chromosomy w Pakistanski (28%) za ten Felietonisci, dostarczanie niektórzy poparcie dla ten hipoteza, oprócz ich wyzsza oferta czestotliwosc od haplogroup 3 (39%) jest nie typowy dla ten Urodzajny Pólksiezyc ( kwintal-Murci et aluminium. 2001) i sugeruje pewien liczniejszy zlozony poczatek, mozliwie rezygnowac domieszka z pózniejszy migracje, taki jak ów od Zyrowac- Iranski mówiacy z stepy od Srodkowy Azja i drudzy z wyzsza oferta wschód Ten mozliwosc jest dostawca a propos wykrywanie od niski czestotliwosci od haplogroups 10, 12, i 13 w ten Bramin, wszystko rzadki w Pakistanski i typowy dla Wschód Azja, Wschód i pólnocny Azja, i Poludniowo-wschodni Azja, poszczególnie.

Ten brak wobec znalezc pewien Y ogniwo rezygnowac pewien zasugerowany zaludnienie od poczatek nie wymaga nie zbijac pewien historyczny stowarzyszenie, oprócz ono nie wymaga wykazywac ów ten Y chromosomy pochodny z taki historyczny wypadki zostaly zgubiony albo wymienione. Analizy od mitochondrial DNA i inny miejsca bylby wspólpracownik wobec wyjasniac ten zaludnienie historie i bylby byc szczególnie zainteresowanie w ludnosc podobny ten Murzyn Makrani i ten Baltycki, w który tu jest pewien wyksiegowac pomiedzy ten fenotyp i ten charakterystyczny Pakistanski Y haplotypes.

Dowody


Ten praca byl podtrzymany przy pewien Wellcome Wielka aglomeracja przedsiebiorstw Kolaborujacy Badanie Wstepny Przyznawac wobec S.Q.M. T.Z. byl takze dostawca a propos Wellcome Wielka aglomeracja przedsiebiorstw, i C.T.-S. a propos Rak Badanie Kampania. My wyrazac nasz wzrost wartosci do pierwotny DNA dawcy który wykonane ten studiowac mozliwy. Ten Wydzial od Zdrowie od ten Rzad od Baluchistan i ten Balucz Student Federacja, Quetta, Pakistanski, pomagajacy w ten zestaw od ten Bramin i Balucz próbki. Sciezka próbki bylismy pobrany z pomoca ten Wydzial od Pediatria, Pani Czytanie Wyslac poczta Stopniowac Medyczny Szpital, Peshawar, pakistanski Jestesmy takze wdzieczny wobec Dr. ja Kazmi i ten Aga Chan Zalozenie Wiejski Zdrowie Poprzec Program pod katem ich pomoc w ten zestaw od Burundi próbki. Dr. F. Sethna zaopatrzony wartosciowy pomoc w ten zestaw od ten Felietonisci próbki. My dziekowac Luis Kwintal-Murci pod katem jego komentarze od rekopis.


Elektroniczny- Baza danych Informacja

URLs pod katem dane w ten przedmiot jestescie nastepujaco:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Kapital wlascicieli 2.0, http:/www.fluxus-engineering.com/.
/ Widok perspektywiczny, http:/forrest.psych.unc.edu/.

Odeslanie do konta korespondujacego

Ahmad AKN (1952) Jezus w niebo u ziemia. Ten Obywatelski i Wojskowy Gazeta Ltd, Lahore, Pakistanski.
Ayub Q, Mohyuddin Pewien, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Kowal C (2000) Identyfikacja i characterisation od powiesc ludzki Y- dotyczacy chromosomu microsatellites z sekwencje baza danych informacja. Jadra Kwasy Res 28e8: [ wolny Pelny tekst w PMC].
Uderzenie od lewa PC (1992) Baltycki. w Uderzenie od lewa PC, Radloff CF (eds) Socjolingwistyka przeglad od pólnocny Pakistanski. Vol 2, Jezyki od pólnocny dzielnice Narodowy Wszczynac od Pakistanski Studia, Islamabad, pp 3–27.
Wstega HJ, Opuszczac P, Rohl PEWIEN (1999) Mediana- laczacy kapital wlascicieli pod katem wnioskujac intraspecific filogenia Mol Biol Evol 1637–48: [PubMed] [ wolny Pelny Tekst].
Wstega HJ, Opuszczac P, Sykes BC, Ryszard MB (1995) Mitochondrial portrety od ludzki ludnosc przy pomocy mediana kapital wlascicieli. Genetyka 141743–753: [PubMed] [ wolny Pelny Tekst].
Pieknosc HW (1979) Ten wyscigi konne od Afganistan. Spiewal-e-Meel Publikacje, Lahore, Pakistanski.
Pieknosc HW (1998) An zapytanie ofertowe w ten etnograficzny od Afganistan Awangarda Ksiazki, Lahore, Pakistanski.
Bergen AW, Wyszachrowac C-Y, Tsai J, Jefferson K, Dey C, Kowal KD, Park S-C, Tsai S-J, Zloto DEMARCHE (1999) An Asian–Native Amerykanin ojcowski rodowód utozsamic przy RPS4Y resequencing i przy microsatellite haplotyping. Anna Brzeczec Genetta 6363–80: [PubMed] [pelny Tekst].
Pusty Nie, Bailliet G, Stawianie czola CM, Masowe zabijanie RF, Rothhammer F, Marcin- Nagietek VL, Karny SD (1997) Poczatek od Indianski Y- chromosomy równie wywnioskowal przy ten analiza od szesc polimorficzny markierzy. Jestem J Medycyna Majacy cechy meskie 10279–89: [PubMed] [ pelny Tekst].
Biddulph J (1977) Plemiona od ten Lania Koosh. Indus Publikacje, Karakul, Pakistanski.
Dzwig na statku RF (1851) Syndyk i ten wyscigi konne ów mieszkac ten dolina od ten Indus. WH Allen i Co Ltd, Londyn.
Koledowac O (1958) Ten Sciezka. Oxford Uniwersytet Nacisk, Karakul, Pakistanski.
Casanova M, Leroy P, Boucekkine C, Weissenbach J, Biskup C, Towarzysz M, Mruczal M, Fiord G, Siniscalco M (1985) PEWIEN ludzki Y- polaczony DNA polimorficzny i jego potencjalny pod katem oszacowanie genetyka i ewolucyjny rezerwa Nauka 2301403–1406: [PubMed].
Kawalkada-Sforza LL, Menozzi P, Plac PEWIEN (1994) Ten historia i geografia od ludzki geny. Ksiaze Uniwersytet Nacisk, Ksiaze.
Kotliny GF (1991) Ten fenomen od ten Indus cywilizacja. w Jansen M, Zagrzac z korzeniami M, Miejski G (eds) Zapomniany handlowy od Indus: wczesniej cywilizacja w Pakistanski z 8th do 2nd milenia BC. Verlag Filipinski von Zabern, Glówny, Niemcy, pp 129–144.
Dekorator KD (1992) Socjolingwistyka przeglad od Pólnocny Pakistanski. Vol 5, Jezyki od Dziecko. Narodowy Wszczynac od Pakistanski Studia, Islamabad.
Ewens WJ (1972) Ten próbkowanie zmiennych teoria od selektywnie neutralny alleluja Teoremat Lud Biol 387–112: [PubMed].
Brudy BF (1992) Etnolodzy: jezyki od ten swiat. Lato Wszczynac od Lingwistyka, Dallas.
Uderzac MF (1994) PEWIEN swiezy wstawka od an Alu element od Y chromosomy jest pewien pozyteczny markier pod katem ludzki zaludnienie studia. Mol Biol Evol 11749–761: [PubMed] [wolny Pelny Tekst].
Uderzac MF, Horacy S (1995) Y dotyczacy chromosomu DNA zmiennosc i ten zaludnianie od Japonia. Jestem J Brzeczec Genetta 56951–962: [PubMed].
Uderzac MF, Karakul TM, Czerwienic AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarchiczny wzory od globalny ludzki Chromosom Y rozmaitosc Mol Biol Evol 181189–1203: [PubMed] [ wolny Pelny Tekst].
Uderzac MF, Czerwienic AJ, Lasek ET, Czapka MR, Jarjanazi H, Karakul T, Santachiara-Benerecetti S, Oppenheim Pewien, Bezrobotny Mama, Jenki T, Ostrer H, Czapka- Oswajanie B (2000) Zydowski i Srodek Wschodni nie- Zydowski ludnosc udzial pewien wspólny kaluza od Y- chromosomy biallelic haplotypes. Proc Natl Akademie Sci USA 976769–6774: [ wolny Pelny tekst w PMC].
Helgason Pewien, Sigurdardottir S, Mikolaj J, Sykes B, Pagórek EW, Cwiek DG, Bosnes V, Gulcz JR, Straz R, Stefansson K (2000) Oceniac Skandynawski i Celtycki przodkowie w ten meski osiedlac od Islandia. Jestem J Brzeczec Genetta 67697–717: [PubMed] [ wolny Pelny Tekst].
Hughes- Grajacy na zwyzke R (1991) Cesarski slownik od Indie: prowincjonalny seria, Baluchistan. Spiewal-e-Meel, Lahore, Pakistanski.
Huzar J (1997) PEWIEN historia od ten narody od Pakistanski wobec niezaleznosc. Oxford Uniwersytet Nacisk, Karakul, Pakistanski.
Ibbetson DEMARCHE (1883) Panjab kasty Spiewal-e-Meel, Lahore, Pakistanski.
Zgrzytanie JF (1991) Mehrgarh: jego miejsce w ten rozwój od stary kultury w Pakistanski. w Jansen M, Zagrzac z korzeniami M, Miejski G (eds) Zapomniany handlowy od Indus: wczesniej cywilizacja w Pakistanski z 8th do 2nd milenia BC. Verlag Filipinski von Zabern, Glówny, Niemcy, pp 34–50.
Bezrobotny Mama, Tyler- Kowal C (2000) Nowy uzywa pod katem nowy haplotypes: ten ludzki Y chromosomy, choroba i wybór Dazy Genetta 16356–362: [PubMed] [ pelny Tekst].
Karakul TM, Zegura SL, Posukh O, Osipova L, Bergen Pewien, Dlugi J, Zloto Demarche, Klitz W, Harihara S, de Knijff P, Wiebe V, Gryf RC, Szablon AR, Uderzac MF (1999) Dziedziczny Azjatycki zródla() od nowy swiat Chromosom Y zalozyciel haplotypes. Jestem J Brzeczec Genetta 64817–831: [PubMed] [wolny Pelny Tekst].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila PEWIEN (2000) Cecha charakterystyczna i czestotliwosc od germline mutacje przy microsatellite miejsca z ludzki Y chromosomy, równie odsloniety przy kierowac obserwacja w ojciec/ syn pary. Jestem J Brzeczec Genetta 661580–1588: [PubMed] [ wolny Pelny Tekst].
Kwok C, Tyler- Kowal C, Mendonca BB, Hughes Ja, Berkovitz GD, Goodfellow PN, Polowanie z sokolem JR (1996) Mutacja analiza od ten 2 kb 5' wobec SRY w XY samice i XY przecinac motywy J Med Genetta 33465–468: [PubMed].
Dlugi JC (1991) Ten genetyka budowa od mieszajacy ludnosc. Genetyka 127417–428: [PubMed] [wolny Pelny Tekst].
Matematyka N, Ujadal M, Tyler- Kowal C (1994) Wysoko informacyjny skladowy haplotypes pod katem ten ludzki Y chromosomy. Brzeczec Mol Genetta 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansarda Pewien, Ismail M, Uderzac MF, Skryty Tatus, Kawalkada-Sforza LL (1999) Ten genezy od Pakistanski ludnosc swiadczyc z Y chromosomy markierzy. w Brodawka SS, Deka R, Chakraborty R (eds) Genua rozmaitosc: zastosowania w ludzki zaludnienie genetyka Kluwer Akademicki/Plenum Wydawcy, Nowy York, pp 83–90.
Mohyuddin Pewien, Ayub Q, Qamar R, Zerjal T, Helgason Pewien, Mehdi SQ, Tyler- Kowal C (2001) Y- dotyczacy chromosomu STR haplotypes w Pakistanski ludnosc Imie Sci Int 118141–146: [PubMed] [pelny Tekst].
Nanavutty P (1997) Ten Felietonisci. Narodowy Ksiazka Wielka aglomeracja przedsiebiorstw, Nowy Delhi, Indie.
Chinska zlota moneta zawierajaca 1 uncje czystego zlota=100 yuan Pewien, Król TE, Santok FR, Taylor PG, Thangaraj K, Zaspiewac L, Bezrobotny Mama, Tyler- Kowal C (1998) PEWIEN polimorficzny ludzki Y- dotyczacy chromosomu G wobec PEWIEN przejezdzajac tranzytem ufundowac w Indie. Ind J Brzeczec Genetta 452–61:.
Qamar R, Ayub Q, Khaliq S, Mansarda Pewien, Karakul T, Mehdi SQ, Uderzac MF (1999) Afrykanin i Wschodni wiatr sródziemnomorski genezy od Pakistanski Wrzaskliwie zaszczekac+ Y chromosomy. Brzeczec Biol 71745–755: [PubMed].
Quddus SA (1990) Ten szczepowy Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistanski.
Kwintal-Murci L, Krausz C, Zerjal T, Sayar SH, Uderzac MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin Pewien, Radhakrishna U, Bezrobotny Mama, Tyler- Kowal C, McElreavey K (2001) Chromosom Y rody slad szerzenie od spoleczenstwo i jezyki w poludniowo-zachodni Azja. Jestem J Brzeczec Genetta 68537–542: [PubMed] [wolny Pelny Tekst].
Robert DF, Hiorns R (1965) Metody od analiza od ten genetyka sklad od pewien hybrydowy zaludnienie. Brzeczec Biol 3738–43:.
Robert GS (1896) Ten Kafirs od ten Hinduski-Kush. Oxford Uniwersytet Nacisk, Karakul, Pakistanski.
Rossosz ZH, Zerjal T, Rzucony Mi, Adojaan M, Alavantic Demarche, Amoralny Pewien, Amos W, et aluminium (2000) Y- dotyczacy chromosomu rozmaitosc w Euroobligacja jest zaginac i wplywal pierwotnie przy geografia, raczej niz przy jezyk. Jestem J Brzeczec Genetta 671526–1543: [PubMed] [ wolny Pelny Tekst].
Santok FR, Carvalho- Lesny DR, Karny SDJ (1999a) PCR- oparty DNA profilowanie od ludzki Y chromosomy w Epplen JT, Lubjuhn T (eds) Metody i narzedzia w biosciences i medycyna. Birkhauser Verlag, Bezpodstawny, Szwajcaria, pp 133–152.
Santok FR, Chinska zlota moneta zawierajaca 1 uncje czystego zlota=100 yuan Pewien, Kayser M, Mitchell RJ, Liu Pewien, Zaspiewac L, Zniszczyc- Bizon G, Novelletto Pewien, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Kowal C (2000) PEWIEN polimorficzny L1 retroposon wstawka w ten centromere od ten ludzki Y chromosomy. Brzeczec Mol Genetta 9421–430: [PubMed] [ wolny Pelny Tekst].
Santok FR, Chinska zlota moneta zawierajaca 1 uncje czystego zlota=100 yuan Pewien, Tyler- Kowal C, Karny SD, Schanfield M, Leoncin WR, Osipova L, Rak MH, Mitchell RJ (1999b) Ten srodkowy Syberyjski poczatek pod katem rodzinny Amerykanin Y chromosomy. Jestem J Brzeczec Genetta 64619–628: [PubMed] [ wolny Pelny Tekst].
Schneider S, Kueffer J-M, Roessli Demarche, Excoffier L (1997) Arlequin ver 1.1: pewien oprogramowanie pod katem zaludnienie genetyka dane analiza Genetyka i Biometry Laboratorium, Uniwersytet od Genewa, Szwajcaria.
Seielstad MT, Hebert JM, Lin AA, Skryty Tatus, Ibrahim M, Vollrath Demarche, Kawalkada-Sforza LL (1994) Zabudowanie od ludzki Y- dotyczacy chromosomu haplotypes przy pomocy pewien nowy polimorficzny PEWIEN wobec G przejezdzajac tranzytem. Brzeczec Mol Genetta 32159–1261: [PubMed].
Golen T, Tomita K, Dzis T, Kotliarova SE, Oslona J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genetyka zmiany od Y chromosomy w ten Japonski zaludnienie i implikacje pod katem nowoczesny ludzki Y chromosomy rodowód. J Brzeczec Genetta 44240–245: [PubMed].
Tomasz MG, Cwiek N, Cofac sie HM (1999) Wysoki przeplyw analiza od 10 microsatellite i 11 diallelic polimorficzny od ludzki Chromosom Y. Brzeczec Genetta 105577–581: [PubMed] [pelny Tekst].
Tyler- Kowal C (1999) Y- dotyczacy chromosomu DNA markierzy. w Brodawka SS, Deka R, Chakraborty R (eds) Genua rozmaitosc: zastosowania w ludzki zaludnienie genetyka Kluwer Akademicki/Plenum Wydawcy, Nowy York, pp 65–73.
Skryty Tatus, Jin L, Lin AA, Mehdi SQ, Jenki T, Vollrath Demarche, Dawid RW, Kawalkada-Sforza LL, Oefner PJ (1997) Wykrywanie od liczny Y chromosomy biallelic polimorficzny przy denaturowanie bardzo dobrze wykonany plynny chromatography. Genua Res 7996–1005: [PubMed] [wolny Pelny Tekst].
Zródla mineralne RS, Yuldasheva N, Ruzibakiev R, Skryty Tatus, Evseeva Ja, Niebieski- Kowal J, Jin L, et aluminium (2001) Ten Euroazja bez serca: pewien nalezacy do kontynentu europejskiego perspektywa u Chromosom Y rozmaitosc Proc Natl Akademie Sci USA 9810244–10249: [ wolny Pelny tekst w PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Sekwencje zmiennosc od ten ludzki Y chromosomy Natura 378379–380: [PubMed] [ pelny Tekst].
Podczas IJ, Lysienie DJ (1998) Genealogiczny wywód z microsatellite dane. Genetyka 150499–510: [PubMed] [ wolny Pelny Tekst].
Wolpert S (2000) PEWIEN nowy historia od Indie. Oxford Uniwersytet Nacisk, Nowy York.
Mlody FW, Sztandar CM (1996) PEWIEN wzrokowy statystyka system. w Zadlo RA, Lis J (eds) Statystyczny obliczanie srodowiska pod katem towarzyski badanie. Szalwia Publikacje, Nowy York, pp 207–236.
Zerjal T, Skinienie L, Skinienie G, Mikelsaar Audiowizualny, Krumina Pewien, Kucinskas V, Rzucony Mi, Tyler- Kowal C (2001) Geograficzny, jezykoznawczy, i kulturalny wplywy u genetyka rozmaitosc: Y- dotyczacy chromosomu repartycja w Pólnocny Europejski ludnosc. Mol Biol Evol 181077–1087: [PubMed] [ wolny Pelny Tekst].
Zerjal T, Dashnyam B, Chinska zlota moneta zawierajaca 1 uncje czystego zlota=100 yuan Pewien, Kayser M, Roewer L, Santok FR, Schiefenhovel W, Fretwell N, Bezrobotny Mama, Harihara S, Klin K, Semjidmaa Demarche, Sajantila Pewien, Salon P, Rak MH, Ginter EK, Evgrafov OV, Tyler- Kowal C (1997) Genetyka zwiazki od Azjaci i Pólnocny Europejczycy, odsloniety przy Y- dotyczacy chromosomu DNA analiza. Jestem J Brzeczec Genetta 601174–1183: [PubMed].

 

 

Stronica najwyzsza oferta zaktualizowac: Friday, November 25, 2005 23:03:01 -0500