Genético

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Chromosomal DNA Variação em Paquistão
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Cristo Tyler- Ferreiro e S. Qasim Mehdi1

1Biomedical e Genético Engenharia Divisão, Dr. um Q. Khan Pesquisa Laboratórios, Islamabad; 2Cancer Pesquisa Campanha, Chromosome Molecular Biologia Grupo, Departamento de Bioquímica, e 3Institute de Biológico Antropologia, Universidade de Oxford, Oxford, Unido Reino; e descodificar Genético, Reykjavik.


Abstrato

Dezoito binário polimorfismos e 16 multiallelic, pequeno-tandem- repetente (STR) loci da nonrecombining porção da humano Y chromosome foi digitado em 718 macho sujeitos pertencente a 12 étnico grupos de Paquistão. Estes identificada 11 estável haplogroups e 503 combinação binário marcador/STR haplotypes. Haplogroup frequências foi em geral similar a essas em adjacente geográfico áreas, e o Paquistão populações falando uma língua isolar ( o Burushos), um Dravidian língua ( o Brahui), ou um Sino- Tibete língua ( o Báltico) assemelhar o Indo-European–speaking geral Ainda assim, médio- juntando redes de haplotypes revelar considerável substructuring de Y variação dentro Paquistão, com muita populações mostrando distinto cachos de haplotypes. Estes padrões pode ser conta for by um comum piscina de Y linhagens, com substancial isolamento entre populações e corrente na menor se Poucos comparativo genético ou dados históricos estão disponíveis para a maioria de populações, mas os resultados pode ser comparado com oral tradições por volta origens O Y dado suporta o bem- estabelecida origem da Analisar em Iraniana, o sugerida por descendência da Perigo de Genghis Khan’s exército, e a origem de o Negro Makrani na África, mas fazer não suporta tradições de Tibete, Sírio, Grega, ou Judaico origens for outro populações.


Introdução

As primeiras evidência de Paleolítico humano assistência na Sul Ásia consiste de pedra implementos encontrado esparso mais ou menos no dia Soan Rio Vale em norte Paquistão ( mulher leviana 1997). Apesar de a falta de fóssil evidência, estas ferramentas aparecer para indicar a presença de canjica na Sul Ásia tão cedo como 200,000–400,000 anos antes (Wolpert 2000) e assim são provavelmente ter estado aliado com arcaico Homo espécies. Paquistão falsidades ao postular sul costeiro rota seguido de anatomicamente moderno Homo Sapiência fora de África, e portanto poderá foram habitado by moderno humanos tão cedo como como 60,000–70,000 anos antes. Tem evidência de antro cidadã em Paquistão noroeste fronteira, mas fóssil evidência da Paleolítico possui estado fragmentário ( mulher leviana 1997). Evidência tem sido descoberta at Mehrghar, em sudoeste Paquistão, indicando Neolithic colônias de como há muito tempo atrás como 7,000 b.c. (desafinado 1991), qual foi seguido de o Indus Vale civilização ( inculsivo as cidades de Arenga e Mohenjodaro) que floreios na 3d e 2d milenário b.c. (vale 1991). Por volta 1500 b.c., o Indo-European–speaking nômade pastoral tribos de mais north—often chamado o Aryans—crossed o Karakorum Montanhas na Sul Ásia. Subsequente histórico eventos incluir o invasão de Alexander o Grande (327–325 b.c.) e o árabe e Musselina conquista de 711 a.d. adiante (Wolpert 2000).

O presente população de Paquistão consiste de mais do que 160 milhão indivíduo ( de acordo com a 2005 QUEM figuras) quem caber pelo menos 18 étnico grupos e falar mais do que 60 línguas ( sujeira 1992). A maioria destas línguas são Indo- Europeu, mas elas também incluir um isolar, Burushaski; um Dravidian língua, Brahui; e um Sino- Tibete língua, Báltico. Punjabi- falando indivíduo forma a maioria população de Paquistão, mas elas representar um complexa mistura de étnico grupos (Ibbetson 1883) e não são analisado aqui; 12 étnico grupos são incluído na presente pesquisa. informação disponível por volta eles é resumida em mesa 1, juntamente com hipótese por volta seu origens (Mehdi et al. 1999). Embora algum destas hipótese são bem- suportada (e.g., o origem da Analisar em Iraniana), muita são baseadas em oral tradições e tem não estado provado contra outro fontes de evidência.

Estreito genético dado estão disponíveis for estes Paquistão étnico grupos Cedo estudos de o ABO sangue grupos e clássico proteína marcadores fazia não incluir tudo grupos e principalmente classificado eles conforme seu espaço de residência. Uma população árvore baseado em 54 clássico enzima marcadores espaços o Perigo e Caminho na Oeste Ásia agrupamento contendo o norte Caucasoids (cavalgada-Sforza et al. 1994). Em outra população árvore, baseado em 47 clássico proteína polimorfismos, o Paquistão amostras forma um pequena subcluster a partir do Indo- Europeu falantes de Índia ( cavalgada-Sforza et al. 1994).

O Y chromosome proporciona um único fonte de genético evidência (Tyler- Ferreiro 1999; Desempregado e Tyler- Ferreiro 2000). A transporta a maior nonrecombining segmento em o genocídio e contém numeroso estável binário marcadores, inculsivo base substituições (sede, e.g., Clandestino et al. 1997) e retroposon inserções ( malhada 1994; Santos et al. 2000), qual pode ser utilizado em combinação com more- rapidamente evoluindo marcadores, tal microsatellites (sede, e.g., Ayub et al. 2000). Conseguinte, muita especificado Y phylogenies podem ser construído que permitem macho- específica determinados aspectos genético história aquela compressão investigar. Heis fortemente influência pela pequena efetiva população tamanho da Y chromosome, guiando a rápida genético corrente, e pela prática de patrilocality em muita sociedades, guiando a alta níveis de geográfico diferenciação de Y haplotypes. Quer o trabalho de Qamar et al. (1999) ao análise de Latido+ chromosomes ( englobando ~2.6% da total) e análise de STR variação (Ayub et al. 2000; Mohyuddin et al. 2001), pouco trabalho tem sido executado em Paquistão Y chromosomes. Portanto, havemos agora realizado um extensivo análise de Paquistão Y linhagens, a determinar what luz elas podem derramado ao origens e genético história da subgrupos que formam a Paquistão população.


Material e Métodos

amostras
O Y chromosomes de 718 desconexos macho sujeitos, pertencente a 12 étnico grupos de Paquistão, foi analisado (mesas 1 e 2; figo. 1). Informado assentimento foi obtido de tudo participantes em esse estudo. Um Epstein Barraca virus–transformed lymphoblastoid cela linha foi estabelecida de qualquer individual, e DNA foi extraída de estes cela linhas for análise.


Binário Polimorfismo Digitando
Nós digitávamos 15 SNPs, um Alu inserção ( malhada 1994; Malhada e Horai 1995), um Linha inserção (Santos et al. 2000), e o 12f2 apagamento (Casanova et al. 1985). O princípio substituições foi 92R7 Celsus?T ( matemática et al. 1994); M9 Celsus?G ( clandestino et al. 1997); SRY-2627 Celsus?T (semestral et al. 1997); SRY-1532 umG?UM (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) Um?G (Seielstad et al. 1994); SRY-8299 G?Um (Santos et al. 1999a); Apto G?UM (Pandya et al. 1998); SRY +465 Celsus?T ( canela et al. 1999); LLY22g Celsus?UM e Tat T?CELSUS transição (Zerjal et al. 1997). Além disso, o M17 marcador ( clandestino et al. 1997) foi digitado, by uso da abecedário GTGGTTGCTGGTTGTTACGT e AGCTGACCACAAACTGATGTAGA seguido de Ailed digestão da PCR produto; o ancestral aleluia não era digerido O M20 marcador (clandestino et al. 1997) foi genotyped, by uso de as cartilhas CACACAACAAGGCACCATC e GATTGGGTGTCTTCAGTGCT seguido de SspI digestão; o Um?G mutação desfazer o posto at posição 118 na 413-bp produto. M11 (clandestino et al. 1997) foi digitado, usando as cartilhas TTCATCACAAGGAGCATAAACAA e CCCTCCCTCTCTCCTTGTATTCTACC seguido de digestão com MspI. O 215-bp produto foi digerido a 193-bp e 22-bp fragmentos na originário aleluia O RPS4Y Celsus?T mutação (icebergue et al. 1999) foi detectar by BslI restrição digestão de um 528-bp PCR produto obtido by uso da abecedário CCACAGAGATGGTGTGGGTA e GAGTGGGAGGGACTGTGAGA. O ancestral CELSUS aleluia contém dois sítios, e o originário T aleluia contém um. M48 (clandestino et al. 1997), umG, foi digitado by aleluia- específica PCR usando o discriminação abecedário TGACAATTAGGATTAAGAATATTATA e TGACAATTAGGATTAAGAATATTATG e a câmara dos comuns abecedário AAAATTCCAAGTTTCAGTGTCACATA para originar específica 145-bp produtos O conjunto de Y binário marcador aleluia trazido by um único individual irá ser referida a como “the Y haplogroup.”
Da 718 amostras, 717 caído em haplogroups espera em consonância com o conhecido phylogeny, mas um Caminho prova (PKH134) não conseguiu amplificar às SRY –1532 e M17 loci. Ele era atribuída a haplogroup 3 em consonância com de alternativa SRY –1532 abecedário ( miudezas a pedido) e dele STR perfil.


Y-STR Digitando
Cinco trinucleotide- repetente polimorfismos (DYS388, DYS392, DYS425, DYS426, e DYS436), dez tetranucleotide- repetente polimorfismos (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, e DYS439) e um pentanucleotide microsatellite (DYS438) foi digitado em tudo Y chromosomes. Três múltipla PCR reações foi realizado para todos Y-STRs, em a10-µl final reação volume contendo 20 ng genocídio DNA, conforme descrito alhures (Thomas et al. 1999; Ayub et al. 2000). PCR produtos foi carreira em um ABI 377 sequenciador. ABIGS350 TAMRA foi usado que as interna alameda norma. O GENES e GENOTYPER software pacotes foi usado para recolher o dado e para analisar fragmentar tamanhos Y-STR aleluia foi nomeada conforme o número de repetente unidades elas contain.The número de repetente unidades foi estabelecida ao longo do dia uso de sequência referência DNA amostras. Aleluia compridos for DYS389b foi obtido by subtração da DYS389II aleluia comprido de DYS389I.
Y-STR duplicações foi encontrado at vária loci. DYS393 foi duplicata em PKH165 (13 e 15) e DYS437 foi duplicata em SDH181 (8 e 9). UM more complexa amostra foi que encontramos em DYS425, onde dois a quatro aleluia foi que encontramos em 36 indivíduo de haplogroups 8, 9, 13, e 21.


Dado Análise
Principal- componentes análise foi executado em haplogroup frequências by uso da Vista ( visual Estatística) sistema software, versão 5.0.2 (jovem e Banido 1996). For gráfico representação, a primeira e segunda principal componentes foi plotadora pela Microscópio Escritório Conjunto Abalizar Pacote em Janela 2000. Biallelic polimorfismo dado for vária mundial populações usado na análise foi obtido de Malhada et al. (2001). Mistura foi avaliado by uso de três diferente medidas: Longa peso menos- quadrados (WLS) medida ( longa 1991); mR, um menos- quadrados aproximação (roupão e Hiorns 1965); e m? (Helgason et al. 2000).

Análise de molecular variação (AMOVA) foi executado by uso da Arlequin pacote (Schneider et al. 1997). AMOVA medidas as proporções de mutação divergência encontrado dentro e entre populações, respectivamente. Embora a maior parte da variação às rapidamente mutação microsatellite loci é espera ter estado produziu em o diferente Paquistão subpopulations, o único mutação eventos às binário loci são muita mais velha e tem não ocorrido na contexto da subdivisão da Paquistão população. Nós achar a seguinte estratégia explorar o máxima monta de relevante mutação informação de o Y-chromosome haplotypes. STR variação dentro haplogroups foi usado para calcular população pairwise FST valores for qualquer individual haplogroup. Para cada população par, um peso acanhado FST foi calculado, onde o valor obtido para cada haplogroup foi peso conforme a proporção de pairwise comparações envolvendo que haplogroup. À revelia de um particular haplogroup a partir de um população, Um, da par UM e B, FST foi set a 1, e o número de pairwise comparações foi tomada que as número de chromosomes trazendo que haplogroup em B. Valores de FST baseado em STRs sozinho ou em STRs mais binário marcadores, com binário marcadores dada um 10- dobra maior fator de ponderação, foi calculado for comparação. Em todas as nossas estes análise, a distância matriz usado corpo da número de passos by qual qualquer par de haplotypes diferença. Lareira provas à significância de correlações entre FST valores foi trazido fora em Arlequin, e multidimensional escalada (MDS) conluios foi construído by uso da SPSS versão 7.0 software pacote.

Médio- juntando redes foi construído by Rede 2.0b ( fita para o cabelo et al. 1999). UM fator de ponderação esquema com um cinco- dobra área foi usado na construção da redes. Os pesos atribuída foi específica for qualquer haplogroup e levou em conta o Y-STR variação através o haplogroup em completo Paquistão população. A seguinte pesos foi usado variação 0-0.09, peso 5; variação 0.1-0.19, peso 4; variação 0.2-0.49, peso 3; variação 0.5-0.99, peso de 2; e variação 1.00, peso 1. Apesar de this, a rede for haplogroup 1 contido muita alta dimensão cubos e foi resolvido by aplicando o reduzido médio e médio juntando rede métodos sequencialmente. reduzido médio algoritmo (fita para o cabelo et al. 1995) foi usado para originar um *.rmf arquivo e o médio juntando rede método foi aplicada para esta finalidade arquivo.

BATWING (Wilson e Calvo 1998), Bayesian Análise de Árvores Com Interna Nódulo Geração, foi usado a aproximação o tempo à mais recente comum ancestre (TMRCA) de um set de chromosomes. Esse programa usa um Marca corrente Montagem Carrada proceder para originar phylogenetic árvores e aliado parâmetro valores consistente com insumo dado ( um conjunto de Y haplotypes) e genético e demográfico modelos O genético modelo assumir simples- passo mutações da STRs e o demográfico modelo eleito foi exponencial crescimento de um inicialmente constante- tamanho população, com ou sem subdivisão em diferente durações da programa Tudo 16 STR loci foi usado; gafanhoto- específica mutação taxa antes probabilidades com base na dado de Kayser et al. (Kayser et al. 2000) foi construído à loci disponível como gama distribuições do formato gama(, b) onde um = (1 + número de mutações observar by Kayser et al.), e b = (1 + número de meioses). For loci não investigar by Kayser et al., a distribuição gama (1,416) foi usado, que tem uma média de 0.0024. Uma geração tempo de 25 anos foi suposto. Assim o 95% confiança intervalos dada levar em consideração incerteza em mutação taxa, população crescimento e ( onde apropriado) subdivisão, mas não para geração tempo.

Resultados

Y-Chromosome Binário Polimorfismos
O 18 binário marcadores usado identificar 20 haplogroups em mundial populações figo 1A), mas somente 11 foi que encontramos em Paquistão, e 5 conta for 92% da prova ( figo. 1 e mesa 2). Haplogroups 1 e 9 foi presente em tudo Paquistão populações examinar, haplogroup 3 foi presente em tudo exceto o Perigo, e haplogroup 28 foi presente em tudo exceto o Perigo e o Kashmiris. Sudoeste populações demonstração maior frequências de hg 9 e o latido+ haplogroups 21 e 8 que nordestino populações ( figos. 1D–E), mas, global, pouco geográfico agrupamento de haplogroup frequências é aparente a partir do nação.


Principal- Componentes Análise
Nós anseio para comparar o Paquistão Y haplogroup dado com dado de populações do resto do mundo. Não adequado conjunto de dados foi disponível para o total set de 18 marcadores, mas o dado de Malhada et al. (2001) dado quase 5 aquela compressão usado, devido a que mesmo ou phylogenetically equivalente marcadores foi há quem diga. principal- componentes análise figo 2A) mostra algum diferenças desde o original análise de Malhada et al., os principais um ser o menos separação da Africana populações. Isso fica a dever-se, a um grande extensão, à subconjunto de marcadores usado, qual faz não incluir muitas das África- específica se. Muita Paquistão populações agrupamento com Sul Ásia e Médio Oriental populações, e são ao lado de Norte Africana, Central Ásia e Europeu populações, assim mostrando um general similaridade com geográfico perto populações. A exceção é o Perigo, quem são bastante distinto. UM similar análise da Paquistão populações sozinho, usando todas binário marcadores ( figo. 2B), confirma a diferença entre o Perigo e o outro populações e também more claramente mostra o distinção da Kalash e o Analisar. A é berrante que o idioma isolate–speaking Burundi e o Dravidian- falando Brahuis fazer não brilhar nestas análise.


Mistura Aproximações
Hipótese por volta população origens ( mesa 1) pode ser respeitado como quantitativa questões por volta mistura. Por exemplo, examinar o possibilidade que o Balaústre Y chromosomes tem um Sírio origem, nós podemos pedir what proporção da Balaústre Ys são originário de Síria e what proporção são de Paquistão ( respeitado aquela compressão o Paquistão prova menos o Balaústre). Dado em sugerida por fonte populações foi tomada da literatura e três medidas de mistura foi calculado. As três aproximações deu largamente consistente resultados, com pequena sistemática diferenças tipicamente m? > mR > Longa WLS à avaliado contribuição da exterior fonte população ( mesa 3). Estes resultados documentar for um exterior contribuição à Perigo, Kalash, Negro Makrani, e Analisar mas não para à outro populações.


Y-Chromosome STR Polimorfismos
Y-STR polimorfismos foi estudado para obter um more especificado vista de Y variação, entre as diferente Paquistão étnico grupos, que would ser menos parcial pela marcador- averiguação proceder A diversidade de Y-STR haplotypes ( mesa 4) foi último à Perigo (0.893) como sugerida por prévio análise (Ayub et al. 2000).
O 16 Y-STRs definido 502 Y haplotypes, a vastidão geral ser observar em simples indivíduo O resto haplotypes foi parte by 2–18 indivíduo ( miudezas são dada na online- somente suplementar mesa). Em tudo casos mas um, o chromosomes distribuição um haplotype ser à mesmo haplogroup ( disso, 503 combinação haplotypes) e, na maioria casos, o indivíduo distribuição um haplotype ser à mesmo população (mesa 5).

O GST e modalidade tamanho da repetente unidade, para todos 16 Y-STRs examinar na Paquistão população, são dada em mesa 6. O correlação entre marcador heterozygosity e GST foi encontrado para não o fazer ser significante (r0.329=; P=.213). O modalidade tamanho e variação da 16 Y-STRs dentro haplogroups 1, 2, 3, 8, 9, 10, 21, 26, e 28 é também dada em mesa 6. Certa haplogroups tem um diferente modalidade aleluia tamanho, e algum exemplos deste são mostrados em negrito itálico em mesa 6. For instância, DYS388 possui 15 repetente em haplogroup 9, em comparação com 12 repetente na maioria da outro haplogroups em Paquistão. Da mesma forma, o modalidade aleluia for DYS438 é 9 em haplogroup 9, mas 10 ou 11 na outro haplogroups. O modalidade aleluia for DYS434 for haplogroup 10 é 11, qual é atraentemente diferente da aleluia tamanho de this gafanhoto noutra haplogroups. O completo falta de variability for DYS436 na 233 macho sujeitos pertencente a haplogroup 3 é notável. Haplogroup 10 aparece ter menos variability através muita loci exceto for DYS390 ( mesa 6). Estes achados demonstrar o forte estrutural de Y-STR variability by haplogroup.

Nós desejada para calcular um Y- fundamentado medida de genético distância entre populações que would refletir a diferenciação que tido ocorrido dentro Paquistão e que would não ser desproporcional subjugado by antigo diferenças que tido anteriormente acumulado entre haplogroups. norma forma de fazer this would ser usar STR variação, e mesa 7 resume população pairwise valores de FST em o fundamento de STR variação sozinho ( um) ou de binário- marcador mais STR variação (B), com binário- marcador diferenças peso 10 tempos maior que STR diferenças. Estes matrizes são altamente correlativo (r0.95=; P.001<), como força ser espera da estrutural de STR variação by haplogroup. Agora, estas medidas são significativamente influência by antigo diferenças, e havemos portanto desenvolvido um modificado medida. Nós razão que a maior parte da STR variação dentro haplogroups would tem originada recentemente e podiam ser usado dali alvo Nós portanto calculado população pairwise valores de FST, em consonância com STR variação dentro haplogroups, e usado um média ponderada destas para produzir um único FST distância matriz ( mesa 7C; figo. 3). Estas distâncias são também altamente correlativo com distâncias baseado em STRs sozinho (r0.76=; P.001<) ou em STRs mais binário marcadores (r0.70=; P.001<), mas um maior proporção de a variação é visto entre populações (22%, comparado com 6% e 7%, respectivamente). Uma comparação de figura 3 com figura 2B ( qual foi baseado em binário marcador frequências sozinho) revela um berrante global afinidade, com o Perigo ser distinto de todas outro populações. O outro de relevo populações são o Kalash e Analisar (como anteriormente), o Kashmiris (talvez a bem de o pequena prova), e o Brahuis, quem são assim more distinto na sua STR perfis que haplogroup frequências. MDS conluios da distâncias em mesas 7A e 7B ( não mostrado) aduzir similar conclusões, mas assemelhar figura 2B more cuidadosamente na maneira como que o Brahuis fazer não estande fora tanto.


Médio- Juntando Redes
O genético relacionamentos entre as diferente Paquistão étnico grupos foi explorado mais by desenhando médio- juntando redes ( fita para o cabelo et al. 1995), e exemplos são mostrado em figuras 4, 5, e 6. O haplogroup 1 rede figo 4) revela considerável variação, até um alta grau de população- específica substructure. Por exemplo, o 24 Analisar haplogroup 1 chromosomes tudo caída em um de três cachos ( figo. 4, verde), 19 de 26 Burundi haplogroup 1 chromosomes caída em duas cachos ( azul), e 12 de 14 Perigo haplogroup 1 chromosomes caída em um único agrupamento, e todas destas cachos são específica a seu respectivo populações. O haplogroup 10 rede figo 5) é muita mais simples, a bem de o menor número de chromosomes, mas ainda revela população- específica agrupamento for Burundi e Perigo haplotypes. O haplogroup 28 rede ( figo. 6) mostra um berrante isolado Analisar- específica agrupamento, no fim de um longa ramada, contendo 15 de 16 Analisar haplogroup 28 chromosomes. Cachos de Kalash, Burundi, and—to um menos degree—Baluch chromosomes são também evidente, embora um Balaústre haplotype é parte com Sindhi e Makrani Balaústre indivíduo de perto sul populações.
BATWING TMRCAs foi calculado à haplogroup 28 rede e for seleto linhagens dentro diversos haplogroups. Os resultados são resumida em mesa 8.

Discussão

Nós temos trazido lá fora primeira extensivo análise de Y diversidade dentro Paquistão, examinador 34 marcadores em 718 macho sujeitos de 12 populações Isto permite nós pedirmos comparar Paquistão Y diversidade com que anteriormente há quem diga em mundial populações, investigar diferenças dentro Paquistão, e a avaliar parte das sugerida por população históricos de um Y perspectiva.


Comparações com Mundial Dado

Num mundial comparação, Paquistão populações principalmente agrupamento por volta um piscina Sul Ásia prova e falsidade ao lado de um meio Oriental prova ( figo. 2A). Esse achado é sem quaisquer surpresas, em parte devido a que Sul Ásia prova incluído 62 Paquistão indivíduo ( isto é, 32% de 196 total) e em parte porque Y variação em muita áreas do mundo é predominante estrutura by geografia, não by língua ou étnico afiliação (Rosser et al. 2000; Zerjal et al. 2001). O maior genético similaridade de Paquistão populações a essas na oeste que a oriental populações é ilustrado pela fato que quatro da cinco frequente haplogroups em Paquistão (haplogroups 1, 2, 3, e 9, qual junto compor 79% da total população) são também frequente em filme sobre o "Old West" Ásia e Europa mas não para em China ou Japão; inversamente, o haplogroups que são frequente em Este Ásia (e.g., 4, 5, 10, 13, e 20) são rara ou ausente em Paquistão, formando somente 2.5% da total Se, como nalgumas interpretações, um cedo êxodo de África ao longo de a costa sul da Ásia guiado à primeira anatomicamente moderno humano populações em Paquistão, e estes indivíduos trazido o oriental haplogroups ou seu precursores, seu Y chromosomes tem agora estado altamente substituída by subsequente migrações ou gene fluxo; certamente, os representantes da oriental haplogroups em Paquistão pode ser originário de moderno atrás- migração, não de antigo sobreviventes.

O quinto haplogroup que é comum em Paquistão, haplogroup 28, diferençar de tudo o outros na sua distribuição. Dentro Paquistão, a feito acima 14% das nossas prova e foi presente em quase dois populações ( que são ambas tido muita pequena tamanhos de amostra), portanto é ambas comum e alargado Fora Paquistão e o perto nações, agora, é rara. A tem sido há quem diga em Índia (30%; presente em 3/3 populações), Tajikistan (10%; presente em 5/6 populações), e Uzbekistan (3%; presente em 10/13 populações), mas é rara em Rússia (0.4%; presente em 1/6 populações) e o Caucasiano (1.4%; presente em 1/6 populações (poços et al. 2001) e não tem estado encontrado at tudo em China ou Mongólia (unpublished observações BATWING aproximações da TMRCA da Paquistão haplogroup 28 chromosomes foi ~7,000 (4,000–14,000) anos ( mesa 8). Assim, dentro esse tempo perigo, o Paquistão populações tem divergir de um comum ancestral população ou tem experiente considerável macho gene fluxo entre se ou de um comum fonte. Uma vez que avaliado idade corresponder à cedo Neolithic perigo, o espalhado deste linhagem força ser aliado com o local expansão de fazendeiras.


Comparações dentro Paquistão
Haplogroup distribuições em Paquistão populações, com exceção de o Perigo ( arrazoar na próxima seção), são atraentemente similar a um another ( figos. 1 e 2), apesar de algum notável linguística diferenças. Certamente, o idioma isolar- falando Burundi, o Dravidian- falando Brahuis, e o Sino-Tibetan–speaking Báltico fazia não brilhar da outro populações at ao todo o haplogroup análise ( mesa 2 e figo. 2), sugestão quer que o linguística diferenças arose após a câmara dos comuns Y amostra foi estabelecida ou que tem havido suficiente Y gene fluxo entre populações para eliminar qualquer inicial diferenças Ainda um more especificado análise da Y haplotypes (e.g., figos. 3–6) revela algum distinto aspectos da Brahui e considerável população específica; população- específica cachos de relacionado haplotypes são comumente que encontramos em estes redes Tal cachos irá somente ser visto se populações são isolado a partir de um another. Pode ser que um baixo grau de gene fluxo entre populações sobre um há muito tempo é suficiente a surtir similar haplogroup frequências sem produzindo muita parte cachos.

População- específica cachos de haplotypes são particularmente evidente nalgumas populações. Na Perigo, onde o distinto haplogroup frequências apontado acima são encontrado, muita chromosomes (19/23; 83%) caída num de justamente dois bem- isolado cachos ( figos. 4 e 5), enquanto o Analisar, o Kalash, e o Burundi também demonstração proeminente cachos. O Perigo, Analisar, e Kalash foi as três populações mostrando a mais significativamente diferente população pairwise FST valores. O alta valores da Perigo e Analisar podem parcialmente ser conta for by migração a Paquistão de outro espaços, até tributário fator é provavelmente aquela compressão corrente, quer devido a um limitada número de arquiteto linhagens ou ocorrido depois dentro pequena populações. Tk valores (Ewens 1972) prover um meio de comparando efetiva população tamanhos. Valores com base na STRs à Perigo, Analisar, Kalash, e Burushos foi 8.9, 77.5, 25.8, e 74.2, respectivamente, em comparação com uma média de 181.8 à outro populações com tamanhos de amostra >20. Efetiva população tamanho for Y chromosomes podem diferençar sobremaneira de censo população tamanho, mas é notável que o Analisar e Kalash fazer tem o o mais pequeno censo tamanhos, um- centésima ou um- milésimo da maior parte de essas da outro populações (mesa 1), portanto estes pequena censo tamanhos poderá foram manter muito tempo atrás. Em síntese, muita aspectos da presente Paquistão Y haplotype distribuições pode ser conta for by um parte ancestral gene piscina, com limitada gene fluxo entre populações e corrente na menor se.


Compreensões em População Origens
O sugerida por população origens ( mesa 1) podem agora ser respeitado à luz de destas Y resultados. Informação é fornecida by haplogroup frequências, que pode ser usado para produzir mistura aproximações, e heis fácil para interpretar se populações são grande e isolado e a origem populações tem diferente frequências. Quando estas condições não são encontrado, a presença de distinto Y linhagens podem ainda ser informante As origens da Analisar são bem- documentado (Nanavutty 1997) e assim prover um útil teste caso. Elas são discípulos da Iraniana profeta Zoroaster, quem migrar a Índia após o desabamento da Sassanian império na século VII a.d. Elas acomodado em 900 a.d. em Gujarat, Índia, onde as senhoras eram chamado o “Parsi” ( senso “from Iraniana). Eventualmente elas movido a Resmungo em Índia e Caratchi em Paquistão, de onde o presente população foi provado ( figo. 7). Seu frequências for haplogroups 3 (8%) e 9 (39%) fazer certamente assemelhar essas em Iraniana more que essas da sua corrente vizinhas em Paquistão. Elas demonstração o último frequência for haplogroup 3 em Paquistão (ademais o Perigo; figo 1C). O acanhado for oito Iraniana populações foi 14% (n401=) (quintal-Murci et al. 2001), considerando que for Paquistão, excluindo o Analisar, foi 36%. correspondente figuras for haplogroup 9 foi 39% em o Analisar, 40% em Iraniana, e 15% em Paquistão excluindo o Analisar. Estes números aduzir uma mistura aproximação de 100% de Iraniana ( mesa 3). Dada o pequena efetiva população tamanho da Analisar, o densidade da sua fósforo à Iraniana dado poderá ser acidental, e a presença de haplogroup 28 chromosomes at 18% (4% em Iraniana; Poços et al. 2001) sugere algum gene fluxo da ambiente populações O TMRCA for o Analisar- específica agrupamento na haplogroup 28 redes foi 1,800 (600–4,500) anos (mesa 8), consistente com a migração de um pequena número de linhagens de iraniana Global, estes resultados demonstrar um perto fósforo entre o histórico recordes e o Y dado, e assim sugerir que o Y dado estará útil quando menos histórico informação é disponível.

A população isto é genetically muita distinto, o Perigo, queixas descendência de Genghis Khan’s exército; seu nome é originário da Persa palavra “hazar,” senso “thousand,” porque tropas foi esquerda atrasado em indiferenças de um mil. Para afinal da século XIX, algum Perigo movido de Afeganistão à Khurram Vale em Paquistão, a origem de as amostras investigar aqui Assim, seu história oral identifica uma origem em Mongólia e população gargalos ~800 e ~100 anos antes. Dos dois predominante Y haplogroups presente em essa população, haplogroup 1 é alargado em Paquistão, muita da Ásia, Europa, e o América, e portanto proporciona pouco informação por volta o lugar de origem. Haplogroup 10, em contraste, é rara na maioria Paquistão populações (1.4%, quando o Perigo são excluir) mas é comum em Este Ásia, inculsivo Mongólia, em que é makes acima sobre meio da população (unpublished resultados). Mistura aproximações ( mesa 3) são consistente com um substancial contribuição de Mongólia. BATWING análise da Perigo- específica haplotype cachos em haplogroups 1 e 10 sugerida por TMRCAs de 400 (120–1,200) e 100 (6–600) anos ( mesa 8), respectivamente Assim, o genético evidência é consistente com a oral tradição quer no, vista da sua independente natureza, proporciona forte suporta lhe ( figo. 7).

Algum outro sugerida por origens receber more limitada suporta da Y dado. O Negro Makrani, com um postular origem na África, carregar o altíssimo frequência de haplogroup 8 chromosomes que encontramos em qualquer Paquistão população, como apontado alhures (Qamar et al. 1999). This haplogroup é altamente confinado a sob-Saharan África, onde a constituir cerca de metade da população (malhada et al. 2001) e podem assim ser estima como um marcador de Africana Y chromosomes. Ainda assim, a makes acima somente 9% da Negro Makrani prova, e haplogroup 28 (juntamente com outro típico Paquistão haplogroups) é presente nesta população. Se o Y chromosomes foi inicialmente Africana ( figo. 7), muita tem depois estado substituída: o sobretudo aproximação da Africana contribuição é ~12% ( mesa 3).

O Báltico são pensado ter originada em Tibete, onde o predominante haplogroups são 4 e 26. Neither foi presente na prova de esse estudo, abastecedor não suporta para um Tibete origem da Y chromosome linhagens e uma mistura aproximação de zero ( mesa 3). Agora, esse resultado deve ser interpretar com cautela, a bem de o pequena tamanho de amostra. Três populações tem possível origens da exércitos de Alexander o Grande: o Burundi, o Kalash, e o Caminho. Moderno Gregos demonstração um moderado alta frequência de haplogroup 21 (28%; Rosser et al. 2000), mas this haplogroup foi não visto em quer a Burundi ou o Kalash prova e foi que encontramos em somente 2% de o Caminho, enquanto o local haplogroup 28 foi presente at 17%, 25%, e 13%, respectivamente. Grega- mistura aproximações de 0% foi obtido à Burundi e o Caminho, mas figuras de 20–40%% foi observar for o Kalash ( mesa 3). Em vista da ausência de haplogroup 21, nós imputar esse resultado quer a corrente na frequências da outro haplogroups, particularmente haplogroups 2 e 1, ou à pobre resolução de linhagens dentro estes haplogroups, resultante em distinto linhagens ser classificado para a mesma paraphyletic haplogroups. Global, não suporta for um Grega origem da sua Y chromosomes foi encontrado, mas essa dedução faz requerer o pressuposto que moderno Gregos são representativo de Alexander’s exércitos. Dois populações, o Kashmiris e o Caminho, também secular queixa a um possível Judaico origem Judaico populações comumente tem um moderado frequência de haplogroup 21 (e.g., 20%) e um alta frequência de haplogroup 9 (e.g., 36%; (malhada et al. 2000). As frequências de ambas destas haplogroups são baixo na Kashmiris e Caminho, e haplogroup 28 é presente at 13% em o Caminho, portanto não suporta para um Judaico origem é encontrado, e a mistura aproximação foi 0% ( mesa 3), embora, ainda, essa dedução é limitada ambas pela pequena tamanho de amostra disponível de Kashmir e pela assunção que o moderno amostras são representativo de antigo populações.

O sugerida por origem da Balaústre é em Síria. Sírio, como Iraniana, são caracterizadas by um baixo frequência de haplogroup 3 e um alta frequência de haplogroup 9 (9% e 57%, respectivamente; Malhada et al. 2000), enquanto o correspondente frequências na Balaústre são 29% e 12%. Essa discordância e o alta frequência de haplogroup 28 na Balaústre (29%) arrumar uma cama predominante Sírio origem for seu Y chromosome improvável, e a mistura aproximação foi 0% (mesa 3), embora o 8% frequência for haplogroup 21, o altíssimo identificada em Paquistão assim distante, faz indicar algum filme sobre o "Old West" contribuição a seu Y linhagens. Brahuis tem um possível origem em Oeste Ásia (Hughes- Bala 1991) e tem estado sugerida por que um espalhado de haplogroup 9 Y chromosomes foi aliado com a expansão de Dravidian- falando fazendeiras ( quintal-Murci et al. 2001). Brahuis tem o altíssimo frequência de haplogroup 9 chromosomes em Paquistão (28%) após o Analisar, abastecedor algum suporta dali hipótese, mas seu maior frequência de haplogroup 3 (39%) é não típico da Fértil Crescente ( quintal-Murci et al. 2001) e sugere um more complexa origem, possivelmente com mistura de mais tarde migrações, tal essas de Indo- Iraniana falantes da estepe de Central Ásia e outros de mais este Essa possibilidade é suportada pela detecção de baixo frequências de haplogroups 10, 12, e 13 na Brahuis, tudo rara em Paquistão e típico de Este Ásia, Este e norte Ásia, e Sudeste Ásia, respectivamente.

O bomba arranjar um emprego Y ligação com um sugerida por população de origem faz não rebatida um histórico associação, mas a faz demonstrar que o Y chromosomes originário de tal histórico eventos foram perdido ou substituída. Análise de mitochondrial DNA e outro loci would ajuda elucidar a população históricos e would ser particularmente interessando em populações como o Negro Makrani e o Báltico, onde há um contraste entre o phenotype e o típico Paquistão Y haplotypes.

Confissões


Esse trabalho foi suportada by um Wellcome Confiança Colaboração Pesquisa Iniciativa Deferimento a S.Q.M. T.Z. foi também suportada pela Wellcome Confiança, e C.T.-S. pela Câncer Pesquisa Campanha. Nós expressamos nossa apreciação à original DNA doadores quem feito esse estudo possível. O departamento de Saúde da Governamental de Baluchistan e o Balaústre Estudante Federação, Quetta, Paquistão, prestou na coleção da Brahui e Balaústre amostras. Caminho amostras foi cobrado com a ajuda da Departamento de Paediatrics, Dama Lendo Poste Graduado Médico Hospital, Peshawar, Paquistão Estamos também agradecido arrastar. eu Kazmi e o Aga Khan Fundação Rural Saúde Suporta Programa for seu ajuda na coleção de Burundi amostras. Dr. F. Sethna previsto valioso ajuda na coleção da Analisar amostras. Nós agradecer Luis Quintal-Murci for dele comentários ao manuscrita.


Eletrônica- Banco de dados Informação

URLs for dado nesta artigo são os seguintes:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Rede 2.0, http:/www.fluxus-engineering.com/.
/ Vista, http:/forrest.psych.unc.edu/.

Referências

Ahmad AKN (1952) Cristo em alto em chão. Os civis e Militar Dicionário geográfico Ltd, Lahore, Paquistão.
Ayub Q, Mohyuddin Um, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Ferreiro CELSUS (2000) Identificação e characterisation de nova humano Y-chromosomal microsatellites de sequência banco de dados informação. Nuclear Ácidos Res 28e8: [ livre Total texto em PMC].
Braçada em nado de costas MICRO (1992) Báltico. em Braçada em nado de costas Micro, Radloff CF (eds) Sociolinguistic pesquisa de norte Paquistão. Vol 2, Línguas de norte áreas Nacional Instituto de Paquistão Estudos, Islamabad, pp 3–27.
Fita para o cabelo HJ, Abandonar P, Rohl UM (1999) Médio- juntando redes for implícito intraspecific phylogenies. Mol Biológico Evol 1637–48: [PubMed] [ livre Total Texto].
Fita para o cabelo HJ, Abandonar P, Sykes BC, Richards MB (1995) Mitochondrial quadros de humano populações usando médio redes. Genético 141743–753: [PubMed] [ livre Total Texto].
Beldade HW (1979) As raças de Afeganistão. Cantado-e-Meel Publicações, Lahore, Paquistão.
Beldade HW (1998) Um consulta na etnografia de Afeganistão Vanguarda Livros, Lahore, Paquistão.
Icebergue AW, Wang CELSUS-Y, Tsai J, Jefferson K, Dey Celsus, Ferreiro KD, Estacionar S- Celsus, Tsai S-J, Ouro D (1999) Um Asian–Native Americana paternal linhagem identificada by RPS4Y resequencing e by microsatellite haplotyping. Ann Zoada Genético 6363–80: [PubMed] [total Texto].
Semestral Não, Bailliet G, Baforada CM, Carnagem RF, Rothhammer F, Caxias- Malmequer VL, Penal SD (1997) Origem de Amerindian Y-chromosomes como implícito pela análise de seis polimorfo marcadores. Am J Corpóreo Anthropol 10279–89: [PubMed] [ total Texto].
Biddulph J (1977) Tribos da Posterior Koosh. Indus Publicações, Caratchi, Paquistão.
Burton RF (1851) Sindh e as raças que habitar o vale da Indus. WH Allen e Co Ltd, Londres.
Canção O (1958) O Caminho. Oxford Universidade Pressione, Caratchi, Paquistão.
Casanova M, Leroy P, Boucekkine Celsus, Weissenbach J, Bispo Celsus, Camarada M, Purrello M, Fiori G, Siniscalco M (1985) UM humano Y- vinculado DNA polimorfismo e dela potente for estimativa genético e evolutivo distância Ciência 2301403–1406: [PubMed].
Cavalgada-Sforza LL, Menozzi P, Varanda UM (1994) A história e geografia de humano genes. Príncipe Universidade Pressione, Príncipe.
Vale GF (1991) O fenômeno da Indus civilização. em Jansen M, Ponderar M, Urbano G (eds) Esquecido cidades ao Indus: cedo civilização em Paquistão da 8th à 2nd milenário BC. Verlag Filipinas von Zabern, Primeiro, Alemanha, pp 129–144.
Cabine KD (1992) Sociolinguistic pesquisa de Norte Paquistão. Vol 5, Línguas de Chitral. Nacional Instituto de Paquistão Estudos, Islamabad.
Ewens WJ (1972) A amostragem teoria de seletivamente neutral aleluia Theor Populacho Biológico 387–112: [PubMed].
Sujeira BF (1992) Etnologia: línguas do mundo. Verão Instituto de Linguística, Dallas.
Malhada MF (1994) UM recente inserção de um Alu elemento ao Y chromosome é um útil marcador for humano população estudos. Mol Biológico Evol 11749–761: [PubMed] [livre Total Texto].
Malhada MF, Horai S (1995) Y chromosomal DNA variação e o povos de Japão. Am J Zoada Genético 56951–962: [PubMed].
Malhada MF, Caratchi Meditação transcendental, Rosar AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierárquico amostras de global humano Y-chromosome diversidade Mol Biológico Evol 181189–1203: [PubMed] [ livre Total Texto].
Malhada MF, Rosar AJ, Madeira ET, Boné MR, Jarjanazi H, Caratchi T, Santachiara-Benerecetti S, Oppenheim Um, Desempregado MA, Jenkins T, Ostrer H, Boné- Domador B (2000) Judaico e Médio Oriental não- Judaico populações parte um comum piscina de Y-chromosome biallelic haplotypes. Proc Natl Acadêmica Sci EUA 976769–6774: [ livre Total texto em PMC].
Helgason Um, Sigurdardottir S, Nicholson J, Sykes B, Morro EW, Brocha DG, Bosnes V, Gulcher JR, Ala R, Stefansson K (2000) Estimativa Escandinavo e Gaelic estirpe na macho colonizador de Islândia. Am J Zoada Genético 67697–717: [PubMed] [ livre Total Texto].
Hughes- Bala R (1991) Imperial dicionário geográfico de Índia: bairrismo série, Baluchistan. Cantado-e-Meel, Lahore, Paquistão.
Mulher leviana J (1997) Uma história da povos de Paquistão para independência. Oxford Universidade Pressione, Caratchi, Paquistão.
Ibbetson D (1883) Panjab castas Cantado-e-Meel, Lahore, Paquistão.
Desafinado JF (1991) Mehrgarh: dela espaço na desenvolvimento de antigo culturas em Paquistão. em Jansen M, Ponderar M, Urbano G (eds) Esquecido cidades ao Indus: cedo civilização em Paquistão da 8th à 2nd milenário BC. Verlag Filipinas von Zabern, Primeiro, Alemanha, pp 34–50.
Desempregado MA, Tyler- Ferreiro CELSUS (2000) Nova empregos for nova haplotypes: o humano Y chromosome, doença e seleção Tendências Genético 16356–362: [PubMed] [ total Texto].
Caratchi Meditação transcendental, Zegura SL, Posukh O, Osipova L, Icebergue Um, Longa J, Ouro D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffiths RC, Templo AR, Malhada MF (1999) Ancestral Ásia fontes() de novo mundo Y-chromosome arquiteto haplotypes. Am J Zoada Genético 64817–831: [PubMed] [livre Total Texto].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger Celsus, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila UM (2000) Características e frequência de germline mutações at microsatellite loci da humano Y chromosome, como revelar by direto observação em pai/ filho pares. Am J Zoada Genético 661580–1588: [PubMed] [ livre Total Texto].
Kwok Celsus, Tyler- Ferreiro Celsus, Mendonca BB, Hughes Eu, Berkovitz GD, Goodfellow PN, Revendedor JR (1996) Mutação análise da 2 kilobyte 5' a SRY em XY fêmeas e XY cortar sujeitos J Med Genético 33465–468: [PubMed].
Longa JC (1991) O genético estrutura de misturado populações. Genético 127417–428: [PubMed] [livre Total Texto].
Matemática N, Bayes M, Tyler- Ferreiro CELSUS (1994) Altamente informante composto haplotypes for o humano Y chromosome. Zoada Mol Genético 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansoor Um, Ismail M, Malhada MF, Clandestino PA, Cavalgada-Sforza LL (1999) As origens de Paquistão populações evidência de Y chromosome marcadores. em Pimentão em pó SS, Deka R, Chakraborty R (eds) Genocídio diversidade: aplicações em humano população genético Kluwer Acadêmica/Plenum Editores, Nova Iorque, pp 83–90.
Mohyuddin Um, Ayub Q, Qamar R, Zerjal T, Helgason Um, Mehdi SQ, Tyler- Ferreiro Celsus (2001) Y-chromosomal STR haplotypes em Paquistão populações Forense Sci Int 118141–146: [PubMed] [total Texto].
Nanavutty P (1997) O Analisar. Nacional Livro Confiança, Nova Delhi, Índia.
Pandya Um rei, TE, Santos FR, Taylor PG, Thangaraj K, Cantar L, Desempregado MA, Tyler- Ferreiro CELSUS (1998) UM polimorfo humano Y-chromosomal G a Uma transição que encontramos em Índia. Ind J Zoada Genético 452–61:.
Qamar R, Ayub Q, Khaliq S, Mansoor Um, Caratchi T, Mehdi SQ, Malhada MF (1999) Africana e Levantine origens de Paquistão Latido+ Y chromosomes. Zoada Biológico 71745–755: [PubMed].
Quddus SA (1990) O tribo Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Paquistão.
Quintal-Murci L, Krausz Celsus, Zerjal T, Sayar SH, Malhada MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin Um, Radhakrishna U, Desempregado MA, Tyler- Ferreiro Celsus, McElreavey K (2001) Y-chromosome linhagens traçado difusão de povos e línguas em sudoeste Ásia. Am J Zoada Genético 68537–542: [PubMed] [livre Total Texto].
Roupão DF, Hiorns R (1965) Métodos de análise da genético composição de um híbrido população. Zoada Biológico 3738–43:.
Robertson GS (1896) O Kafirs da Hindu-Kush. Oxford Universidade Pressione, Caratchi, Paquistão.
Rosser ZH, Zerjal T, Lançada Me, Adojaan M, Alavantic D, Amoral Um, Amos W, et al (2000) Y-chromosomal diversidade na Europa é rebite e influência em primeiro lugar by geografia, ao invés de by língua. Am J Zoada Genético 671526–1543: [PubMed] [ livre Total Texto].
Santos FR, Carvalho- Prata DR, Penal SDJ (1999a) PCR- fundamentado DNA perfil de humano Y chromosomes. em Epplen JT, Lubjuhn T (eds) Métodos e ferramentas em biosciences e medicina. Birkhauser Verlag, Infundado, Suíça, pp 133–152.
Santos FR, Pandya Um, Kayser M, Mitchell RJ, Liu Um, Cantar L, Desfazer- Bisão G, Novelletto Um, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Ferreiro CELSUS (2000) UM polimorfo L1 retroposon inserção em o centromere da humano Y chromosome. Zoada Mol Genético 9421–430: [PubMed] [ livre Total Texto].
Santos FR, Pandya Um, Tyler- Ferreiro Celsus, Penal SD, Schanfield M, Leonard WR, Osipova L, Lagostim MH, Mitchell RJ (1999b) O centro Siberiano origem for nativo Americana Y chromosomes. Am J Zoada Genético 64619–628: [PubMed] [ livre Total Texto].
Schneider S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: um software for população genético dado análise Genético e Biometry Laboratório, Universidade de Genebra, Suíça.
Seielstad MT, Hebert JM, Lin AA, Clandestino PA, Ibrahim M, Vollrath D, Cavalgada-Sforza LL (1994) Construção de humano Y-chromosomal haplotypes usando um nova polimorfo UM a G transição. Zoada Mol Genético 32159–1261: [PubMed].
Canela T, Tomita K, Nesse dia T, Kotliarova SE, Lee J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genético variações ao Y chromosome na Japonesa população e implicâncias for moderno humano Y chromosome linhagem. J Zoada Genético 44240–245: [PubMed].
Thomas MG, Brocha N, Retirada HM (1999) Alta através análise de 10 microsatellite e 11 diallelic polimorfismos ao humano Y-chromosome. Zoada Genético 105577–581: [PubMed] [total Texto].
Tyler- Ferreiro CELSUS (1999) Y-chromosomal DNA marcadores. em Pimentão em pó SS, Deka R, Chakraborty R (eds) Genocídio diversidade: aplicações em humano população genético Kluwer Acadêmica/Plenum Editores, Nova Iorque, pp 65–73.
Clandestino PA, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, Davis RW, Cavalgada-Sforza LL, Oefner PJ (1997) Detecção de numeroso Y chromosome biallelic polimorfismos by denaturing alta- atuação líquido chromatography. Genocídio Res 7996–1005: [PubMed] [livre Total Texto].
Poços RS, Yuldasheva N, Ruzibakiev R, Clandestino PA, Evseeva Eu, Azul- Ferreiro J, Jin L, et al (2001) O Euroasiano heartland: um continental perspectiva em Y-chromosome diversidade Proc Natl Acadêmica Sci EUA 9810244–10249: [ livre Total texto em PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Sequência variação da humano Y chromosome. Natureza 378379–380: [PubMed] [ total Texto].
Wilson IJ, Calvo DJ (1998) Genealogical inferência de microsatellite dado. Genético 150499–510: [PubMed] [ livre Total Texto].
Wolpert S (2000) UM nova história de Índia. Oxford Universidade Pressione, Nova Iorque.
Jovem FW, Banido CM (1996) UM visual estatística sistema. em Picada RA, Raposa J (eds) Estatístico computando ambientes for social investigador. Sálvia Publicações, Nova Iorque, pp 207–236.
Zerjal T, Acenar L, Acenar G, Mikelsaar AV, Krumina Um, Kucinskas V, Lançada Me, Tyler- Ferreiro CELSUS (2001) Geográfico, linguística, e cultural influências em genético diversidade: Y-chromosomal distribuição em Norte Europeu populações. Mol Biológico Evol 181077–1087: [PubMed] [ livre Total Texto].
Zerjal T, Dashnyam B, Pandya Um, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Fretwell N, Desempregado MA, Harihara S, Vislumbre K, Semjidmaa D, Sajantila Um, Salão P, Lagostim MH, Ginter EK, Evgrafov OV, Tyler- Ferreiro CELSUS (1997) Genético relacionamentos de Ásia e Norte Europeu, revelar by Y-chromosomal DNA análise. Am J Zoada Genético 601174–1183: [PubMed].

 

 

 

 

 

 

 

 

 

 

Último da página atualizado: Friday, November 25, 2005 22:48:56 -0500