Arvelighetsforskning

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Kromosomet DNA Avveksling inne Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Chris Tyler-Smith,2 hvorfor. Qasim Mehdi1

1Biomedical og Geneteknikk Inndelingen, Dr. en Q. Khan Forskning Laboratorium, Islamabad; 2Cancer Forskning Annonsekampanje, Kromosomet Molekylær Biology Gruppe, Avdeling av Biochemistry, og 3Institute av Biological Antropologien, Universitet av Oxford, Oxford, Forenet Kingston; og avkode Arvelighetsforskning, Reykjavik.


Referatet

Atten binær polymorphisms og 16 multiallelic, kort-tandem- gjentagelse (STR) loci fra det nonrecombining havn av det human Y kromosomet var skrevet inne 718 mannlig emner hjemmehørende å 12 ethnic holdene av Pakistan. Disse kjennemerke 11 stabile haplogroups og 503 kombinasjonen binær farm land/STR haplotypes. Haplogroup hyppighet var vanligvis analog med dem inne neighboring geografisk arealer, og det Pakistansk befolkninger snakker en omgangsspråk isolere ( det Burushos), en Dravidian omgangsspråk ( det Brahui), eller en Sino-Tibetan omgangsspråk ( det Baltisk) lignet det Indo-European–speaking hovedparten Ikke desto mindre, media- blir med nettverk av haplotypes avsløre anseelig substructuring av Y avveksling innen Pakistan, med mange befolkninger viser adskilt klyngene av haplotypes. Disse mønstre kan regningen for av en vanlig vannpytt av Y i rett linje, med innholdsrik aisolering imellom befolkninger og haug inne det mindre seg Få relativ genetisk eller historisk data er anvendelig for høyst befolkninger, bortsett fra det resultater kan sammenlignet med muntlig tradisjon om origins. Det Y data oppbacking det frisk- etablerte origin av det Analysen inne Iran, det foreslo nedgang av det Hazaras fra Genghis Khan’s hæren, og opprinnelsen av det Neger- Makrani inne Afrika, bortsett fra ikke oppbacking tradisjon av Tibetan, Syrian, Gresk, eller Jødisk origins for annet befolkninger.


Introduksjon

Det tidligst bevis av Paleolithic human tilstedeværelse inne det Sør Asia består av sten iverksette grunnlegge spredt i nærheten det Soan Elv Dal inne nordlig Pakistan (Hussain 1997). Til tross for det mangel på fossil bevis, disse verktøy komme å gi uttrykk for nærværelsen av hominids inne det Sør Asia så tidlig som 200,000–400,000 år for (Wolpert 2000) og således er sikkert å ha blitt forbundet med arkaisk Homo art. Pakistan lies på postulat sør kysten veien føle etter av anatomisk moderne Homo Sapiens ute av Afrika, og så kanskje ha blitt bebodd av moderne human så tidlig som idet 60,000–70,000 år for. Det er bevis av hulen bolig inne Pakistan nordover grense, bortsett fra fossil bevis fra det Paleolithic har blitt fragmentarisk (Hussain 1997). Bevis er blitt avdekket for Mehrghar, inne southwestern Pakistan, angir Neolithic ordning fra idet for lenge siden idet 7,000 b.c. (Jarrige 1991), hvilke var føle etter av det Innsette Dal kulturen ( inkluderer byene av Plage og Mohenjodaro) det flourished inne det 3d og 2d millennia b.c. (Dales 1991). I nærheten 1500 b.c., det Indo-European–speaking nomadic pastoral tribes fra fremme north—often alarmert det Aryans—crossed det Karakorum Fjell inn i Sør Asia. Etterfølgende historisk begivenheter inkludere det invasjonen av Alexandria det Stor (327–325 b.c.) og det Araber og Muslim overvinne fra 711 a.d. onwards (Wolpert 2000).

Det gave befolkning av Pakistan består av mer enn 160 million individer ( i følge å 2005 HVEM beregner) hvem høre til det vil si 18 ethnic holdene og snakke mer enn 60 språkene ( uhyggelig 1992). Det meste av disse språkene er Indo- Europeiske, bortsett fra de likeledes inkludere en isolere, Burushaski; en Dravidian omgangsspråk, Brahui; og en Sino-Tibetan omgangsspråk, Baltisk. Punjabi- snakker individer blankett flertallet befolkning av Pakistan, bortsett fra de forestiller en innviklet tilsetningen av ethnic holdene (Ibbetson 1883) og er ikke undersøke her over; 12 ethnic holdene er inkludert inne det gave oversikt. beskjed anvendelig om seg er sammenfattet inne bord 1, sammen med hypotese om deres origins (Mehdi et al. 1999). Til tross for noe av disse hypotese er frisk- understøttet (e.g., det origin av det Analysen inne Iran), høyst er basert på muntlig tradisjon og ha ikke blitt testet imot annet kilder av bevis.

Knapp genetisk data er anvendelig for disse Pakistansk ethnic holdene Tidlig studier av det ABO blod holdene og klassisk protein skilter inkluderte ikke alle holdene og for størstedelen hemmelig seg alt etter deres sted av bolig. EN befolkning tree basert på 54 klassisk enzym skilter stedene det Hazara og Sti inne det Vest Asiaten klyngen inneholder det nordlig Caucasoids (Cavalli-Sforza et al. 1994). Inne en annen befolkning tree, basert på 47 klassisk protein polymorphisms, det Pakistansk eksemplar blankett en liten subcluster innen det Indo- Europeiske høyttaler fra India (Cavalli-Sforza et al. 1994).

Det Y kromosomet skaffer en enestående kilde av genetisk bevis (Tyler-Smith 1999; Arbeidsløs og Tyler-Smith 2000). Den bærer det størst nonrecombining avsnitt inne det Genova og behersker tallrik stabile binær skilter, inkluderer basis erstatninger (se, e.g., Lusket et al. 1997) og retroposon innsettingen ( hammer 1994; Santos et al. 2000), hvilke kan brukes inne kombinasjonen med flere- hurtig utfolder skilter, som microsatellites (se, e.g., Ayub et al. 2000). Følgelig, meget detaljert Y phylogenies kanne være bygget det tillate mannlig- spesifikk aspektene av genetisk historien å bli etterforske. Disse er kraftig ha innflytelse på av det liten effektiv befolkning kassens størrelse Y kromosomet, leder å rask genetisk haug, og av praksisen av patrilocality inne mange samfunnet, leder å høy høyder av geografisk differensiering av Y haplotypes. Trass i det arbeide av Qamar et al. (1999) på analyse av YAP+ kromosomet ( danne ~2.6% av det sum) og analyserer av STR avveksling (Ayub et al. 2000; Mohyuddin et al. 2001), liten arbeide er blitt gjennomførte opp på Pakistansk Y kromosomet. Derfor, vi har nå utført en i et stort omfang analyse av Pakistansk Y i rett linje, å avgjøre hva lyset de kanne befri seg for på origins og genetisk historien av det undergruppene det gjøre opp det Pakistansk befolkning.


Materiale og Metoder

Eksemplar
Det Y kromosomet av 718 ikke relatert mannlig emner, hjemmehørende å 12 ethnic holdene av Pakistan, var undersøke (registre 1 og 2; diagram. 1). Informert samtykket var oppnådd fra alle sider deltakere inne denne studere. En Epstein Barr virus–transformed lymphoblastoid cellen line ble grunnlagt fra hver individ, og DNA var utdraget fra disse cellen linjer for analyse.


Binær Polymorphism Maskinskrivning
Vi skrevet 15 SNPs, en Alu innsettingen ( hammer 1994; Hammer og Horai 1995), en Line innsettingen (Santos et al. 2000), og det 12f2 overstrekingen ( kvinnebedårer et al. 1985). Grunnlaget erstatninger var 92R7 C?T (Mathias et al. 1994); M9 C?G ( lusket et al. 1997); SRY-2627 C?T (Bianchi et al. 1997); SRY-1532 enG?EN (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) En?G (Seielstad et al. 1994); SRY-8299 G?En (Santos et al. 1999a); Passende G?EN (Pandya et al. 1998); SRY +465 C?T ( skinne et al. 1999); LLY22g C?EN og Tat T?C overgang (Zerjal et al. 1997). Dessuten, det M17 farm land ( lusket et al. 1997) var skrevet, av bruk av det grunning GTGGTTGCTGGTTGTTACGT og AGCTGACCACAAACTGATGTAGA føle etter av AflIII oversikten av det PCR fabrikat; det anen allele var ikke oversikten Det M20 farm land (lusket et al. 1997) var anleggspreg, av bruk av det grunning CACACAACAAGGCACCATC og GATTGGGTGTCTTCAGTGCT føle etter av SspI oversikten; det En?G mutation ødelegge byggetomta for holdning 118 inne det 413-bp fabrikat. M11 (lusket et al. 1997) var skrevet, benytter det grunning TTCATCACAAGGAGCATAAACAA og CCCTCCCTCTCTCCTTGTATTCTACC føle etter av oversikten med MspI. Det 215-bp fabrikat var oversikten å 193-bp og 22-bp deler inne det avledet allele. Det RPS4Y C?T mutation (Bergen et al. 1999) var oppdaget av BslI begrensning oversikten av en 528-bp PCR fabrikat oppnådd av bruk av det grunning CCACAGAGATGGTGTGGGTA og GAGTGGGAGGGACTGTGAGA. Det anen C allele behersker to steder, og det avledet T allele behersker ettall. M48 (lusket et al. 1997), enG, var skrevet av allele- spesifikk PCR benytter det skjønn grunning TGACAATTAGGATTAAGAATATTATA og TGACAATTAGGATTAAGAATATTATG og det vanlig grunning AAAATTCCAAGTTTCAGTGTCACATA å utvikle spesifikk 145-bp produktene Apparatet av Y binær farm land alleles bar av en enkelt individ ville være henvist å idet “the Y haplogroup.”
Av det 718 eksemplar, 717 falle til jorden i haplogroups ventet på basis av det kjent phylogeny, bortsett fra ettall Sti eksemplar (PKH134) lot være å betale forsterke for det SRY –1532 og M17 loci. Han var bestemt å haplogroup 3 på basis av av alternativ SRY –1532 grunning ( detaljene på forespørsel) og hans STR profil.


Y-STR Maskinskrivning
Fem trinucleotide- gjentagelse polymorphisms (DYS388, DYS392, DYS425, DYS426, og DYS436), ti tetranucleotide- gjentagelse polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, og DYS439) og ettall pentanucleotide microsatellite (DYS438) var skrevet inne alle Y kromosomet. Tre multikanal PCR reaksjonene var utført by all means Y-STRs, inne a10-µl final reaksjonen kvantum inneholder 20 ng Genova DNA, idet beskrevet et annet sted (Thomas et al. 1999; Ayub et al. 2000). PCR produktene var løpe opp på en ABI 377 orden. ABIGS350 TAMRA var anvendt idet det indre lane målestokk. Det TILBLIVELSE og ANLEGGSPREG programvare pakkene var pleide avhente det data og å analysere del størrelsene Y-STR alleles var benevnt alt etter antallet av gjentagelse enheter de contain.The antallet av gjentagelse enheter var etablerte igjennom det bruk av orden henvisning DNA eksemplar. Allele lengdene for DYS389b var oppnådd av fradrag av det DYS389II allele lengden fra DYS389I.
Y-STR fordobler var grunnlegge for adskillige loci. DYS393 var duplikert inne PKH165 (13 og 15) og DYS437 var duplikert inne SDH181 (8 og 9). EN flere innviklet mønster var grunnlegge inne DYS425, der hvor to å fire alleles var grunnlegge inne 36 individer fra haplogroups 8, 9, 13, og 21.


Data Analyse
Rektor- komponentene analyse var gjennomførte opp på haplogroup hyppighet av bruk av det ViSta ( synlig Statistikken) system programvare, versjon 5.0.2 (ung og Banner 1996). For grafikk representasjon, det for det første og andre rektor komponentene var tegnet av det Microsoft Kontor Suite Overgå Pakke opp på Vinduer 2000. Biallelic polymorphism data for forskjellige verden befolkninger anvendt inne analysen var oppnådd fra Hammer et al. (2001). Tilsetningen var anslått av bruk av tre annerledes måler: Lang veiede minst- kvadrat (WLS) mål ( lang 1991); herr, en minst- kvadrat anslå verdi (Roberts og Hiorns 1965); og m? (Helgason et al. 2000). Analyse av molekylær ikke stemme overens med (AMOVA) var gjennomførte av bruk av det Arlequin pakke (Schneider et al. 1997). AMOVA måler prosentandelene av mutational divergensene grunnlegge innen og imellom befolkninger, respectively. Til tross for mange av avvekslingen for det hurtig mutating microsatellite loci forventes å ha blitt produsert inne det annerledes Pakistansk subpopulations, det enestående mutation begivenheter for det binær loci er mange eldre og ha ikke hendelse inne det sammenheng av det subdivision av det Pakistansk befolkning. Vi konstruert det fulgte strategi å bedrift det maksimum beløpet av relevant mutational beskjed fra det Y- kromosomet haplotypes. STR avveksling innen haplogroups var pleide beregn befolkning pairwise FST verdier for hver individ haplogroup. For hver befolkning par, en veiede mening FST var beregnet, der hvor takstmannen oppnådd for hver haplogroup var veiede alt etter prosentandelen av pairwise sammenligningene innvolvere det haplogroup. Inne fraværet av en detalj haplogroup fra ettall befolkning, En, av det par EN og B, FST var sette å 1, og antallet av pairwise sammenligningene var tatt idet antallet av kromosomet bærer det haplogroup inne B. Verdier av FST basert på STRs alene eller opp på STRs addisjonstegn binær skilter, med binær skilter gitt en 10- folde høyere belastning, var beregnet for sammenligningen. Inne alle av disse analyserer, avstanden matrise anvendt bestod av antallet av skritt hvorved hver par av haplotypes differansen. Mantel prøver for det vekt av correlations imellom FST verdier var bar ut inne Arlequin, og multidimensional bestiger (MDS) stykke ut var bygget av bruk av det SPSS versjon 7.0 programvare pakke.

Media- blir med nettverk var bygget av Nettverk 2.0b ( revenue label et al. 1999). EN belastning plan med en fem- folde omfang var anvendt inne konstruksjonen av det nettverk. Det veier bestemt var spesifikk for hver haplogroup og tok med i regnskapet det Y-STR avveksling vannrett det haplogroup inne det hele Pakistansk befolkning. Det fulgte veier var anvendt ikke stemme overens med 0-0.09, vekt 5; ikke stemme overens med 0.1-0.19, vekt 4; ikke stemme overens med 0.2-0.49, vekt 3; ikke stemme overens med 0.5-0.99, vekt av 2; og ikke stemme overens med 1.00, vekt 1. Til tross for denne, nettverket for haplogroup 1 inneholdt mange høy dimensjonerer terningene og var løst av anvender det nedsatte media og media blir med nettverk metoder etter hverandre. nedsatte media algoritmen (revenue label et al. 1995) var pleide utvikle en *.rmf arkiv og det media blir med nettverk metoden var anvendt å denne arkiv.

BATWING (Wilson og Skallet 1998), Bayesian Analyse av Trees Med Indre Knute Generasjon, var pleide anslå verdi det tid å de fleste nylig vanlig anen (TMRCA) av en sette av kromosomet. Denne program bruker en Flekk lenken Monte Carlo fremgangsmåte å utvikle phylogenetic trees og forbundet parameter verdier gjennomført med input data ( en sette av Y haplotypes) og genetisk og demographic modeller Det genetisk modell antar enkelt- steg mutations av det STRs og det demographic modell valgt var eksponent oppblomstringen fra en i starten bestandig- tok mål befolkning, med eller uten subdivision inne annerledes starter av det program Alle 16 STR loci var anvendt; locus- spesifikk mutation rate tidligere sannsynligheter basert på informasjonen av Kayser et al. (Kayser et al. 2000) var bygget for det loci anvendelig idet gamma distribusjoner av formen gamma(, b) der hvor en = (1 + antallet av mutations iakttatt av Kayser et al.), og b = (1 + antallet av meioses). For loci ikke etterforske av Kayser et al., distribusjonen gamma (1,416) var anvendt, hvilke har en mening av 0.0024. EN generasjon tid av 25 år var antatt. Således det 95% indiskresjon intervaller gitt ta med i regnskapet uviss inne mutation rate, befolkning oppblomstringen og ( der hvor passende) subdivision, bortsett fra ikke generasjon tid.

Resultater

Y- Kromosomet Binær Polymorphisms
Det 18 binær skilter anvendt identifisere 20 haplogroups inne worldwide befolkninger diagram 1A), bortsett fra bare 11 var grunnlegge inne Pakistan, og 5 regningen for 92% av det eksemplar ( diagram. 1 og bord 2). Haplogroups 1 og 9 var gave inne alle Pakistansk befolkninger besiktiget, haplogroup 3 var gave inne alle bortsett fra det Hazaras, og haplogroup 28 var gave inne alle bortsett fra det Hazaras og det Kashmiris. Southwestern befolkninger viser høyere hyppighet av hg 9 og det YAP+ haplogroups 21 og 8 enn northeastern befolkninger (figs. 1D–E), bortsett fra, total, liten geografisk klyngen av haplogroup hyppighet skinner igjennom innen det land.


Rektor- Komponentene Analyse
Vi ønskede å sammenligne det Pakistansk Y haplogroup data med data fra befolkninger fra hvilepausen av verden. Nei passende data sette var anvendelig for helheten sette av 18 skilter, bortsett fra det data av Hammer et al. (2001) innrømmet nesten 5 å bli anvendt, fordi det likt eller phylogenetically ekvivalent skilter var rapportere. rektor- komponentene analyse diagram 2A) viser noe forskjellene fra originalen analyse av Hammer et al., det hovedavdeling ettall tilværelse det mindre atskillelse av det Afrikaner befolkninger. Denne ved hjelp av, en stor størrelse, å det subset av skilter anvendt, hvilke does ikke inkludere mange av det Afrika- spesifikk seg. Høyst Pakistansk befolkninger klyngen med Sør Asiaten og Midt Fra øst befolkninger, og er i nærheten av Nordlig Afrikaner, Sentral Asiaten og Europeiske befolkninger, således viser en general likhet med geografisk slutte befolkninger. Det ettall unntakelsen er det Hazara, hvem er helt adskilt. EN lignende analyse av det Pakistansk befolkninger alene, benytter alle av det binær skilter ( diagram. 2B), stadfester forskjellen i mellom dem Hazaras og det annet befolkninger samt flere klare viser tydeligheten av det Kalash og det Analysen. Den slår til det språket isolate–speaking Burusho og det Dravidian- snakker Brahuis står ikke ut inne disse analyserer.


Tilsetningen Anslår
Hypotese om befolkning origins ( bord 1) kan betraktet som idet kvantitativ spørsmål om tilsetningen. For eksempel, å test det mulighet det det Baluch Y kromosomet har en Syrian origin, vi kanne anmode hva prosentandel av det Baluch Ys er avledet fra Syria og hva prosentandel er fra Pakistan ( betraktet som å bli det Pakistansk eksemplar minus det Baluch). Data opp på foreslo kilde befolkninger var tatt fra litteraturen og tre måler av tilsetningen var beregnet. Det tre anslår ga bred gjennomført resultater, med liten planmessig forskjellene karakteristisk m? > herr > Lang WLS for det anslått bidrag fra det ekstern kilde befolkning ( bord 3). Disse resultater skaffe bevis for en ekstern bidrag å det Hazaras, Kalash, Neger- Makrani, og Analysen bortsett fra ikke for å det annet befolkninger.


Y- Kromosomet STR Polymorphisms
Y-STR polymorphisms var studier å få en flere detaljert utsikt av Y avveksling, blant det annerledes Pakistansk ethnic holdene, det ville være færre forutinntatt av det farm land-ascertainment fremgangsmåte Variasjonen av Y-STR haplotypes ( bord 4) var lavest for det Hazara (0.893) idet foreslo av foregående analyserer (Ayub et al. 2000). Det 16 Y-STRs definerte 502 Y haplotypes, det de fleste tilfeller tilværelse iakttatt inne enkelt individer Det resterende haplotypes var delt av 2–18 individer ( detaljene er gitt inne det online- bare supplerende bord). Inne alle sakene bortsett fra ettall, det kromosomet deler en haplotype tilhøre å det likt haplogroup ( herav, 503 kombinasjonen haplotypes) og, i de fleste tilfeller, det individer deler en haplotype tilhøre å det likt befolkning (bord 5).

Det GST og modal kassens størrelse gjentagelse enhet, for alle 16 Y-STRs besiktiget inne det Pakistansk befolkning, er gitt inne bord 6. Det korrigerte imellom farm land heterozygosity og GST var grunnlegge ikke for å være betydelig (r0.329=; P=.213). Det modal størrelse og ikke stemme overens med av det 16 Y-STRs innen haplogroups 1, 2, 3, 8, 9, 10, 21, 26, og 28 er likeledes gitt inne bord 6. Bestemt haplogroups ha en annerledes modal allele størrelse, og noe eksempler av denne er vist inne fet kursivene inne bord 6. For eksempel, DYS388 har 15 gjentar inne haplogroup 9, sammenlignet med 12 gjentar inne det meste av det annet haplogroups inne Pakistan. På lignende måte, det modal allele for DYS438 er 9 inne haplogroup 9, bortsett fra 10 eller 11 inne det annet haplogroups. Det modal allele for DYS434 for haplogroup 10 er 11, hvilke er påfallende annerledes fra det allele størrelse av denne locus inne annet haplogroups. Det fullstendig mangel på variability for DYS436 inne det 233 mannlig emner hjemmehørende å haplogroup 3 er bemerkelsesverdig. Haplogroup 10 fremgår å har den minst variability vannrett høyst loci bortsett fra for DYS390 ( bord 6). Disse resultatene demonstrere karakteregenskapen strukturerer av Y-STR variability av haplogroup.

Vi savnet å beregn en Y- basert mål av genetisk avstand imellom befolkninger det ville reflektere differensieringen det fikk hendelse innen Pakistan og det ville ikke være uforholdsmessig dominere av gamle forskjellene det fikk tidligere akkumulert imellom haplogroups. Normalen vei å gjøre denne ville være å bruk STR avveksling, og bord 7 sammenfatte befolkning pairwise verdier av FST på basis av STR avveksling alene ( en) eller av binær- farm land addisjonstegn STR avveksling (B), med binær- farm land forskjellene veiede 10 timene høyere enn STR forskjellene. Disse matrise er høylig korrigerte (r0.95=; P.001<), idet kunne være ventet fra det strukturerer av STR avveksling av haplogroup. Imidlertid, disse måler er viktig under innflytelse fra gamle forskjellene, og vi ha derfor bebygget en modifisert mål. Vi grunn det mange av det STR avveksling innen haplogroups ville ha oppstå i den seneste tid og kunne bli brukt for denne purpose.Nous avons beregné donc par par des valeurs de befolkning de FST, sur la basis du STR avveksling dans des haplogroups, et hjelpemidleré une moyenne peseé de ces derniers tømme tilvirke une matrise enkel de avstand de FST ( bord 7C ; figue. 3) Disse avstander er likeledes høylig korrigerte med avstander basert opp på STRs alene (r0.76=; P.001<) eller opp på STRs addisjonstegn binær skilter (r0.70=; P.001<), bortsett fra en betydelig prosentandel av avvekslingen er sett imellom befolkninger (22%, sammenlignet med 6% og 7%, respectively). EN sammenligningen av skikkelsen 3 med skikkelsen 2B ( hvilke var basert på binær farm land hyppighet alene) avsløre en påfallende total likhet, med det Hazaras tilværelse adskilt fra alle sider av det annet befolkninger. Det annet fremragende befolkninger er det Kalash og Analysen (som før), det Kashmiris (muligens med hensyn til det liten eksemplar), og det Brahuis, hvem er således flere adskilt inne deres STR profiler enn haplogroup hyppighet. MDS stykke ut av avstandene inne registre 7A og 7B (ikke vist) føre til lignende konklusjonene, bortsett fra ligne skikkelsen 2B nærmere inne måten det det Brahuis står ikke ut så mange.


Media- Blir med Nettverk
Det genetisk forbindelser blant det annerledes Pakistansk ethnic holdene var utforske fremme av tegner media- blir med nettverk ( revenue label et al. 1995), og eksempler er vist inne beregner 4, 5, og 6. Det haplogroup 1 nettverk diagram 4) avsløre anseelig avveksling, bortsett fra likeledes en høy graden av befolkning- spesifikk substructure. For eksempel, det 24 Analysen haplogroup 1 kromosomet alle falle i ettall av tre klyngene ( diagram. 4, grønn), 19 av 26 Burusho haplogroup 1 kromosomet falle i to klyngene ( blåfarge), og 12 av 14 Hazara haplogroup 1 kromosomet falle i en enkelt klyngen, og alle av disse klyngene er spesifikk å deres respekt befolkninger. Det haplogroup 10 nettverk diagram 5) er mange enklere, med hensyn til det mindre antallet av kromosomet, bortsett fra atter avsløre befolkning- spesifikk klyngen for Burusho og Hazara haplotypes. Det haplogroup 28 nettverk ( diagram. 6) viser en påfallende isolere Analysen- spesifikk klyngen, bak i en lang armen, inneholder 15 av 16 Analysen haplogroup 28 kromosomet. Klyngene av Kalash, Burusho, and—to en mindre degree—Baluch kromosomet er likeledes innlysende, til tross for ettall Baluch haplotype er delt med Sindhi og Makrani Baluch individer fra rett ved sør befolkninger.
BATWING TMRCAs var beregnet for det haplogroup 28 nettverk og for valgt i rett linje innen et antall haplogroups. Det resultater er sammenfattet inne bord 8.

Diskusjonen

Vi har gjennomførte det for det første i et stort omfang analyse av Y variasjonen innen Pakistan, undersøkelsen 34 skilter inne 718 mannlig emner fra 12 befolkninger Denne innrømmer oss å sammenligne Pakistansk Y variasjonen med det tidligere rapportere inne verden befolkninger, å etterforske forskjellene innen Pakistan, og å vurdere noen av det foreslo befolkning historisk fra en Y perspektiv.


Sammenligningene med Worldwide Data
Inne en worldwide sammenligningen, Pakistansk befolkninger for størstedelen klyngen i nærheten en vannpytt Sør Asiaten eksemplar og skrøne i nærheten av en Midt Fra øst eksemplar ( diagram. 2A). Denne oppdagelse er unsurprising, inne del fordi det Sør Asiaten eksemplar inkludert 62 Pakistansk individer (i.e., 32% av 196 sum) og inne del fordi Y avveksling inne mange arealer av verden er dominerende konstruert av geografi, ikke av omgangsspråk eller ethnic tilknytningen (Rosser et al. 2000; Zerjal et al. 2001). Det betydelig genetisk likhet av Pakistansk befolkninger å dem inne det vest enn å fra øst befolkninger er belyst av fakta det fire av det fem hyppig haplogroups inne Pakistan (haplogroups 1, 2, 3, og 9, hvilke sammen gjøre opp 79% av det sum befolkning) er likeledes hyppig inne villvestfilm Asia og Europa bortsett fra ikke inne Porselen eller Japan; omvendt, det haplogroups det er hyppig inne Øst Asia (e.g., 4, 5, 10, 13, og 20) er sjelden eller borte inne Pakistan, danner bare 2.5% av det sum Hvis, idet inne noe forklaring, en tidlig exodus fra Afrika frem det sør kysten av Asia smal avsats å det for det første anatomisk moderne human befolkninger inne Pakistan, og disse folk bar det fra øst haplogroups eller deres precursors, deres Y kromosomet ha nå blitt hovedsakelig erstattet av etterfølgende migrations eller gene flyte; virkelig, representantene av det fra øst haplogroups inne Pakistan kanskje være avledet fra moderne rygg-migration, ikke fra gamle overlevende.
Det femte haplogroup det er vanlig inne Pakistan, haplogroup 28, skiller ut fra alle sider det andre i sin distribusjon. Innen Pakistan, den fremstilt opp 14% av våre eksemplar og var gave inne nesten to befolkninger ( begge to hvis fikk meget liten eksemplar størrelsene), så det er en begge to vanlig og alminnelig utbredt Ytterside Pakistan og det rett ved land, imidlertid, det er en sjelden. Den er blitt rapportere inne India (30%; gave inne 3/3 befolkninger), Tajikistan (10%; gave inne 5/6 befolkninger), og Uzbekistan (3%; gave inne 10/13 befolkninger), bortsett fra det er en sjelden inne Russland (0.4%; gave inne 1/6 befolkninger) og det Caucasus (1.4%; gave inne 1/6 befolkninger (frisk et al. 2001) og har ikke blitt grunnlegge i det hele tatt inne Porselen eller Mongolia ( upublisert observasjoner BATWING anslår av det TMRCA av det Pakistansk haplogroup 28 kromosomet var ~7,000 (4,000–14,000) år ( bord 8). Således, innen i denne omgang periode, det Pakistansk befolkninger ha dykkeren fra en vanlig anen befolkning eller ha erfaring anseelig mannlig gene flyte imellom dem selv eller fra en vanlig kilde. Siden det anslått alderen korresponderer å det tidlig Neolithic periode, det spre av denne i rett linje kunne være forbundet med det innenbys ekspansjon av gårdbruker.


Sammenligningene innen Pakistan
Haplogroup distribusjoner inne Pakistansk befolkninger, med unntagelse av det Hazara ( omtalt inne det neste avdeling), er påfallende analog med hver andre (figs. 1 og 2), til tross for noe bemerkelsesverdig språklig forskjellene. Virkelig, språket isolere- snakker Burusho, det Dravidian- snakker Brahuis, og det Sino-Tibetan–speaking Baltisk stod ikke ut fra det annet befolkninger i det hele tatt inne det haplogroup analyserer ( bord 2 og diagram. 2), forslag enten den ene eller den andre av det det språklig forskjellene dukket opp etter det vanlig Y mønster ble grunnlagt eller det der er blitt nok Y gene flyte imellom befolkninger å fjerne alle initial forskjellene Ennå en flere detaljert analyse av det Y haplotypes (e.g., figs. 3–6) avsløre noe adskilt vise egenskaper av det Brahui og anseelig befolkning spesifikk; befolkning- spesifikk klyngene av i slekt haplotypes er vanligvis grunnlegge inne disse nettverk Slik klyngene ville bare være sett hvis befolkninger er isolere fra hver andre. Den kanskje være det en lav graden av gene flyte imellom befolkninger over for lenge siden er nok å gir seg utslag i lignende haplogroup hyppighet uten produserer mange delt klyngene.

Befolkning- spesifikk klyngene av haplotypes er spesielt innlysende inne noe befolkninger. Inne det Hazaras, der hvor det adskilt haplogroup hyppighet bemerket over er grunnlegge, høyst kromosomet (19/23; 83%) falle i ettall av rettferdig to frisk- isolere klyngene (figs. 4 og 5), mens derimot det Analysen, det Kalash, og det Burusho likeledes viser prominent klyngene. Det Hazaras, Analysen, og Kalash var det tre befolkninger viser de fleste viktig annerledes befolkning pairwise FST verdier. Det høy verdier av det Hazaras og Analysen kanne delvis være regningen for av migration å Pakistan fra annet stedene, bortsett fra en bidrar faktoren er sikkert å bli haug, enten den ene eller den andre av det man har krav på å en begrenset antallet av grunnleggeren i rett linje eller hender heretter innen liten befolkninger. Tk verdier (Ewens 1972) skaffe en vei av sammenlignende effektiv befolkning størrelsene. Verdier basert på det STRs for det Hazaras, Analysen, Kalash, og Burushos var 8.9, 77.5, 25.8, og 74.2, respectively, sammenlignet med en mening av 181.8 for det annet befolkninger med eksemplar størrelsene >20. Effektiv befolkning størrelse for Y kromosomet kanne avviker høyeste fra stilling befolkning størrelse, bortsett fra det er en bemerkelsesverdig det det Analysen og Kalash gjøre har den minste stilling størrelsene, ettall- den hundrede eller ettall- tusende av det meste av dem av det annet befolkninger (bord 1), så disse liten stilling størrelsene kanskje ha blitt holdt i lang tid. Inne resymé, mange vise egenskaper av det gave Pakistansk Y haplotype distribusjoner kan regningen for av en delt anen gene vannpytt, med begrenset gene flyte imellom befolkninger og haug inne det mindre seg.


Innblikk i Befolkning Origins
Det foreslo befolkning origins ( bord 1) kanne nå være betraktet som i lyset av av disse Y resultater. Beskjed er skaffet av haplogroup hyppighet, hvilke kan pleide tilvirke tilsetningen anslår, og disse er lett å fortolke hvis befolkninger er stor og isolere og kilden befolkninger ha annerledes hyppighet. Når disse vilkårene er ikke møtte, nærværelsen av adskilt Y i rett linje kanne fremdeles være opplysende Det origins av det Analysen er frisk- dokumentert (Nanavutty 1997) og således skaffe en nyttig test rettssak. De er føle etter av det Iraner prophet Zoroaster, hvem migrenen å India etter det bryte sammen av det Sassanian imperium inne det 7th århundre a.d. De avgjort inne 900 a.d. inne Gujarat, India, der hvor de var alarmert det “Parsi” ( betydning “from Iran). Senere de flyttet å Mumling inne India og Karachi inne Pakistan, hvorfra det gave befolkning var eksemplar ( diagram. 7). Deres hyppighet for haplogroups 3 (8%) og 9 (39%) gjøre virkelig ligne dem inne Iran flere enn dem av deres aktuelle nabo inne Pakistan. De viser det lavest hyppigheten for haplogroup 3 inne Pakistan (et stykke unna fra det Hazaras; diagram 1C). Det mening for åtte Iraner befolkninger var 14% (n401=) (Quintana-Murci et al. 2001), mens derimot det for Pakistan, eksklusive det Analysen, var 36%. tilsvarende beregner for haplogroup 9 var 39% inne det Analysen, 40% inne Iran, og 15% inne Pakistan eksklusive det Analysen. Disse beregner føre til en tilsetningen anslå verdi av 100% fra Iran ( bord 3). Gitt det liten effektiv befolkning kassens størrelse Analysen, tettheten av deres kamp å det Iraner data kanskje være tilfeldig, og nærværelsen av haplogroup 28 kromosomet for 18% (4% inne Iran; Frisk et al. 2001) foreslår noe gene flyte fra det omringer befolkninger Det TMRCA for det Analysen- spesifikk klyngen inne det haplogroup 28 nettverk var 1,800 (600–4,500) år (bord 8), gjennomført med det migration av en liten antallet av i rett linje fra Iran Total, disse resultater demonstrere med nød og neppe kamp imellom det historisk arkivene og det Y data, og således foreslå det det Y data ville være nyttig når færre historisk beskjed er anvendelig.
Befolkningen det er genetisk høyst adskilt, det Hazaras, kravene nedgang fra Genghis Khan’s hæren; deres navnet er avledet fra det Persisk ord “hazar,” betydning “thousand,” fordi troops var igjen bak inne løsrivelsen av tusen. Mot utgangen av det 19th århundre, noe Hazaras flyttet fra Afghanistan å det Khurram Dal inne Pakistan, kilden av det eksemplar etterforske her over Således, deres muntlig historien identifiserer en origin inne Mongolia og befolkning flaskehalsen ~800 og ~100 år for. Av det to dominerende Y haplogroups gave inne denne befolkning, haplogroup 1 er alminnelig utbredt inne Pakistan, mange av Asia, Europa, og det USA, hvorfor skaffer liten opplysninger på tilblivelsesstedet. Haplogroup 10, inne kontrasten, er sjelden inne høyst Pakistansk befolkninger (1.4%, når det Hazaras er utelukket) bortsett fra er vanlig inne Øst Asia, inkluderer Mongolia, der hvor den lager opp over halvparten av befolkningen (upublisert resultater). Tilsetningen anslår ( bord 3) er gjennomført med en innholdsrik bidrag fra Mongolia. BATWING analyse av det Hazara- spesifikk haplotype klyngene inne haplogroups 1 og 10 foreslo TMRCAs av 400 (120–1,200) og 100 (6–600) år ( bord 8), respectively. Således, det genetisk bevis er gjennomført med det muntlig tradisjon og, med henblikk på dens selvstendig art, skaffer kraftig oppbacking for den ( diagram. 7).

Noe annet foreslo origins få flere begrenset oppbacking fra det Y data. Det Neger- Makrani, med en postulat origin inne Afrika, befordre det aller høyest hyppigheten av haplogroup 8 kromosomet grunnlegge dersom noe Pakistansk befolkning, idet bemerket et annet sted (Qamar et al. 1999). Denne haplogroup er hovedsakelig innesperre å sub-Saharan Afrika, der hvor den konstituere om halvparten av befolkningen (hammer et al. 2001) og kanne således gjelde som en farm land av Afrikaner Y kromosomet. Ikke desto mindre, den lager opp bare 9% av det Neger- Makrani eksemplar, og haplogroup 28 (jevnsides med annet typisk Pakistansk haplogroups) er gave i denne befolkning. Hvis det Y kromosomet var i starten Afrikaner ( diagram. 7), høyst ha heretter blitt erstattet: det total anslå verdi av det Afrikaner bidrag er ~12% ( bord 3).

Det Baltisk er tanke å ha oppstå inne Tibet, der hvor det dominerende haplogroups er 4 og 26. Ingen av to var gave inne prøven fra denne studere, skaffer nei oppbacking for en Tibetan origin av det Y kromosomet i rett linje og en tilsetningen anslå verdi av null ( bord 3). Imidlertid, denne resultere må være forklarte med advarsel, med hensyn til det liten eksemplar størrelse. Tre befolkninger ha mulig origins fra det armies av Alexandria det Stor: det Burusho, det Kalash, og det Sti. Moderne Gresk viser en måte høy hyppigheten av haplogroup 21 (28%; Rosser et al. 2000), bortsett fra denne haplogroup var ikke sett inne enten den ene eller den andre av det Burusho eller det Kalash eksemplar og var grunnlegge inne bare 2% av det Sti, mens derimot det innenbys haplogroup 28 var gave for 17%, 25%, og 13%, respectively. Gresk- tilsetningen anslår av 0% var oppnådd for det Burusho og det Sti, bortsett fra beregner av 20–40%% var iakttatt for det Kalash ( bord 3). Inne utsikt av fraværet av haplogroup 21, vi henføre denne resultere enten den ene eller den andre av å haug inne hyppighetene av det annet haplogroups, spesielt haplogroups 2 og 1, eller å tarveligheten resolution av i rett linje innen disse haplogroups, resulterer inne adskilt i rett linje tilværelse hemmelig inn i likt paraphyletic haplogroups. Total, nei oppbacking for en Gresk origin av deres Y kromosomet ble stiftet, bortsett fra denne slutningen does forlange antagelsen det moderne Gresk er distinguished av Alexander’s armies. To befolkninger, det Kashmiris og det Sti, likeledes kvad tilgodehavende å en mulig Jødisk origin. Jødisk befolkninger vanligvis har en moderat hyppigheten av haplogroup 21 (e.g., 20%) og en høy hyppigheten av haplogroup 9 (e.g., 36%; (hammer et al. 2000). Hyppighetene av begge to av disse haplogroups er lav inne det Kashmiris og Sti, og haplogroup 28 er gave for 13% inne det Sti, så nei oppbacking for en Jødisk origin er funnet, og tilsetningen anslå verdi var 0% ( bord 3), til tross for, atter, denne slutningen er begrenset begge to av det liten eksemplar størrelse anvendelig fra Kashmir og av antagelsen det det moderne eksemplar er distinguished av gamle befolkninger.

Det foreslo origin av det Baluch er inne Syria. Syrians, like Iraner, er særpreget av en lavfrekvens av haplogroup 3 og en høy hyppigheten av haplogroup 9 (9% og 57%, respectively; Hammer et al. 2000), mens derimot det tilsvarende hyppighet inne det Baluch er 29% og 12%. Denne differansen og det høy hyppigheten av haplogroup 28 inne det Baluch (29%) lage en dominerende Syrian origin for deres Y kromosomet usannsynlig, og tilsetningen anslå verdi var 0% (bord 3), til tross for det 8% hyppigheten for haplogroup 21, det aller høyest kjennemerke inne Pakistan hittil, does gi uttrykk for noe villvestfilm bidrag å deres Y i rett linje. Brahuis har en mulig origin inne Vest Asia (Hughes- Kulen 1991) og den har blitt foreslo det en spre av haplogroup 9 Y kromosomet var forbundet med det ekspansjon av Dravidian- snakker gårdbruker (Quintana-Murci et al. 2001). Brahuis ha det aller høyest hyppigheten av haplogroup 9 kromosomet inne Pakistan (28%) etter det Analysen, skaffer noe oppbacking for denne hypotese, bortsett fra deres høyere hyppigheten av haplogroup 3 (39%) er ikke typisk av det Fruktbar Halvmånen (Quintana-Murci et al. 2001) og foreslår en flere innviklet origin, muligens med tilsetningen fra siden migrations, som dem av Indo- Iraner høyttaler fra det gikk av Sentral Asia og andre fra fremme øst Denne mulighet er understøttet av oppdagelsen av lav hyppighet av haplogroups 10, 12, og 13 inne det Brahuis, alle sjelden inne Pakistan og typisk av Øst Asia, Øst og nordlig Asia, og Southeast Asia, respectively.

Det dårlig å finner en Y koble sammen med en foreslo befolkning av origin avkrefter ikke en historisk forening, bortsett fra den does demonstrere det det Y kromosomet avledet fra slik historisk begivenheter ha blitt bortkommet eller erstattet. Analyserer av mitochondrial DNA og annet loci ville hjelpe å forklare befolkningen historisk og ville være spesielt interessant inne befolkninger like det Neger- Makrani og det Baltisk, i hvilket det er en kontrasten imellom det phenotype og det typisk Pakistansk Y haplotypes.

Acknowledgments


Denne arbeide var understøttet av en Wellcome Tillit Samarbeidet Forskning Initiativ Støtte å S.Q.M. T.Z. var likeledes understøttet av Det Wellcome Tillit, og C.T.-S. av det Kreften Forskning Annonsekampanje. Vi ekspres våre takknemlighet å originalen DNA donorer hvem fremstilt denne studere mulig. Avdelingen av Sunnhet av regjeringen av Baluchistan og det Baluch Student Federation, Quetta, Pakistan, hjalp inne samlingen av det Brahui og Baluch eksemplar. Sti eksemplar var avhentet med det assistanse av det Avdeling av Læren om barnesykdommer, Dame Lesing Stolpe Ta avsluttende eksamen Legeundersøkelse Gjestfrihet, Peshawar, Pakistan Vi er likeledes takknemlig å Dr. jeg Kazmi og det Aga Khan Opprettelsen Rural Sunnhet Oppbacking Program for deres assistanse inne det innsamling av kollekt av Burusho eksemplar. Dr. F. Sethna forsynt kostbar assistanse inne innsamlingen av det Analysen eksemplar. Vi takk Luis Quintana-Murci for hans kommentarer på manuskriptet.


Elektronisk- Data bank Beskjed

URLs for data i denne gjenstand er som følger:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Nettverk 2.0, http:/www.fluxus-engineering.com/.
/ ViSta, http:/forrest.psych.unc.edu/.

Henvisning

Ahmad AKN (1952) Jesus inne himmelen på jord. Det Sivil og Militær Se Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin En, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler-Smith C (2000) Legitimasjonen og characterisation av helt nytt human Y- kromosomet microsatellites fra orden data bank beskjed. Atomer Syren Res 28e8: [ ledig I sin helhet tekst inne PMC].
Ryggcrawl PC (1992) Baltisk. inne Ryggcrawl PC, Radloff CF (eds) Sociolinguistic oversikt av nordlig Pakistan. Vol 2, Språkene av nordlig arealer Nasjonal Off av Pakistan Studier, Islamabad, pp 3–27.
Revenue label HJ, Forster Pencen, Rohl EN (1999) Media- blir med nettverk for inferring intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ ledig I sin helhet Tekst].
Revenue label HJ, Forster Pencen, Sykes BC, Richards MEGABYTE (1995) Mitochondrial portretter av human befolkninger benytter media nettverk. Arvelighetsforskning 141743–753: [PubMed] [ ledig I sin helhet Tekst].
Klokken HW (1979) Rasene av Afghanistan. Sang-e-Meel Utgivelsene, Lahore, Pakistan.
Klokken HW (1998) En henvendelsen inn i ethnography av Afghanistan. Fortropp Bøker, Lahore, Pakistan.
Bergen AW, Knep C-Y, Tsai J, Jefferson K, Dey C, Smith KD, Park S-C, Tsai S-J, Gullet D (1999) En Asian–Native Amerikaneren faderlig i rett linje kjennemerke av RPS4Y resequencing og av microsatellite haplotyping. Ann Nynne Genetisk 6363–80: [PubMed] [i sin helhet Tekst].
Bianchi Nei, Bailliet G, Modig CM, Blodbad RF, Rothhammer F, Martinez-Marignac VL, Straffe SD (1997) Origin av Amerindian Y- kromosomet idet slutte seg til av analysen av seks polymorphic skilter. Er J Fysisk Anthropol 10279–89: [PubMed] [ i sin helhet Tekst].
Biddulph J (1977) Tribes av det Bakben Koosh. Innsette Utgivelsene, Karachi, Pakistan.
Burton RF (1851) Sindh og rasene det bebo det dal av det Innsette. WH Allen og Tilpasse Ltd, London.
Caroe O (1958) Det Sti. Oxford Universitet Presse, Karachi, Pakistan.
Kvinnebedårer M, Leroy Pencen, Boucekkine C, Weissenbach J, Biskopen C, Fyren M, Purrello M, Fiori G, Siniscalco M (1985) EN human Y- sammenkoblet DNA polymorphism og dens muligheter for anslår genetisk og utviklingen avstand Vitenskap 2301403–1406: [PubMed].
Cavalli-Sforza LL, Menozzi Pencen, Piazza EN (1994) Historien og geografi av human tilblivelse. Prinsen Universitet Presse, Prinsen.
Dales GF (1991) Det phenomenon av det Innsette kulturen. inne Jansen M, Mulloy M, Urban G (eds) Glemt byer på Innsette: tidlig kulturen inne Pakistan fra det 8th å det 2nd millennia BC. Verlag Philipp von Zabern, Hovedavdeling, Tyskland, pp 129–144.
Dekk KD (1992) Sociolinguistic oversikt av Nordlig Pakistan. Vol 5, Språkene av Pus. Nasjonal Off av Pakistan Studier, Islamabad.
Ewens WJ (1972) Smaker teori av kresent nøytralitet alleles. Teoretisk Populær Biol 387–112: [PubMed].
Uhyggelig BF (1992) Ethnologue: språkene av verden. Sommer Off av Språklig, Dallas.
Hammer MF (1994) EN nylig innsettingen av en Alu component på Y kromosomet er en nyttig farm land for human befolkning studier. Mol Biol Evol 11749–761: [PubMed] [ledig I sin helhet Tekst].
Hammer MF, Horai S (1995) Y kromosomet DNA avveksling og det folk av Japan. Er J Nynne Genetisk 56951–962: [PubMed].
Hammer MF, Karachi TM, Rødlig AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarkisk oppbygget mønstre av fleste human Y- kromosomet variasjonen Mol Biol Evol 181189–1203: [PubMed] [ ledig I sin helhet Tekst].
Hammer MF, Rødlig AJ, Tre ET, Skottelue Herr, Jarjanazi H, Karachi T, Santachiara-Benerecetti S, Oppenheim En, Arbeidsløs MA, Jenkins T, Ostrer H, Skottelue-Tamir B (2000) Jødisk og Midt Fra øst ingen- Jødisk befolkninger aksje en vanlig vannpytt av Y- kromosomet biallelic haplotypes. Utbytte Natl Akademiker Sci USA 976769–6774: [ ledig I sin helhet tekst inne PMC].
Helgason En, Sigurdardottir S, Nicholson J, Sykes B, Ås EW, Bradford DG, Bosnes V, Gulcher JR, Valgkrets R, Stefansson K (2000) Anslår Nordisk og Gaelic anen inne det mannlig betale en gjeld av Island. Er J Nynne Genetisk 67697–717: [PubMed] [ ledig I sin helhet Tekst].
Hughes- Kulen R (1991) Keiserlig gazetteer av India: område serien, Baluchistan. Sang-e-Meel, Lahore, Pakistan.
Hussain J (1997) EN historien av folkets av Pakistan i retning uavhengighet. Oxford Universitet Presse, Karachi, Pakistan.
Ibbetson D (1883) Panjab kast Sang-e-Meel, Lahore, Pakistan.
Jarrige JF (1991) Mehrgarh: dens sted inne utviklingen av gamle kulturen inne Pakistan. inne Jansen M, Mulloy M, Urban G (eds) Glemt byer på Innsette: tidlig kulturen inne Pakistan fra det 8th å det 2nd millennia BC. Verlag Philipp von Zabern, Hovedavdeling, Tyskland, pp 34–50.
Arbeidsløs MA, Tyler-Smith C (2000) Ny bruker for ny haplotypes: det human Y kromosomet, sykdommen og utvalg Retninger Genetisk 16356–362: [PubMed] [ i sin helhet Tekst].
Karachi TM, Zegura SL, Posukh O, Osipova L, Bergen En, Lang J, Gullet D, Klitz W, Harihara S, de Knijff Pencen, Wiebe V, Griffiths RC, Templeton AR, Hammer MF (1999) Anen Asiaten kilder() av ny verden Y- kromosomet grunnleggeren haplotypes. Er J Nynne Genetisk 64817–831: [PubMed] [ledig I sin helhet Tekst].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff Pencen, Stoneking M, Sajantila EN (2000) Kjennetegnene og hyppigheten av germline mutations for microsatellite loci fra det human Y kromosomet, idet avsløre av direkte observasjon inne far/ sønnen parene. Er J Nynne Genetisk 661580–1588: [PubMed] [ ledig I sin helhet Tekst].
Kwok C, Tyler-Smith C, Mendoza BB, Hughes Jeg, Berkovitz GD, Goodfellow PN, Hark JR (1996) Mutation analyse av det 2 kb 5' å SRY inne XY kvinner og XY gjennomskjære emner J Med Genetisk 33465–468: [PubMed].
Lang JC (1991) Det genetisk struktur av tilsetningen befolkninger. Arvelighetsforskning 127417–428: [PubMed] [ledig I sin helhet Tekst].
Mathias N, Bayes M, Tyler-Smith C (1994) Høylig opplysende blanding haplotypes for det human Y kromosomet. Nynne Mol Genetisk 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansoor En, Ismail M, Hammer MF, Lusket Pappa, Cavalli-Sforza LL (1999) Det origins av Pakistansk befolkninger bevis fra Y kromosomet skilter. inne Papiha SS, Deka R, Chakraborty R (eds) Genova variasjonen: søknadene inne human befolkning arvelighetsforskning Kluwer Akademiker/Plenum Forleggere, New York, pp 83–90.
Mohyuddin En, Ayub Q, Qamar R, Zerjal T, Helgason En, Mehdi SQ, Tyler-Smith C (2001) Y- kromosomet STR haplotypes inne Pakistansk befolkninger Forensic Sci Int 118141–146: [PubMed] [i sin helhet Tekst].
Nanavutty PENCEN (1997) Det Analysen. Nasjonal Bestille Tillit, Ny Delhi, India.
Pandya En, Kingston TE, Santos FR, Taylor PG, Thangaraj K, Synge L, Arbeidsløs MA, Tyler-Smith C (1998) EN polymorphic human Y- kromosomet G å EN overgang grunnlegge inne India. Ind J Nynne Genetisk 452–61:.
Qamar R, Ayub Q, Khaliq S, Mansoor En, Karachi T, Mehdi SQ, Hammer MF (1999) Afrikaner og Levantine origins av Pakistansk YAP+ Y kromosomet. Nynne Biol 71745–755: [PubMed].
Quddus SA (1990) Det tribal Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, Hammer MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin En, Radhakrishna U, Arbeidsløs MA, Tyler-Smith C, McElreavey K (2001) Y- kromosomet i rett linje spor spredningen av folk og språkene inne southwestern Asia. Er J Nynne Genetisk 68537–542: [PubMed] [ledig I sin helhet Tekst].
Roberts DF, Hiorns R (1965) Metoder av analyse av det genetisk komposisjonen av en blanding befolkning. Nynne Biol 3738–43:.
Robertson GS (1896) Det Kafirs av det Bakben-Kush. Oxford Universitet Presse, Karachi, Pakistan.
Rosser ZH, Zerjal T, Kaste Meg, Adojaan M, Alavantic D, Amoralsk En, Amos W, et al (2000) Y- kromosomet variasjonen inne Europa er klenge og ha innflytelse på opprinnelig av geografi, snarere enn av omgangsspråk. Er J Nynne Genetisk 671526–1543: [PubMed] [ ledig I sin helhet Tekst].
Santos FR, Carvalho- Sølv DR, Straffe SDJ (1999a) PCR- basert DNA profilering av human Y kromosomet inne Epplen JT, Lubjuhn T (eds) Metoder og verktøy inne biosciences og medisin. Birkhauser Verlag, Basel, Sveits, pp 133–152.
Santos FR, Pandya En, Kayser M, Mitchell RJ, Liu En, Synge L, Ødelagt-Bisol G, Novelletto En, Qamar R, Mehdi SQ, Adhikari R, Knijff Pencen, Tyler-Smith C (2000) EN polymorphic L1 retroposon innsettingen inne det centromere av det human Y kromosomet. Nynne Mol Genetisk 9421–430: [PubMed] [ ledig I sin helhet Tekst].
Santos FR, Pandya En, Tyler-Smith C, Straffe SD, Schanfield M, Leonard WR, Osipova L, Crawford MH, Mitchell RJ (1999b) Det sentral Siberian origin for innfødt Amerikaneren Y kromosomet. Er J Nynne Genetisk 64619–628: [PubMed] [ ledig I sin helhet Tekst].
Schneider S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: en programvare for befolkning genetisk data analyse Arvelighetsforskning og Biometry Laboratorium, Universitet av Genève, Sveits.
Seielstad MT, Hebert JM, Lin AA, Lusket Pappa, Ibrahim M, Vollrath D, Cavalli-Sforza LL (1994) Bygging av human Y- kromosomet haplotypes benytter en ny polymorphic EN å G overgang. Nynne Mol Genetisk 32159–1261: [PubMed].
Skinne T, Tomita K, Dags dato T, Kotliarova SE, Lee J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genetisk variasjoner på Y kromosomet inne det Japansk befolkning og innblanding for moderne human Y kromosomet i rett linje. J Nynne Genetisk 44240–245: [PubMed].
Thomas MG, Bradford N, Kaste HM (1999) Høy produksjon analyse av 10 microsatellite og 11 diallelic polymorphisms på human Y- kromosomet. Nynne Genetisk 105577–581: [PubMed] [i sin helhet Tekst].
Tyler-Smith C (1999) Y- kromosomet DNA skilter. inne Papiha SS, Deka R, Chakraborty R (eds) Genova variasjonen: søknadene inne human befolkning arvelighetsforskning Kluwer Akademiker/Plenum Forleggere, New York, pp 65–73.
Lusket Pappa, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, Davis RW, Cavalli-Sforza LL, Oefner PJ (1997) Oppdagelsen av tallrik Y kromosomet biallelic polymorphisms av denaturing høy- gjennomførelse flytende chromatography. Genova Res 7996–1005: [PubMed] [ledig I sin helhet Tekst].
Frisk RS, Yuldasheva N, Ruzibakiev R, Lusket Pappa, Evseeva Jeg, Blåfarge-Smith J, Jin L, et al (2001) Det Eurasian hjerteløs: en kontinental perspektiv opp på Y- kromosomet variasjonen Utbytte Natl Akademiker Sci USA 9810244–10249: [ ledig I sin helhet tekst inne PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Orden avveksling av det human Y kromosomet Art 378379–380: [PubMed] [ i sin helhet Tekst].
Wilson IJ, Skallet DJ (1998) Genealogical slutningen fra microsatellite data. Arvelighetsforskning 150499–510: [PubMed] [ ledig I sin helhet Tekst].
Wolpert S (2000) EN ny historien av India. Oxford Universitet Presse, New York.
Ung FW, Banner CM (1996) EN synlig statistikken system. inne Stine RA, Rev J (eds) Statistisk arbeider med computer omgivelser for sosiale forskning. Sage Utgivelsene, New York, pp 207–236.
Zerjal T, Beckman L, Beckman G, Mikelsaar AV, Krumina En, Kucinskas V, Kaste Meg, Tyler-Smith C (2001) Geografisk, språklig, og kulturell påvirker opp på genetisk variasjonen: Y- kromosomet distribusjon inne Nordlig Europeiske befolkninger. Mol Biol Evol 181077–1087: [PubMed] [ ledig I sin helhet Tekst].
Zerjal T, Dashnyam B, Pandya En, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Fretwell N, Arbeidsløs MA, Harihara S, Skimrende lys K, Semjidmaa D, Sajantila En, Salong Pencen, Crawford MH, Ginter EK, Evgrafov OV, Tyler-Smith C (1997) Genetisk forbindelser av Asiatene og Nordlig Europeere, avsløre av Y- kromosomet DNA analyse. Er J Nynne Genetisk 601174–1183: [PubMed].

 

Side vare oppdatert: Onsdag, Friday, 25 November 2005 22:47:57 -0500