Genetics

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 


chromosoom DNA Wisseling ter Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Christus Tyler- Smid enzovoorts. Qasim Mehdi1

1Biomedical en Genetic Engineering Verdeling, Passiva. te Q. Khan Speurwerk Laboratorium, Islamabad; 2Cancer Speurwerk Werkseizoen, Chromosoom Moleculair Biologie Groepering, Tak van dienst van Biochemie, en 3Institute van Biologisch Antropologie, Universiteit van Oxford, Oxford, Verenigd Koninkrijk; en decoderen Genetica, Reykjavik.


uittreksel

Achttien tweetallig polymorphisms en 16 multiallelic, tekort- tandem- repeteren (STR) loci vanuit naar de nonrecombining taks van naar de menselijk YPSILON chromosoom waren getypt ter 718 mannelijk vak toebehoren voor 12 etnisch groepen van Pakistan. Dit hier identificatiecode 11 waardevast haplogroups en 503 vereniging tweetallig uitgesproken/STR haplotypes. Haplogroup veelvuldigheid waren in het algemeen soortgelijk voor zulks ter omwonend geografisch zone, en naar de Pakistan universum spreken te taal isoleren ( naar de Burushos), te Dravidian taal ( naar de Brahma), of te Sino- Tibetaans taal ( naar de Oostzee) weghebben van naar de Indo-European–speaking meerderjarigheid Niettemin, zwaartelijn- toetreding netwerk van haplotypes uitbrengen geruim onderbouw van YPSILON wisseling te Pakistan, van velen universum vertoning uitgesproken wis van haplotypes. Dit hier voorbeeld annuleerteken zitten verantwoorde voor tegen te komma pot van YPSILON komaf, van substantiële isolering tussen universum en strekking ter naar de minder zichzelf Weinig vergrotende trap genetic of historisch materieel zitten voorhanden voor meest universum, slechts naar de resultaten annuleerteken zitten presentatrice van oraal traditie zowat opkomst Naar de YPSILON materieel steun naar de welput- opgericht opkomst van naar de Parsis ter Perzië, naar de voorstellen neerhaling van naar de Toevalligheid vanuit Genghis Khan’s legermacht, en naar de opkomst van naar de Zwart Makrani ter Afrika, slechts verrichten niet steun traditie van Tibetaans, Syrisch, Grieks, of Joods opkomst voor andere universum.


voorstelling

Naar de primeurs verklaring van Paleolithicum menselijk tegenwoordigheid ter naar de Zuidelijk Azië bestaan van van klei werktuig stichten verstrooid zowat naar de Soan Vloed Vallei ter noords Pakistan ( huzaar 1997). Niettegenstaande naar de ontstentenis van verstening verklaring, dit hier gereedschap verschijnen voor omschrijven naar de tegenwoordigheid van hominids ter naar de Zuidelijk Azië zoals vroegtijdig zoals 200,000–400,000 jaren voor (Wolpert 2000) en zus zitten waarschijnlijk voor zijn geweest vennoot van verouderd Homo soort. Pakistan leugentaal voort naar de postulaat zuidelijk zeekust traject volger tegen anatomisch nieuwerwets Homo Sapiens uit Afrika, en zodoende mei zijn geweest bewonen tegen nieuwerwets mensen zoals vroegtijdig zoals 60,000–70,000 jaren voor. Ziedaar zit verklaring van spelonk wonen ter Pakistan noordwesten rijksgrens, slechts verstening verklaring vanuit naar de Paleolithicum heeft geweest fragmentarisch ( huzaar 1997). Verklaring heeft geweest zonder dekking ter Mehrghar, ter zuidwester Pakistan, omschrijven Neolithicum voldoening vanuit zoals speculant à la hausse voor zoals 7,000 b.c. (Jarrige 1991), wie waren volger tegen naar de Indus Vallei civilisatie ( waaronder naar de steden van Harappa en Mohenjodaro) welk zwier ter naar de 3d en 2d duizendjarig b.c. (dal 1991). Zowat 1500 b.c., naar de Indo-European–speaking zwervend pastoraal volksstam vanuit vervolgens north—often genaamd naar de Aryans—crossed naar de Karakorum Bergwand te naar de Zuidelijk Azië. Volgend historisch gebeurtenis opnemen naar de invasie van Alexander naar de Tof (327–325 b.c.) en naar de Arabier en Moslim veroveren vanuit 711 a.d. voort (Wolpert 2000).

Naar de tegenwoordig universum van Pakistan bestaan van ruim 160 miljoen persoonlijk ( volgens voor 2005 WIE cijfers) wie toebehoren voor tenminste 18 etnisch groepen en spreken ruim 60 talen ( grimmig 1992). Allermeest dit hier talen zitten Indo- Europees, slechts zij tevens opnemen een isoleren, Burushaski; te Dravidian taal, Brahma; alsmede Sino- Tibetaans taal, Oostzee. Punjabi- spreken persoonlijk vorm naar de meerderjarigheid universum van Pakistan, slechts zij weergeven te samengesteld bijmengsel van etnisch groepen (Ibbetson 1883) en zitten niet verdelen hiernaartoe; 12 etnisch groepen zitten met inbegrip van ter onderhavige schrijven schouw. wetenswaardigheid voorhanden zowat zij zit samenvattend herhalen ter tarief 1, mitsgaders onderstelling zowat hun opkomst (Mehdi et al. 1999). Wel sommige van dit hier onderstelling zitten welput- voorstander (e.g., naar de opkomst van naar de Parsis ter Perzië), meest zitten op basis van oraal traditie en zijn niet geweest toets tegenover andere welput van verklaring.

Schraal genetic materieel zitten voorhanden voor dit hier Pakistan etnisch groepen Vroegtijdig gezocht van naar de ABO bloed groepen en klassikaal proteïne uitgesproken did niet opnemen helemaal groepen en veelal kleine advertenties zij volgens hun werkhuis van woonplaats. TE universum boom op basis van 54 klassikaal enzyme uitgesproken werkhuis naar de Toevalligheid en Pad ter naar de Westen Aziatisch wis inhouden naar de noords Caucasoids (ruiterstoet-Sforza et al. 1994). Ter andere universum boom, op basis van 47 klassikaal proteïne polymorphisms, naar de Pakistan steekproef vorm te min subcluster te naar de Indo-europees spreker vanuit India ( ruiterstoet-Sforza et al. 1994).

Naar de YPSILON chromosoom zorgen voor te unieke welput van genetic verklaring (Tyler- Smid 1999; Jobling en Tyler- Smid 2000). Op draagt naar de grootscheeps nonrecombining segment ter naar de Genua en bevat talrijk waardevast tweetallig uitgesproken, waaronder vuig vervanging (zien, e.g., Stiekem et al. 1997) en retroposon plaatsing ( hamer 1994; Santos et al. 2000), wie annuleerteken zitten tweedehands ter vereniging van meerder- stroomversnelling zich ontwikkelen uitgesproken, zulke zoals microsatellites (zien, e.g., Ayub et al. 2000). Zodoende, zelfs uitvoerig YPSILON phylogenies annuleerteken zitten inrichten welk verstrekken mannelijk- specifiek schijn van genetic voorgeschiedenis voor zitten vorsen. Dit hier zitten met klem beïnvloed tegen naar de min werkelijk universum spanwijdte van naar de YPSILON chromosoom, vooraanstaand voor stroomversnelling genetic strekking, en tegen naar de uitoefening van patrilocality ter velen vereniging, vooraanstaand voor weetje waterpas van geografisch differentiëring van YPSILON haplotypes. Niettegenstaande naar de werkzaamheden van Qamar et al. (1999) voort naar de zinsontleding van Keffen+ chromosoom ( omvatten ~2.6% van naar de volslagen) en verdelen van STR wisseling (Ayub et al. 2000; Mohyuddin et al. 2001), weinig werkzaamheden heeft geweest verricht voort Pakistan YPSILON chromosoom. Toch, wij hebben wel verricht een veelomvattend zinsontleding van Pakistan YPSILON komaf, voor voornemen welke zwak zij annuleerteken luifel voort naar de opkomst en genetic kunstgeschiedenis naar de subgroups welk merk daarboven Pakistan universum.


vaste stof en Werkwijze

steekproef
Naar de YPSILON chromosoom van 718 unrelated mannelijk vak, toebehoren voor 12 etnisch groepen van Pakistan, waren verdelen (tarief 1 en 2; vijg. 1). Waarschuwen toestemming watertje zich toeëigenen vanuit helemaal participant ter zulks werkkamer. Een Epstein Schuur virus–transformed lymphoblastoid kerker wachtrij watertje opgericht vanuit iedere persoonlijk, en DNA watertje uittreksel vanuit dit hier kerker strafregels voor zinsontleding.


Tweetallig Polymorphism Typen
Wij getypt 15 SNPs, een Rekenorgaan plaatsing ( hamer 1994; Hamer en Horai 1995), te Wachtrij plaatsing (Santos et al. 2000), en naar de 12f2 doorhaling (Casanova et al. 1985). Naar de vuig vervanging waren 92R7 C?T ( wiskunde et al. 1994); M9 C?G ( stiekem et al. 1997); SRY-2627 C?T (tweejaarlijks et al. 1997); SRY-1532 teG?TE (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) Te?G (Seielstad et al. 1994); SRY-8299 G?Te (Santos et al. 1999a); Ad rem G?TE ( Pandora et al. 1998); SRY +465 C?T ( scheen et al. 1999); LLY22g C?TE en Tat T?C overgang (Zerjal et al. 1997). Benevens, naar de M17 uitgesproken ( stiekem et al. 1997) watertje getypt, tegen toepassing van naar de puik GTGGTTGCTGGTTGTTACGT en AGCTGACCACAAACTGATGTAGA volger tegen AflIII verwerking van naar de PCR voortbrengsel; naar de voorouderlijk aangeven watertje niet verwerken Naar de M20 uitgesproken (stiekem et al. 1997) watertje genotyped, tegen toepassing van naar de puik CACACAACAAGGCACCATC en GATTGGGTGTCTTCAGTGCT volger tegen SspI verwerking; bovenstaand?G mutatie verwoesten naar de terrein ter toestand 118 ter naar de 413-bp voortbrengsel. M11 (stiekem et al. 1997) watertje getypt, using naar de puik TTCATCACAAGGAGCATAAACAA en CCCTCCCTCTCTCCTTGTATTCTACC volger tegen verwerking van MspI. Naar de 215-bp voortbrengsel watertje verwerken voor 193-bp en 22-bp stuk ter naar de geïnduceerd aangeven Naar de RPS4Y C?T mutatie (Bergum et al. 1999) watertje speurder tegen BslI restrictie verwerking van te 528-bp PCR voortbrengsel zich toeëigenen tegen toepassing van naar de puik CCACAGAGATGGTGTGGGTA en GAGTGGGAGGGACTGTGAGA. Naar de voorouderlijk C aangeven bevat tweetal terreinen, en naar de geïnduceerd T aangeven bevat men. M48 (stiekem et al. 1997), teG, watertje getypt tegen aangeven- specifiek PCR using naar de onderscheidingsvermogen puik TGACAATTAGGATTAAGAATATTATA en TGACAATTAGGATTAAGAATATTATG en naar de komma puik AAAATTCCAAGTTTCAGTGTCACATA voor voortbrengen specifiek 145-bp renteproducten Naar de troep van YPSILON tweetallig uitgesproken aangeven wagon tegen te ongetrouwd persoonlijk zal zitten verwijzen voor zoals “the Ypsilon haplogroup.”
Van naar de 718 steekproef, 717 omhakken te haplogroups verwachte voort naar de grondslag van naar de bekend phylogeny, slechts men Pad steekproef (PKH134) zakken voor versterken ter naar de SRY –1532 en M17 loci. Hij watertje aangewezen voor haplogroup 3 voort naar de grondslag van uitwijkmogelijkheid SRY –1532 puik ( item op verzoek) en zijn STR profiel.


ypsilon-STR Typen
Vijf trinucleotide- repeteren polymorphisms (DYS388, DYS392, DYS425, DYS426, en DYS436), tiental tetranucleotide- repeteren polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, en DYS439) en men pentanucleotide microsatellite (DYS438) waren getypt in totaal YPSILON chromosoom. Drietal multiplexinrichting PCR terugwerking waren verricht voor helemaal YPSILON-STRs, ter a10-µl uiterste terugwerking volume inhouden 20 ng Genua DNA, zoals signaleren ergens anders ( Thomas et al. 1999; Ayub et al. 2000). PCR renteproducten waren stormloop voort een ABI 377 volgorde. ABIGS350 TAMRA watertje tweedehands zoals naar de inwendig vaargeul vaandel. Naar de SCHEPPINGSBOEK en GENOTYPER software zending waren tweedehands voor inzamelen naar de materieel en voor verdelen stuk spanwijdte YPSILON-STR aangeven waren heet volgens naar de telefoonnummer van repeteren units zij contain.The aantal repeteren units watertje opgericht via naar de toepassing van volgorde verwijzing DNA steekproef. Aangeven lengte voor DYS389b waren zich toeëigenen tegen aftrekking van naar de DYS389II aangeven lengte vanuit DYS389I.
YPSILON-STR dubbele boeking waren stichten ter verschillend loci. DYS393 watertje kopie ter PKH165 (13 en 15) en DYS437 watertje kopie ter SDH181 (8 en 9). TE meerder samengesteld voorbeeld watertje stichten ter DYS425, waarheen tweetal voor viertal aangeven waren stichten ter 36 persoonlijk vanuit haplogroups 8, 9, 13, en 21.


materieel Zinsontleding
Werkgever- component zinsontleding watertje verricht voort haplogroup veelvuldigheid tegen toepassing van naar de Vergezicht ( zichtbaar Statistiek) systeemsoftware, voorstelling 5.0.2 (jong en Vlag 1996). Voor grafisch symbool voorstelling, eerstgenoemde en tweede werkgever component waren plotter tegen naar de Microscoop Zetel Gevolg Uitmunten Zending voort Venster 2000. Biallelic polymorphism materieel voor verschillende wereld universum tweedehands ter naar de zinsontleding waren verkregen uit Hamer et al. (2001). Bijmengsel watertje verwachte tegen toepassing van drietal verschillend maatregelen: Speculant à la hausse gewogen minst- winkelhaak (WLS) stap ( speculant à la hausse 1991); mR, te minst- winkelhaak taxatie (toga en Hiorns 1965); en m? (Helgason et al. 2000).
Zinsontleding van moleculair variantie (AMOVA) watertje verricht tegen toepassing van naar de Arlequin zending (Schneider et al. 1997). AMOVA maatregelen naar de omvang van mutatie divergentie stichten te en tussen universum, respectievelijk. Wel zeer van naar de wisseling ter naar de stroomversnelling mutatie microsatellite loci zit verwachte voor zijn geweest leverden op ter naar de verschillend Pakistan subpopulations, naar de unieke mutatie gebeurtenis ter naar de tweetallig loci zitten zeer oudere en zijn niet voorvallen ter naar de zinsverband van naar de onderverdeling van naar de Pakistan universum. Wij verzinnen naar de volgend strategie voor exploot naar de maximumbedrag van desbetreffend mutatie wetenswaardigheid vanuit naar de YPSILON- chromosoom haplotypes. STR wisseling te haplogroups watertje tweedehands voor uitrekenen universum pairwise FST waarden voor iedere persoonlijk haplogroup. Per deel van universum tweetal, te gewogen schriel FST watertje berekend, waarheen naar de waarde zich toeëigenen per deel van haplogroup watertje gewogen volgens naar de verhouding van pairwise vergelijking wikkelen welk haplogroup. Bij gebrek aan van te vies haplogroup vanuit men universum, Te, van naar de tweetal TE en B, FST watertje troep voor 1, en naar de telefoonnummer van pairwise vergelijking watertje genomen zoals naar de telefoonnummer van chromosoom verdragend welk haplogroup ter B. Waarden van FST op basis van STRs verlaten of voort STRs vermeerderd met tweetallig uitgesproken, van tweetallig uitgesproken uitgaande van te 10- vouw hogere zwaarwichtigheid, waren berekend op vergelijking. In totaal van dit hier verdelen, naar de verte voedingsbodem tweedehands gevolg van naar de telefoonnummer van stoep waarbij iedere tweetal van haplotypes verschil. Schoorsteenmantel toets voor naar de betekenis van samenhang tussen FST waarden waren wagon uiterlijk ter Arlequin, en multidimensional in kokend water doen (MDS) verwikkeling waren inrichten tegen toepassing van naar de SPSS voorstelling 7.0 software zending.

Zwaartelijn- toetreding netwerk waren inrichten tegen Netwerk 2.0b ( banderol et al. 1999). TE zwaarwichtigheid uitbreidingsplan van te vijf- vouw verspreidingsgebied watertje tweedehands ter naar de opbouw van naar de netwerk. Naar de zwaarte aangewezen waren specifiek voor iedere haplogroup en took te verslag naar de YPSILON-STR wisseling tegenover naar de haplogroup ter naar de vol Pakistan universum. Naar de volgend zwaarte waren tweedehands variantie 0-0.09, zwaarte 5; variantie 0.1-0.19, zwaarte 4; variantie 0.2-0.49, zwaarte 3; variantie 0.5-0.99, zwaarte van 2; en variantie 1.00, zwaarte 1. Niettegenstaande zulks, naar de netwerk voor haplogroup 1 recipiënt velen weetje omvang kubus en watertje voornemen tegen toepassen naar de verminderd zwaartelijn en zwaartelijn toetreding netwerk werkwijze sequentieel. verminderd zwaartelijn algoritme (banderol et al. 1995) watertje tweedehands voor voortbrengen te *.rmf vijl en naar de zwaartelijn toetreding netwerk werkwijze watertje toegepast voor zulks vijl.

BATWING (Wilson en Onopgesmut 1998), Bayesian Zinsontleding van Geboomte Van Inwendig Knooppunt Voortbrenging, watertje tweedehands voor taxatie naar de tijd voor naar de meest vers komma voorzaat (TMRCA) van te troep van chromosoom. Zulks programma uses te Teken ketting Monte Carlo wijze van handelen voor voortbrengen phylogenetic geboomte en vennoot variabele waarden verenigbaar van invoergegevens materieel ( te troep van YPSILON haplotypes) en genetic en demografisch voorbeeld Naar de genetic voorbeeld veronderstellen ongetrouwd- trede mutaties van naar de STRs en naar de demografisch voorbeeld chosen watertje exponentieel wasdom vanuit een aanvankelijk gestadig- spanwijdte universum, van of zonder onderverdeling ter verschillend loopt van naar de programma Helemaal 16 STR loci waren tweedehands; sprinkhaan- specifiek mutatie verhouding vroeger kansen op basis van naar de materieel van Kayser et al. (Kayser et al. 2000) waren inrichten voor naar de loci voorhanden zoals gamma verspreiding van eerstgenoemde gammaa(, b) waarheen te = (1 + aantal mutaties zich houden aan tegen Kayser et al.), en b = (1 + aantal meioses). Voor loci niet vorsen tegen Kayser et al., naar de verspreiding gamma (1,416) watertje tweedehands, wie heeft te schriel van 0.0024. TE voortbrenging tijd van 25 jaren watertje geveinsd. Zus naar de 95% vertrouwen tussenruimte uitgaande van voeren te verslag wisselvalligheid ter mutatie verhouding, bevolkingstoeneming en ( waarheen toepasselijk) onderverdeling, slechts niet voortbrenging tijd.

resultaten

ypsilon- Chromosoom Tweetallig Polymorphisms
Naar de 18 tweetallig uitgesproken tweedehands vereenzelvigen 20 haplogroups ter wereldwijd universum vijg 1A), slechts uitsluitend 11 waren stichten ter Pakistan, en 5 verantwoorde 92% van naar de steekproef ( vijg. 1 en tarief 2). Haplogroups 1 en 9 waren tegenwoordig in totaal Pakistan universum visiteren, haplogroup 3 watertje tegenwoordig in totaal uitzondering naar de Toevalligheid, en haplogroup 28 watertje tegenwoordig in totaal uitzondering naar de Toevalligheid en naar de Kasjmir. Zuidwester universum uiterlijk vertoon hogere veelvuldigheid van hg 9 en naar de Keffen+ haplogroups 21 en 8 dan noordoosten universum (figs. 1D–E), slechts, totaal, weinig geografisch wis van haplogroup veelvuldigheid zit vertoonbaar te naar de staat.


Werkgever- Component Zinsontleding
Wij wenst voor presentatrice naar de Pakistan YPSILON haplogroup materieel van materieel vanuit universum vanuit overige van naar de wereld. Niet toepasselijk gegevensverzameling watertje voorhanden voor naar de vol troep van 18 uitgesproken, slechts naar de materieel van Hamer et al. (2001) veroorloofd nagenoeg 5 voor zitten tweedehands, want idem of phylogenetically gelijkwaardig uitgesproken waren verslaggever. werkgever- component zinsontleding vijg 2A) uiterlijk vertoon sommige verschil vanuit naar de origineel zinsontleding van Hamer et al., naar de voornaamste men zijnde naar de pachter schifting van naar de Afrikaans universum. Zulks zit te danken aan, te wijd spanwijdte, voor naar de subset van uitgesproken tweedehands, wie doet niet opnemen velen Afrika- specifiek zichzelf. Meest Pakistan universum wis van Zuidelijk Aziatisch en Midden Oosters universum, en zitten zuinig voor Noords Afrikaans, Middelste Aziatisch en Europees universum, zus vertoning te veldheer overeenkomstigheid van geografisch zuinig universum. Naar de men uitzondering is het Toevalligheid, wie zitten vrij uitgesproken. TE soortgelijk zinsontleding van naar de Pakistan universum verlaten, using gehele naar de tweetallig uitgesproken ( vijg. 2B), vormen naar de verschil tussen naar de Toevalligheid en onlangs universum alsmede meerder klaar uiterlijk vertoon naar de distinctness van naar de Kalash en naar de Parsis. Op zit snedig welk naar de taal isolate–speaking Boeroendi en naar de Dravidian- spreken Brahma verrichten niet tentoonstellingsstand uiterlijk ter dit hier verdelen.


Bijmengsel Taxaties
Onderstelling zowat universum opkomst ( tarief 1) annuleerteken zitten overwegen zoals kwantitatief kwesties zowat bijmengsel. Bijvoorbeeld, voor toets naar de mogelijkheid welk naar de Stijl YPSILON chromosoom zijn te Syrisch opkomst, wij annuleerteken vragen welke verhouding van naar de Stijl Ys stammen af van Syrië noem maar op verhouding zitten vanuit Pakistan ( overwegen voor zitten naar de Pakistan steekproef minus naar de Stijl). Materieel voort voorstellen welput universum waren genomen vanuit naar de litteratuur en drietal maatregelen van bijmengsel waren berekend. Naar de drietal taxaties leverden op wijd verenigbaar resultaten, van min systematisch verschil typisch m? > mR > Speculant à la hausse WLS voor naar de verwachte quotisatie vanuit naar de uitwendig welput universum ( tarief 3). Dit hier resultaten zorgen voor verklaring voor een uitwendig quotisatie voor naar de Toevalligheid, Kalash, Zwart Makrani, en Parsis slechts niet voor onlangs universum.


YPSILON- Chromosoom STR Polymorphisms
YPSILON-STR polymorphisms waren gezocht te halen te meerder uitvoerig zienswijze van YPSILON wisseling, tussen naar de verschillend Pakistan etnisch groepen, welk zou zitten verminderd vooringenomen tegen naar de uitgesproken-ascertainment wijze van handelen Naar de verscheidenheid van YPSILON-STR haplotypes ( tarief 4) watertje onderste voor naar de Toevalligheid (0.893) zoals voorstellen tegen vroeger verdelen (Ayub et al. 2000).
Naar de 16 YPSILON-STRs preciseren 502 YPSILON haplotypes, naar de ruim meerderjarigheid zijnde zich houden aan ter ongetrouwd persoonlijk Naar de verder haplotypes waren gedeeld tegen 2–18 persoonlijk ( item zitten uitgaande van ter naar de online- uitsluitend suppletoir tarief). Ter helemaal ziektegeval slechts men, naar de chromosoom deelneming te haplotype toebehoren voor idem haplogroup ( vanhier, 503 vereniging haplotypes) en, ter meest ziektegeval, naar de persoonlijk deelneming te haplotype toebehoren voor idem universum (tarief 5).

Naar de GST en modaliteit spanwijdte van naar de repeteren unit, voor helemaal 16 YPSILON-STRs visiteren ter naar de Pakistan universum, zitten uitgaande van ter tarief 6. Naar de samenhang tussen uitgesproken heterozygosity en GST watertje stichten niet voor zitten zinvol (r0.329=; P=.213). Naar de modaliteit spanwijdte en variantie van naar de 16 YPSILON-STRs te haplogroups 1, 2, 3, 8, 9, 10, 21, 26, en 28 zit tevens uitgaande van ter tarief 6. Zekere haplogroups zijn te verschillend modaliteit aangeven spanwijdte, en sommige voorbeelden hiervan zitten aangewezen ter boldface cursiefletter ter tarief 6. Voor voorbeeld, DYS388 heeft 15 repeteren ter haplogroup 9, presentatrice van 12 repeteren ter allermeest onlangs haplogroups ter Pakistan. Soortgelijk, naar de modaliteit aangeven voor DYS438 zit 9 ter haplogroup 9, slechts 10 of 11 ter onlangs haplogroups. Naar de modaliteit aangeven voor DYS434 voor haplogroup 10 zit 11, wie zit snedig verschillend vanuit naar de aangeven spanwijdte van zulks sprinkhaan ter andere haplogroups. Naar de volslagen ontstentenis van variability voor DYS436 ter naar de 233 mannelijk vak toebehoren voor haplogroup 3 zit notabele. Haplogroup 10 blijkt zijn naar de minst variability tegenover meest loci uitzondering voor DYS390 ( tarief 6). Dit hier conclusie vertonen naar de zwaar structureel van YPSILON-STR variability tegen haplogroup.

Wij wilden voor uitrekenen te YPSILON- op basis van stap van genetic verte tussen universum welk zou weerspiegelen naar de differentiëring welk had voorvallen te Pakistan en welk zou niet zitten onevenredig overheersen tegen ouderwets verschil welk had vooraf opgelopen tussen haplogroups. vaandel zin voor verrichten zulks zou voor toepassing STR wisseling, en tarief 7 samenvattend herhalen universum pairwise waarden van FST voort naar de grondslag van STR wisseling verlaten ( te) of van tweetallig- uitgesproken vermeerderd met STR wisseling (B), van tweetallig- uitgesproken verschil gewogen 10 tijd hogere dan STR verschil. Dit hier moedermoord zitten zeerst correleren (r0.95=; P.001<), zoals macht zitten verwachte vanuit naar de structureel van STR wisseling tegen haplogroup. Toch, dit hier maatregelen zitten zinvol beïnvloed tegen ouderwets verschil, en wij hebben toch ontwikkeld te gewijzigde stap. Wij beredeneerd zoveel van naar de STR wisseling te haplogroups zou zijn ontstane recent en zou kunnen aangewend voor zulks honk Wij toch berekend universum pairwise waarden van FST, voort naar de grondslag van STR wisseling te haplogroups, en tweedehands te gewogen schade van dit hier voor voedingsmiddelen te ongetrouwd FST verte voedingsbodem ( tarief 7C; vijg. 3). Dit hier verte zitten tevens zeerst correleren van verte op basis van STRs verlaten (r0.76=; P.001<) of voort STRs vermeerderd met tweetallig uitgesproken (r0.70=; P.001<), slechts te meerder verhouding van naar de wisseling zit gezien tussen universum (22%, presentatrice van 6% en 7%, respectievelijk). TE vergelijking van postuur 3 van postuur 2B ( wie watertje op basis van tweetallig uitgesproken veelvuldigheid verlaten) uitbrengen te snedig totaal overeenstemming, van naar de Toevalligheid zijnde uitgesproken vanuit gehele onlangs universum. Onlangs wijduitstaand universum zitten naar de Kalash en Parsis (zoals vooraleer), naar de Kasjmir (wellicht wegens naar de min steekproef), en naar de Brahma, wie zitten zus meerder uitgesproken ter hun STR profiel dan haplogroup veelvuldigheid. MDS verwikkeling van naar de verte ter tarief 7A en 7B ( niet aangewezen) voorsprong voor soortgelijk uitgemaakte zaak, slechts weghebben van postuur 2B meerder zuinig ter naar de zin welk naar de Brahma verrichten niet tentoonstellingsstand uiterlijk zozeer.


zwaartelijn- Toetreding Netwerk
Naar de genetic verwantschap tussen naar de verschillend Pakistan etnisch groepen waren verkennen vervolgens tegen werkje zwaartelijn- toetreding netwerk ( banderol et al. 1995), en voorbeelden zitten aangewezen in cijfers 4, 5, en 6. Naar de haplogroup 1 netwerk vijg 4) uitbrengen geruim wisseling, slechts ook een weetje trap van universum- specifiek onderbouw Bijvoorbeeld, naar de 24 Parsi haplogroup 1 chromosoom helemaal zondeval te men van drietal wis ( vijg. 4, onnozel), 19 van 26 Boeroendi haplogroup 1 chromosoom zondeval te tweetal wis ( landerig), en 12 van 14 Toevalligheid haplogroup 1 chromosoom zondeval te te ongetrouwd wis, en helemaal van dit hier wis zitten specifiek voor hun respectief universum. Naar de haplogroup 10 netwerk vijg 5) zit zeer simpel, wegens naar de minder telefoonnummer van chromosoom, slechts weer uitbrengen universum- specifiek wis voor Boeroendi en Toevalligheid haplotypes. Naar de haplogroup 28 netwerk ( vijg. 6) uiterlijk vertoon te snedig op zichzelf staand Parsi- specifiek wis, op het einde van te speculant à la hausse zijtak, inhouden 15 van 16 Parsi haplogroup 28 chromosoom. Wis van Kalash, Boeroendi, and—to te pachter degree—Baluch chromosoom zitten tevens klaarblijkelijk, wel men Stijl haplotype zit gedeeld van Sindhi en Makrani Stijl persoonlijk vanuit naburig zuidelijk universum.
BATWING TMRCAs waren berekend voor naar de haplogroup 28 netwerk en voor uitgezocht komaf te te aantal haplogroups. Naar de resultaten zitten samenvattend herhalen ter tarief 8.

vooroverleg

Wij hebben verricht naar de voorste veelomvattend zinsontleding van YPSILON verscheidenheid te Pakistan, examining 34 uitgesproken ter 718 mannelijk vak vanuit 12 universum Zulks verstrekken ons voor presentatrice Pakistan YPSILON verscheidenheid daarmee vooraf verslaggever ter wereld universum, voor vorsen verschil te Pakistan, en voor evalueren sommige van naar de voorstellen universum kroniekschrijver vanuit te YPSILON prospect.


Vergelijking van Wereldwijd Materieel
Ter te wereldwijd vergelijking, Pakistan universum veelal wis zowat te pot Zuidelijk Aziatisch steekproef en leugen zuinig voor te Midden Oosters steekproef ( vijg. 2A). Zulks conclusie zit unsurprising, in afleveringen want naar de Zuidelijk Aziatisch steekproef met inbegrip van 62 Pakistan persoonlijk ( dat wil zeggen, 32% van 196 volslagen) en ter vaneengaan want YPSILON wisseling ter velen zone van naar de wereld zit voornaamste zinsbouw tegen inrichting, niet tegen taal of etnisch affiliëren (Rosser et al. 2000; Zerjal et al. 2001). Naar de meerder genetic overeenkomstigheid van Pakistan universum voor zulks ter naar de westen dan voor oosters universum zit geïllustreerd tegen naar de feitelijkheid welk viertal van naar de vijf veelvuldig haplogroups ter Pakistan (haplogroups 1, 2, 3, en 9, wie tezamen merk opwaarts 79% van naar de volslagen universum) zitten tevens veelvuldig ter westers Azië en Europa slechts niet ter China of Japan; een gesprek voeren, naar de haplogroups welk zitten veelvuldig ter Oriënt Azië (e.g., 4, 5, 10, 13, en 20) zitten zeldzaam of verstrooid ter Pakistan, vorm uitsluitend 2.5% van naar de volslagen Wanneer, zoals ter sommige vertolking, een vroegtijdig Exodus vanuit Afrika over naar de zuidelijk zeekust van Azië lichtdiode voor eerstgenoemde anatomisch nieuwerwets menselijk universum ter Pakistan, en dit hier volk wagon naar de oosters haplogroups of hun voorloper, hun YPSILON chromosoom zijn wel geweest ruimschoots vervangen tegen volgend trek of gene stroom; weliswaar, naar de vertegenwoordigers van naar de oosters haplogroups ter Pakistan mei zitten geïnduceerd vanuit nieuwerwets weerom- trek, niet vanuit ouderwets overlevende.
Naar de vijfde haplogroup welk zit komma ter Pakistan, haplogroup 28, verschillen vanuit gehele anderen ter zijn verspreiding. Te Pakistan, op gemaakte opwaarts 14% van onze steekproef en watertje tegenwoordig in totaal slechts tweetal universum ( beider van wie had zelfs min steekproef spanwijdte), zodoende is het beider komma en wijdvertakt Uitwendig Pakistan en naar de naburig dorps, toch, is het zeldzaam. Op heeft geweest verslaggever ter India (30%; tegenwoordig ter 3/3 universum), Tajikistan (10%; tegenwoordig ter 5/6 universum), en Oezbekistan (3%; tegenwoordig ter 10/13 universum), slechts is het zeldzaam ter Rusland (0.4%; tegenwoordig ter 1/6 universum) en naar de Kaukasus (1.4%; tegenwoordig ter 1/6 universum (welput et al. 2001) en heeft niet geweest stichten ter helemaal ter China of Mongolië (unpublished waarneming BATWING taxaties van naar de TMRCA van naar de Pakistan haplogroup 28 chromosoom waren ~7,000 (4,000–14,000) jaren ( tarief 8). Zus, te ditmaal volzin, naar de Pakistan universum zijn uiteenlopen vanuit te komma voorouderlijk universum of zijn geroutineerd geruim mannelijk gene stroom tussen zichzelf of vanuit te komma welput. Waar naar de verwachte verouderen overeenstemmen voor naar de vroegtijdig Neolithicum volzin, naar de verspreiding hiervan komaf macht zitten vennoot van naar de plaatselijke uitzetting van veenboeren.


vergelijking te Pakistan
Haplogroup verspreiding ter Pakistan universum, met uitzondering van naar de Toevalligheid ( verhandelen ter naar de volgende vak), zitten snedig soortgelijk voor elkaar (figs. 1 en 2), niettegenstaande sommige notabele taalkundig verschil. Weliswaar, naar de taal isoleren- spreken Boeroendi, naar de Dravidian- spreken Brahma, en naar de Sino-Tibetan–speaking Oostzee did niet tentoonstellingsstand uiterlijk vanuit onlangs universum ter welgeteld naar de haplogroup verdelen ( tarief 2 en vijg. 2), voorstel hetzij welk naar de taalkundig verschil arose over naar de komma Ypsilon voorbeeld watertje opgericht of welk ziedaar heeft geweest voldoende YPSILON gene stroom tussen universum voor wegwerken ieder voorletter verschil Toch te meerder uitvoerig zinsontleding van naar de YPSILON haplotypes (e.g., figs. 3–6) uitbrengen sommige uitgesproken wezenstrek van naar de Brahma en geruim universum specifiek; universum- specifiek wis van verwantschapt haplotypes zitten plain stichten ter dit hier netwerk Zulke wis zal uitsluitend zitten gezien wanneer universum zitten op zichzelf staand vanuit elkaar. Op mei zitten welk te loeien trap van gene stroom tussen universum tegenover lang voldoet voor voortvloeisel ter soortgelijk haplogroup veelvuldigheid zonder voedingsmiddelen velen gedeeld wis.
Universum- specifiek wis van haplotypes zitten vooral klaarblijkelijk ter sommige universum. Ter naar de Toevalligheid, waarheen naar de uitgesproken haplogroup veelvuldigheid toon vorenstaand zitten stichten, meest chromosoom (19/23; 83%) zondeval te men van uitsluitend tweetal welput- op zichzelf staand wis (figs. 4 en 5), vermits naar de Parsis, naar de Kalash, en naar de Boeroendi tevens uiterlijk vertoon vooraanstaand wis. Naar de Toevalligheid, Parsis, en Kalash waren naar de drietal universum vertoning naar de meest zinvol verschillend universum pairwise FST waarden. Naar de weetje waarden van naar de Toevalligheid en Parsis annuleerteken ten dele zitten verantwoorde voor tegen trek voor Pakistan vanuit andere werkhuis, slechts te quotisatie factor zit waarschijnlijk voor zitten strekking, hetzij verschuldigde voor te eng aantal stichter komaf of occurring vervolgens te min universum. Tk waarden (Ewens 1972) zorgen voor te zin van vergelijking werkelijk universum spanwijdte. Waarden op basis van naar de STRs voor naar de Toevalligheid, Parsis, Kalash, en Burushos waren 8.9, 77.5, 25.8, en 74.2, respectievelijk, presentatrice van te schriel van 181.8 voor onlangs universum van steekproef spanwijdte >20. Werkelijk universum spanwijdte voor YPSILON chromosoom annuleerteken verschillen zeerst vanuit volkstelling universum spanwijdte, slechts is het notabele welk naar de Parsis en Kalash verrichten zijn naar de minder volkstelling spanwijdte, men- honderdste of men- duizendste van allermeest zulks van onlangs universum (tarief 1), zodoende dit hier min volkstelling spanwijdte mei zijn geweest volhouden allang. Ter verzamellijst, velen wezenstrek van onderhavige schrijven Pakistan YPSILON haplotype verspreiding annuleerteken zitten verantwoorde tegen te gedeeld voorouderlijk gene pot, van eng gene stroom tussen universum en strekking ter naar de minder zichzelf.


inzicht te Universum Opkomst
Naar de voorstellen universum opkomst ( tarief 1) annuleerteken wel zitten overwegen ter naar de zwak van dit hier YPSILON resultaten. Wetenswaardigheid zit voorzien tegen haplogroup veelvuldigheid, wie annuleerteken zitten tweedehands voor voedingsmiddelen bijmengsel taxaties, en dit hier zitten vlot voor vertolken wanneer universum zitten wijd en op zichzelf staand en naar de welput universum zijn verschillend veelvuldigheid. Wanneer dit hier voorwaarde zitten niet met, naar de tegenwoordigheid van uitgesproken YPSILON komaf annuleerteken stilstaand zitten informatica Naar de opkomst van naar de Parsis zitten welput- gedocumenteerd (Nanavutty 1997) en zus zorgen voor te nuttig proefproces. Zij zitten achterban van naar de Perzisch ziener Zoroaster, wie trekken voor India over naar de ondergang van naar de Sassanian rijk ter naar de 7th eeuw a.d. Zij bestendig ter 900 a.d. ter Gujarat, India, waarheen zij waren genaamd naar de “Parsi” ( zin “from Perzië). Uiteindelijk zij bewogen voor Mummelen ter India en Karate ter Pakistan, vanwaar onderhavige schrijven universum watertje steekproef ( vijg. 7). Hun veelvuldigheid voor haplogroups 3 (8%) en 9 (39%) verrichten weliswaar weghebben van zulks ter Perzië meerder dan zulks van hun tegenwoordig omwonenden ter Pakistan. Zij uiterlijk vertoon naar de onderste veelvuldigheid voor haplogroup 3 ter Pakistan (ongerekend naar de Toevalligheid; vijg 1C). Naar de schriel voor achttal Perzisch universum watertje 14% (n401=) (vijfkaart-Murci et al. 2001), vermits welk voor Pakistan, weren naar de Parsis, watertje 36%. overeenkomstig cijfers voor haplogroup 9 waren 39% ter naar de Parsis, 40% ter Perzië, en 15% ter Pakistan weren naar de Parsis. Dit hier cijfers voorsprong voor een bijmengsel taxatie van 100% vanuit Perzië ( tarief 3). Uitgaande van naar de min werkelijk universum spanwijdte van naar de Parsis, naar de vasthoudendheid van hun weerga voor naar de Perzisch materieel mei zitten fortuitous, en naar de tegenwoordigheid van haplogroup 28 chromosoom ter 18% (4% ter Perzië; Welput et al. 2001) voorstellen sommige gene stroom vanuit naar de omliggend universum Naar de TMRCA voor naar de Parsi- specifiek wis ter naar de haplogroup 28 netwerk watertje 1,800 (600–4,500) jaren (tarief 8), verenigbaar van naar de trek van te min aantal komaf vanuit Perzië Totaal, dit hier resultaten vertonen te zuinig weerga tussen naar de historisch archief en naar de YPSILON materieel, en zus voorstellen welk naar de YPSILON materieel zal zitten nuttig wanneer verminderd historisch wetenswaardigheid zit voorhanden.
Naar de universum welk zit genetically meest uitgesproken, naar de Toevalligheid, schadegevallen neerhaling vanuit Genghis Khan’s legermacht; hun naamwoord stamt af vanuit naar de Perzisch woordje “hazar,” zin “thousand,” want troeper restten hierachter ter team van mille. Voor naar de uiterste deel van naar de 19th eeuw, sommige Toevalligheid bewogen vanuit Afghanistan voor naar de Khurram Vallei ter Pakistan, naar de welput van naar de steekproef vorsen hiernaartoe Zus, hun oraal voorgeschiedenis identificatiecode een opkomst ter Mongolië en universum wegvernauwing ~800 en ~100 jaren voor. Van naar de tweetal voornaamste YPSILON haplogroups tegenwoordig ter zulks universum, haplogroup 1 zit wijdvertakt ter Pakistan, zeer van Azië, Europa, en naar de Amerika, enzovoorts zorgen voor weinig wetenswaardigheid zowat naar de werkhuis van opkomst. Haplogroup 10, ter tegenstelling, zit zeldzaam ter meest Pakistan universum (1.4%, wanneer naar de Toevalligheid zitten niet-inbegrepen) slechts zit komma ter Oriënt Azië, waaronder Mongolië, waarheen op merk opwaarts tegenover helft van naar de universum (unpublished resultaten). Bijmengsel taxaties ( tarief 3) zitten verenigbaar van te substantiële quotisatie vanuit Mongolië. BATWING zinsontleding van naar de Toevalligheid- specifiek haplotype wis ter haplogroups 1 en 10 voorstellen TMRCAs van 400 (120–1,200) en 100 (6–600) jaren ( tarief 8), respectievelijk Zus, naar de genetic verklaring zit verenigbaar met het oogmerk oraal traditie en, ter zienswijze van zijn zelfstandig wezen, zorgen voor zwaar steun ervoor ( vijg. 7).

Sommige andere voorstellen opkomst toucheren meerder eng steun vanuit naar de YPSILON materieel. Naar de Zwart Makrani, van te postulaat opkomst ter Afrika, voorhebben naar de hoogst veelvuldigheid van haplogroup 8 chromosoom stichten ter ieder Pakistan universum, zoals toon ergens anders (Qamar et al. 1999). Zulks haplogroup zit ruimschoots kamerarrest voor sub- Sahara Afrika, waarheen op opricht zowat helft van naar de universum (hamer et al. 2001) en annuleerteken zus zitten tel zoals te uitgesproken van Afrikaans YPSILON chromosoom. Niettemin, op merk opwaarts uitsluitend 9% van naar de Zwart Makrani steekproef, en haplogroup 28 (over van andere typisch Pakistan haplogroups) zit tegenwoordig hierin universum. Wanneer naar de YPSILON chromosoom waren aanvankelijk Afrikaans ( vijg. 7), meest zijn vervolgens geweest vervangen: naar de totaal taxatie van naar de Afrikaans quotisatie zit ~12% ( tarief 3).

Naar de Oostzee zitten gedachte voor zijn ontstane ter Tibet, waarheen naar de voornaamste haplogroups zitten 4 en 26. Noch watertje tegenwoordig ter naar de steekproef vanuit zulks werkkamer, zorgen voor niet steun voor te Tibetaans opkomst van naar de YPSILON chromosoom komaf en een bijmengsel taxatie van nulpunt ( tarief 3). Toch, zulks voortvloeisel most zitten vertolker van waarschuwingscommando, wegens naar de min steekproefomvang. Drietal universum zijn ten spoedigste opkomst vanuit naar de wapening van Alexander naar de Tof: naar de Boeroendi, naar de Kalash, en naar de Pad. Nieuwerwets Grieks uiterlijk vertoon te matig hoogfrequentie van haplogroup 21 (28%; Rosser et al. 2000), slechts zulks haplogroup watertje niet gezien ter hetzij naar de Boeroendi of naar de Kalash steekproef en watertje stichten ter uitsluitend 2% van naar de Pad, vermits naar de plaatselijke haplogroup 28 watertje tegenwoordig ter 17%, 25%, en 13%, respectievelijk. Grieks- bijmengsel taxaties van 0% waren zich toeëigenen voor naar de Boeroendi en naar de Pad, slechts cijfers van 20–40%% waren zich houden aan voor naar de Kalash ( tarief 3). Ter zienswijze van naar de mangel van haplogroup 21, wij ascribe zulks voortvloeisel hetzij voor strekking ter naar de veelvuldigheid van onlangs haplogroups, vooral haplogroups 2 en 1, of voor naar de stumperig voornemen van komaf te dit hier haplogroups, voortvloeiend ter uitgesproken komaf zijnde kleine advertenties te idem paraphyletic haplogroups. Totaal, niet steun voor te Grieks opkomst van hun YPSILON chromosoom watertje stichten, slechts zulks uitgemaakte zaak doet vergen naar de Maria-Hemelvaart welk nieuwerwets Grieks zitten vertegenwoordiger van Alexander wapening. Tweetal universum, naar de Kasjmir en naar de Pad, tevens leg schuldvordering voor te ten spoedigste Joods opkomst Joods universum plain zijn te matig veelvuldigheid van haplogroup 21 (e.g., 20%) en te weetje veelvuldigheid van haplogroup 9 (e.g., 36%; (hamer et al. 2000). Naar de veelvuldigheid van beider van dit hier haplogroups zitten loeien ter naar de Kasjmir en Pad, en haplogroup 28 zit tegenwoordig ter 13% ter naar de Pad, zodoende niet steun voor te Joods opkomst zit stichten, en naar de bijmengsel taxatie watertje 0% ( tarief 3), wel, weer, zulks uitgemaakte zaak zit eng beider tegen naar de min steekproefomvang voorhanden vanuit Kasjmir en tegen naar de Maria-Hemelvaart welk naar de nieuwerwets steekproef zitten vertegenwoordiger van ouderwets universum.

Naar de voorstellen opkomst van naar de Stijl zit ter Syrië. Syrisch, zoals Perzisch, zitten tekenen tegen te loeien veelvuldigheid van haplogroup 3 en te hoogfrequentie van haplogroup 9 (9% en 57%, respectievelijk; Hamer et al. 2000), vermits naar de overeenkomstig veelvuldigheid ter naar de Stijl zitten 29% en 12%. Zulks verschil en naar de hoogfrequentie van haplogroup 28 ter naar de Stijl (29%) merk te voornaamste Syrisch opkomst voor hun YPSILON chromosoom onwaarschijnlijk, en naar de bijmengsel taxatie watertje 0% (tarief 3), wel naar de 8% veelvuldigheid voor haplogroup 21, naar de hoogst identificatiecode ter Pakistan zover, doet omschrijven sommige westers quotisatie voor hun YPSILON komaf. Brahma zijn te ten spoedigste opkomst ter Westen Azië (Hughes- Kogel 1991) en op is aangegeven welk te verspreiding van haplogroup 9 YPSILON chromosoom watertje vennoot met het oogmerk uitzetting van Dravidian- spreken veenboeren ( vijfkaart-Murci et al. 2001). Brahma zijn naar de hoogst veelvuldigheid van haplogroup 9 chromosoom ter Pakistan (28%) over naar de Parsis, zorgen voor sommige steun hiervoor onderstelling, slechts hun hogere veelvuldigheid van haplogroup 3 (39%) zit niet typisch van naar de Vruchtbaar Sikkel ( vijfkaart-Murci et al. 2001) en voorstellen te meerder samengesteld opkomst, mogelijkerwijs van bijmengsel vanuit later trek, zulke zoals zulks van Indo- Perzisch spreker vanuit naar de steppe van Middelste Azië en anderen vanuit vervolgens oriënt Zulks mogelijkheid zit voorstander tegen naar de speurder van loeien veelvuldigheid van haplogroups 10, 12, en 13 ter naar de Brahma, helemaal zeldzaam ter Pakistan en typisch van Oriënt Azië, Oriënt en noords Azië, en Zuidoostelijk Azië, respectievelijk.

Naar de storing voor vondst te YPSILON verbinding van te voorstellen universum van opkomst doet niet weerleggen te historisch vereniging, slechts op doet vertonen welk naar de YPSILON chromosoom geïnduceerd vanuit zulke historisch gebeurtenis zijn geweest zoekgeraakt of vervangen. Verdelen van mitochondrial DNA en andere loci zou steun voor toelichten naar de universum kroniekschrijver en zou vooral interessant ter universum zoals naar de Zwart Makrani en naar de Oostzee, waarin ziedaar zit te tegenstelling tussen naar de phenotype en naar de typisch Pakistan YPSILON haplotypes.

Acknowledgments


Zulks werkzaamheden watertje voorstander tegen te Wellcome Vertrouwen Medewerking Speurwerk Initiatief Subsidie voor S.Q.M. T.Z. watertje tevens voorstander tegen Naar de Wellcome Vertrouwen, en C.T.-S. tegen naar de Kankeronderzoek Werkseizoen. Wij uitdrukkelijk onze waardevermeerdering voor naar de origineel DNA schenker wie gemaakte zulks werkkamer ten spoedigste. Naar de Tak van dienst van Gezondheid van naar de Regering van Baluchistan en naar de Stijl Student Federatie, Quetta, Pakistan, hulp ter naar de verzameling van naar de Brahma en Stijl steekproef. Pad steekproef waren inzamelen met het oogmerk steun van naar de Tak van dienst van Paediatrics, Vrouw Voorlezing Werkkring Gepromoveerde Medische Ziekenhuisinrichting, Peshawar, Pakistan Wij zitten tevens erkentelijk voor Passiva. mij Kazmi en naar de Aga Khan Vorming Landelijke Gezondheid Steun Programma voor hun steun ter naar de verzameling van Boeroendi steekproef. passiva uitspraak Seth voorzien waardevol steun ter naar de verzameling van naar de Parsi steekproef. Wij danken Luis Vijfkaart-Murci voor zijn toelichting voort naar de manuscript.


elektronisch-Database Wetenswaardigheid

URLs voor materieel hierin stuk zitten als volgt:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Netwerk 2.0, http:/www.fluxus-engineering.com/.
/ Vergezicht, http:/forrest.psych.unc.edu/.
/
referenties

Ahmad AKN (1952) Jezus ter lucht voort grond. Naar de Civiel en Militair Krant Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin Te, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Smid C (2000) Identificatie en characterisation van roman menselijk YPSILON- chromosoom microsatellites vanuit volgorde database wetenswaardigheid. Nucleair- Zuur Res 28e8: [ zonder kosten Volmondig tekst ter PMC].
Rugslag PC (1992) Oostzee. ter Rugslag PC, Radloff KOSTEN EN VRACHT (eds) Sociolinguistic schouw van noords Pakistan. Vol 2, Talen van noords zone Vaderlands Instituut van Pakistan Gezocht, Islamabad, pp 3–27.
Banderol HJ, Verzaken P, Rohl TE (1999) Zwaartelijn- toetreding netwerk voor inferring intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ zonder kosten Volmondig Tekst].
Banderol HJ, Verzaken P, Sykes Voor Christus, Richards MEGABYTE (1995) Mitochondrial portret van menselijk universum using zwaartelijn netwerk. Genetica 141743–753: [PubMed] [ zonder kosten Volmondig Tekst].
Schel HW (1979) Naar de wedren van Afghanistan. Sang-e-Meel Verschijning, Lahore, Pakistan.
Schel HW (1998) Een verzoek om inlichtingen te naar de etnografie van Afghanistan Vanguard Handelsboeken, Lahore, Pakistan.
Bergum AW, Wang C- Ypsilon, Tsai J, Jefferson K, Dey C, Smid KD, Warande S-C, Tsai S-J, Gulden D (1999) Een Asian–Native Amerikaans vaderszijde komaf identificatiecode tegen RPS4Y resequencing en tegen microsatellite haplotyping. Ann Geroezemoes Genet 6363–80: [PubMed] [volmondig Tekst].
Tweejaarlijks Niet, Belle G, Flink CM, Vleselijk RF, Rothhammer Uitspraak, Dienstklopper- Goudsbloem VL, Pena SD (1997) Opkomst van Amerindian YPSILON- chromosoom zoals concluderen tegen naar de zinsontleding van zestal polymorphic uitgesproken. Ben J Artsenij Antropologisch 10279–89: [PubMed] [ volmondig Tekst].
Biddulph J (1977) Volksstam van naar de Hindoeïstisch Koosh. Indus Verschijning, Karate, Pakistan.
Draagvermogen RF (1851) Sindh en naar de wedren welk bewonen naar de vallei van naar de Indus. WH Aangeven en Co Ltd, Londen.
Slemppartij O (1958) Naar de Pad. Oxford Universiteit Pers, Karate, Pakistan.
Casanova M, Leroy P, Boucekkine C, Weissenbach J, Bisschop C, Velg M, Purrello M, Fiori G, Siniscalco M (1985) TE menselijk YPSILON- verbinding DNA polymorphism en zijn potentieel voor voorcalculatie genetic en ontwikkeling verte Wetenschap 2301403–1406: [PubMed].
Ruiterstoet-Sforza LL, Menozzi P, Piazza TE (1994) Naar de voorgeschiedenis en inrichting van menselijk Scheppingsboek. Vorst Universiteit Pers, Vorst.
Dal GF (1991) Naar de verschijnsel van naar de Indus civilisatie. ter Jansen M, Mulloy M, Stedelijk G (eds) Vergeten steden voort naar de Indus: vroegtijdig civilisatie ter Pakistan vanuit naar de 8th voor naar de 2nd duizendjarig Voor Christus. Verlag Filippijns von Zabern, Voornaamste, Duitsland, pp 129–144.
Versieren KD (1992) Sociolinguistic schouw van Noords Pakistan. Vol 5, Talen van Hittepetit. Vaderlands Instituut van Pakistan Gezocht, Islamabad.
Ewens WJ (1972) Naar de steekproef nemen theorie van selectief onpartijdig aangeven Theorema Gepeupel Biol 387–112: [PubMed].
Grimmig BF (1992) Etnologisch: talen van naar de wereld. Zomer Instituut van Taalwetenschap, Dallas.
Hamer MF (1994) TE vers plaatsing van een Rekenorgaan element voort naar de YPSILON chromosoom zit te nuttig uitgesproken voor menselijk universum gezocht. Mol Biol Evol 11749–761: [PubMed] [zonder kosten Volmondig Tekst].
Hamer MF, Horai S (1995) YPSILON chromosoom DNA wisseling en naar de volk van Japan. Ben J Geroezemoes Genet 56951–962: [PubMed].
Hamer MF, Karate TM, Rossig AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hiërarchische voorbeeld van global menselijk YPSILON- chromosoom verscheidenheid Mol Biol Evol 181189–1203: [PubMed] [ zonder kosten Volmondig Tekst].
Hamer MF, Rossig AJ, Woud ET, Wagenkap MR, Jarjanazi H, Karate T, Santachiara-Benerecetti S, Oppenheim Te, Jobling MA, Jenkins T, Ostrer H, Wagenkap-Tamir B (2000) Joods en Midden Oosters non- Joods universum tantième te komma pot van YPSILON- chromosoom biallelic haplotypes. Proc Natl Academisch Sci VERENIGDE STATEN VAN AMERIKA 976769–6774: [ zonder kosten Volmondig tekst ter PMC].
Helgason Te, Sigurdardottir S, Nicholson J, Sykes B, Heuvel EW, Draadnagel DG, Bosnië V, Gulcher JR, Ziekenzaal R, Stefansson K (2000) Voorcalculatie Scandinavisch en Keltisch voorouderlijk ter naar de mannelijk voldoen van IJsland. Ben J Geroezemoes Genet 67697–717: [PubMed] [ zonder kosten Volmondig Tekst].
Hughes- Kogel R (1991) Keizerlijk krant van India: provinciaal set, Baluchistan. Sang-e-Meel, Lahore, Pakistan.
Huzaar J (1997) TE voorgeschiedenis van naar de volk van Pakistan voor zelfstandigheid. Oxford Universiteit Pers, Karate, Pakistan.
Ibbetson D (1883) Panjab kaste Sang-e-Meel, Lahore, Pakistan.
Jarrige JF (1991) Mehrgarh: zijn werkhuis ter naar de ontwikkeling van ouderwets teelt ter Pakistan. ter Jansen M, Mulloy M, Stedelijk G (eds) Vergeten steden voort naar de Indus: vroegtijdig civilisatie ter Pakistan vanuit naar de 8th voor naar de 2nd duizendjarig Voor Christus. Verlag Filippijns von Zabern, Voornaamste, Duitsland, pp 34–50.
Jobling MA, Tyler- Smid C (2000) Opkomend uses voor opkomend haplotypes: naar de menselijk Ypsilon chromosoom, ziekte en teeltkeus Ontwikkelingen Genet 16356–362: [PubMed] [ volmondig Tekst].
Karate TM, Zegura SL, Posukh O, Osipova L, Bergum Te, Speculant à la hausse J, Gulden D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffioen RC, Sjabloon AR, Hamer MF (1999) Voorouderlijk Aziatisch welput() van opkomend wereld YPSILON- chromosoom stichter haplotypes. Ben J Geroezemoes Genet 64817–831: [PubMed] [zonder kosten Volmondig Tekst].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila TE (2000) Tekenend en veelvuldigheid van germline mutaties ter microsatellite loci vanuit naar de menselijk YPSILON chromosoom, zoals uitbrengen tegen directe waarneming ter vader/ zoon tweetal. Ben J Geroezemoes Genet 661580–1588: [PubMed] [ zonder kosten Volmondig Tekst].
Kwok C, Tyler- Smid C, Mendonca BB, Hughes Mij, Berkovitz GD, Goodfellow PN, Venten JR (1996) Mutatie zinsontleding van naar de 2 kilobyte 5' voor SRY ter XY wijfje en XY doorsnijden vak J Med Genet 33465–468: [PubMed].
Speculant à la hausse JC (1991) Naar de genetic zinsbouw van bijmengsel universum. Genetica 127417–428: [PubMed] [zonder kosten Volmondig Tekst].
Wiskunde Berechting, Bayes M, Tyler- Smid C (1994) Zeerst informatica samenstelling haplotypes voor naar de menselijk YPSILON chromosoom. Geroezemoes Mol Genet 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Pastorie Te, Ismail M, Hamer MF, Stiekem Pa, Ruiterstoet-Sforza LL (1999) Naar de opkomst van Pakistan universum verklaring vanuit YPSILON chromosoom uitgesproken. ter Papisme SS, Deka R, Chakraborty R (eds) Genua verscheidenheid: verzoekschrift ter menselijk universum genetica Kluwer Academisch/ Plenum Uitgeverij, Opkomend York, pp 83–90.
Mohyuddin Te, Ayub Q, Qamar R, Zerjal T, Helgason Te, Mehdi SQ, Tyler- Smid C (2001) YPSILON- chromosoom STR haplotypes ter Pakistan universum Voornaam Sci Int 118141–146: [PubMed] [volmondig Tekst].
Nanavutty P (1997) Naar de Parsis. Vaderlands Boekje Vertrouwen, Opkomend Delhi, India.
Pandora Te, Koning TE, Santos FR, Taylor PG, Thangaraj K, Zingen L, Jobling MA, Tyler- Smid C (1998) TE polymorphic menselijk YPSILON- chromosoom G voor TE overgang stichten ter India. Ind J Geroezemoes Genet 452–61:.
Qamar R, Ayub Q, Khaliq S, Pastorie Te, Karate T, Mehdi SQ, Hamer MF (1999) Afrikaans en Levantijns opkomst van Pakistan Keffen+ YPSILON chromosoom. Geroezemoes Biol 71745–755: [PubMed].
Quddus SA (1990) Naar de stam- Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Vijfkaart-Murci L, Krausz C, Zerjal T, Sayar St, Hamer MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin Te, Radhakrishna U, Jobling MA, Tyler- Smid C, McElreavey K (2001) YPSILON- chromosoom komaf zweem verspreiding van volk en talen ter zuidwester Azië. Ben J Geroezemoes Genet 68537–542: [PubMed] [zonder kosten Volmondig Tekst].
Toga DF, Hiorns R (1965) Werkwijze van zinsontleding van naar de genetic vormgeving van te hybrid universum. Geroezemoes Biol 3738–43:.
Robertson GS (1896) Naar de Kafirs van naar de Hindoeïstisch-Kush. Oxford Universiteit Pers, Karate, Pakistan.
Rosser ZH, Zerjal T, Werpen Mij, Adojaan M, Alavantic D, Amourette Te, Amos W, et al (2000) YPSILON- chromosoom verscheidenheid ter Europa zit beklinken en beïnvloed op de eerste plaats tegen inrichting, vrij dan tegen taal. Ben J Geroezemoes Genet 671526–1543: [PubMed] [ zonder kosten Volmondig Tekst].
Santos FR, Carvalho- Zilver Passiva, Pena SDJ (1999a) PCR- op basis van DNA profiel van menselijk Ypsilon chromosoom ter Epplen JT, Lubjuhn T (eds) Werkwijze en gereedschap ter biosciences en medicijn. Birkhauser Verlag, Bazel, Zwitserland, pp 133–152.
Santos FR, Pandora Te, Kayser M, Mitchell RJ, Liu Te, Zingen L, Verwoesten- Bizon G, Novelletto Te, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Smid C (2000) TE polymorphic L1 retroposon plaatsing ter naar de centromere van naar de menselijk YPSILON chromosoom. Geroezemoes Mol Genet 9421–430: [PubMed] [ zonder kosten Volmondig Tekst].
Santos FR, Pandora Te, Tyler- Smid C, Pena SD, Schanfield M, Leonisch WR, Osipova L, Zoetwaterkreeft MH, Mitchell RJ (1999b) Naar de middelste Siberisch opkomst voor vaderlands Amerikaans YPSILON chromosoom. Ben J Geroezemoes Genet 64619–628: [PubMed] [ zonder kosten Volmondig Tekst].
Schneider S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: te software voor universum genetic materieel zinsontleding Genetica en Biometry Laboratorium, Universiteit van Genève, Zwitserland.
Seielstad MT, Hebert JM, Lin AA, Stiekem Pa, Ibrahim M, Vollrath D, Ruiterstoet-Sforza LL (1994) Opbouw van menselijk YPSILON- chromosoom haplotypes using een ander mens polymorphic TE voor G overgang. Geroezemoes Mol Genet 32159–1261: [PubMed].
Scheen T, Tomita K, Vandaag T, Kotliarova SE, Luwte J, Kuroki Ypsilon, Jin DK, Tokunaga K, Nakamura H, Nakahori YPSILON (1999) Genetic veranderingen voort naar de YPSILON chromosoom ter naar de Japans universum en gevolgen voor nieuwerwets menselijk YPSILON chromosoom komaf. J Geroezemoes Genet 44240–245: [PubMed].
Thomas MG, Draadnagel Berechting, Zwaaien ZM (1999) Weetje doorvoercapaciteit zinsontleding van 10 microsatellite en 11 diallelic polymorphisms voort naar de menselijk YPSILON- chromosoom. Geroezemoes Genet 105577–581: [PubMed] [volmondig Tekst].
Tyler- Smid C (1999) YPSILON- chromosoom DNA uitgesproken. ter Papisme SS, Deka R, Chakraborty R (eds) Genua verscheidenheid: verzoekschrift ter menselijk universum genetica Kluwer Academisch/ Plenum Uitgeverij, Opkomend York, pp 65–73.
Stiekem Pa, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, David RW, Ruiterstoet-Sforza LL, Oefner PJ (1997) Speurder van talrijk YPSILON chromosoom biallelic polymorphisms tegen denaturing weetje- waarneming vocht chromatography. Genua Res 7996–1005: [PubMed] [zonder kosten Volmondig Tekst].
Welput RS, Yuldasheva Berechting, Ruzibakiev R, Stiekem Pa, Evseeva Mij, Landerig- Smid J, Jin L, et al (2001) Naar de Eurasian harteloos: te continentaal prospect voort YPSILON- chromosoom verscheidenheid Proc Natl Academisch Sci VERENIGDE STATEN VAN AMERIKA 9810244–10249: [ zonder kosten Volmondig tekst ter PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Volgorde wisseling van naar de menselijk Ypsilon chromosoom Wezen 378379–380: [PubMed] [ volmondig Tekst].
Wilson IJ, Onopgesmut DJ (1998) Genealogical gevolgtrekking vanuit microsatellite materieel. Genetica 150499–510: [PubMed] [ zonder kosten Volmondig Tekst].
Wolpert S (2000) TE opkomend voorgeschiedenis van India. Oxford Universiteit Pers, Opkomend York.
Jong FW, Vlag CM (1996) TE zichtbaar statistiek systematiek. ter Steek RA, Vos J (eds) Statistisch calculeerbaar omgeving voor sociaal navorsingen. Salvia Verschijning, Opkomend York, pp 207–236.
Zerjal T, Grijperlijn L, Grijperlijn G, Mikelsaar AV, Krumina Te, Kucinskas V, Werpen Mij, Tyler- Smid C (2001) Geografisch, taalkundig, en cultureel protectie voort genetic verscheidenheid: YPSILON- chromosoom verspreiding ter Noords Europees universum. Mol Biol Evol 181077–1087: [PubMed] [ zonder kosten Volmondig Tekst].
Zerjal T, Dashnyam B, Pandora Te, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Fretwell Berechting, Jobling MA, Harihara S, Glanzen K, Semjidmaa D, Sajantila Te, Salomon P, Zoetwaterkreeft MH, Ginter EK, Evgrafov OV, Tyler- Smid C (1997) Genetic verwantschap van Aziatisch en Noords Europees, uitbrengen tegen YPSILON- chromosoom DNA zinsontleding. Ben J Geroezemoes Genet 601174–1183: [PubMed].

 

 

 

 

 

 

 

 

Pagina vorig bijwerken: Thursday, November 24, 2005 00:06:19 -0500