Genetica

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Cromosomico DNA Variazione in Il Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Cristo Tyler- Distruggere e S. Qasim Mehdi1

1Biomedical e Genetico Ingegneria Divisione, Dott. un Q. Khan Ricerca Laboratori, Islamabad; 2Cancer Ricerca Campagna, Cromosoma Molecolare Biologia Gruppo, Dipartimento di Biochimica, e 3Institute di Biologico Antropologia, Universitê di Scarpa da uomo classica con lacci, Scarpa da uomo classica con lacci, Unito Regno; e decodificare Genetica, Reykjavik.

Astratto

Diciotto doppio polimorfismo e 16 multiallelic, corto- in tandem- ripetizione (STR) luoghi dal nonrecombining porzione del umano Y cromosoma erano tipo in 718 maschio soggetto averi verso 12 etnico gruppo di Il pakistan. Questi identificato 11 stabile haplogroups e 503 combinazione doppio pennarello/STR haplotypes. Haplogroup frequenze erano generalmente simile verso quelli in neighboring geografico area, e il Il pakistan popolazione parlare un lingua isolare ( il Burushos), un Dravidian lingua ( il Brahui), o un Sino- Il Tibet lingua ( il Balti) assomigliare il Indo-European–speaking maggioranza Cionondimeno, mezzi di comunicazione- unire rete di haplotypes rivelare considerevole substructuring di Y variazione dentro Il pakistan, con molti popolazione rappresentazioni distinto gruppi di haplotypes. Questi schema inscatolare essere conto poich‚ da un comune biliardo di Y lignaggio, con sostanziale isolamento tra popolazione e direzione nel minore se stesso Poco comparativo genetico o storico dati sei disponibile poich‚ il pi popolazione, solo il risultare inscatolare essere comparare con orale tradizione da ogni parte origine Il Y dati sostegno il bene- stabilito origine del Analizzi in Iran, il suggerire lignaggio del Gioco di dadi da Genghis Khan’s esercito, e il origine di il Negro Makrani in Africa, solo fare non sostegno tradizione di Il Tibet, La Siria, Greco, o Ebreo origine poich‚ altro popolazione.

Introduzione

Il il più presto prova di Paleolithic umano presenza nel Sud Asia consistere di pietra strumento trovato spargere in giro il Soan Fiume Valle in settentrionale Il pakistan ( ussaro 1997). Nonostante il mancanza di fossile prova, questi strumento apparire verso indicare il presenza di viaggiatore nel Sud Asia come primo come 200,000–400,000 anni d'etê passato (Wolpert 2000) e cosØ sei probabile verso avere stato associato con arcaico Homo specie. Il pakistan bugie sul postulato del sud costiero far viaggiare adepto da anatomicamente moderno Homo Sapiens eliminato di Africa, e cosØ Maggio avere stato abitato da moderno umano come primo come 60,000–70,000 anni d'etê passato. C'ź prova di caverna risiedere in Il pakistan nord-ovest frontiera, solo fossile prova dal Paleolithic ha stato frammentario ( ussaro 1997). Prova ha stato scoprire a Mehrghar, in a sudovest Il pakistan, indicare Neolithic colonizzazione da come molto tempo fa come 7,000 b.c. (stonatura 1991), quale erano adepto da il Indus Valle civiltà ( includere il cities di Arringa e Mohenjodaro) quello fiorire nel 3d e 2d millenni b.c. (valle 1991). In giro 1500 b.c., il Indo-European–speaking nomade pastorale trub da ulteriore north—often visitatore il Aryans—crossed il Karakorum Montagne in il Sud Asia. Successivo storico eventi includere il invasione di Alessandria il Grande (327–325 b.c.) e il Arabo e Mussulmano conquista da 711 a.d. in arrivo (Wolpert 2000).

Il presente popolazione di Il pakistan consistere di pi di 160 milione individuale ( secondo verso 2005 CHI figure) chi appartenere verso almeno 18 etnico gruppo e parlare pi di 60 lingua ( lordura 1992). Il pi di questi lingua sei Indo- Europeo, solo essi anche includere un isolare, Burushaski; un Dravidian lingua, Brahui; e un Sino- Il Tibet lingua, Balti. Il Punjab- parlare individuale forma il maggioranza popolazione di Il pakistan, solo essi rappresentare un complesso mescolanza di etnico gruppo (Ibbetson 1883) e sei non analizzato qui; 12 etnico gruppo sei incluso nel presente esame. informazione disponibile da ogni parte loro ź ricapitoli in da tavolo 1, assieme con ipotesi da ogni parte loro origine (Mehdi et al. 1999). Sebbene alcuno di questi ipotesi sei bene- sostenitore (e.g., il origine del Analizzi in Iran), il pi sei ignobile acceso orale tradizione e avere non stato esame contro altro fonte di prova.

Scarso genetico dati sei disponibile poich‚ questi Il pakistan etnico gruppo Primo laboratorio di posa di il ABO sangue gruppo e classico proteina pennarello did non includere tutto gruppo e per la maggior parte classificato loro secondo loro piazza di residenza. UN popolazione albero ignobile acceso 54 classico enzima pennarello piazza il Gioco di dadi e Sentiero nel Ovest Asia gruppo contenendo il settentrionale Caucasoids (gaio-Sforza et al. 1994). In un altro popolazione albero, ignobile acceso 47 classico proteina polimorfismo, il Il pakistan campione forma un piccolo subcluster dentro il Indoeuropeo telecronista da India ( gaio-Sforza et al. 1994).

Il Y cromosoma provvedere un unico fonte di genetico prova (Tyler- Distruggere 1999; Disoccupato e Tyler- Distruggere 2000). Lo trasporta il elargizione nonrecombining segmento in il Genova e contenere numeroso stabile doppio pennarello, includere ignobile sostituzione (vedere, e.g., Da basso et al. 1997) e retroposon inserzioni ( martello 1994; Sant ' et al. 2000), quale inscatolare essere usato in combinazione con più- rapido elaborando pennarello, cosØ microsatellites (vedere, e.g., Ayub et al. 2000). Conseguentemente, tutto particolareggiato Y filogenetico inscatolare essere costruire quello permettere maschio- specifico aspetto di genetico storia verso essere studi. Questi sei fortemente influenza da il piccolo effettivo popolazione taglia del Y cromosoma, di guida verso rapido genetico direzione, e da il pratica di patrilocality in molti società, di guida verso alto sullo stesso livello di geografico differenziazione di Y haplotypes. Nonostante tutto il lavoro di Qamar et al. (1999) sul analisi di Guaire+ cromosoma ( comprendere ~2.6% del totale) e analizzare di STR variazione (Ayub et al. 2000; Mohyuddin et al. 2001), piccolo lavoro ha stato carried eliminato acceso Il pakistan Y cromosoma. Quindi, abbiamo presente eseguire un esteso analisi di Il pakistan Y lignaggio, verso determinare che leggero essi inscatolare versare sul origine e genetico storia del subgroups quello trucco il Il pakistan popolazione.

Materiale e Metodo

Campione
Il Y cromosoma di 718 unrelated maschio soggetto, averi verso 12 etnico gruppo di Il pakistan, erano analizzato (cucchiaio da minestra 1 e 2; fico. 1). Delatore consentire fu ottenere da tutto partecipante in questo studio. Un Epstein Caserma virus–transformed linfoblastico cellula linea fu stabilito da ciascuno individuale, e DNA fu estratto da questi cellula certificato di matrimonio poich‚ analisi.

Doppio Polimorfismo Battitura a macchina
Noi tipo 15 SNPs, un Alu inserzioni ( martello 1994; Martello e Horai 1995), un Linea inserzioni ( sant ' et al. 2000), e il 12f2 cancellando (Casanova et al. 1985). Il ignobile sostituzione erano 92R7 C?T ( matematica et al. 1994); M9 C?G ( da basso et al. 1997); SRY-2627 C?T (biennale et al. 1997); SRY-1532 unG?UN (Whitfield et al. 1995; Kwok et al. 1996; Sant ' et al. 1999b); sY81 (DYS271) Un?G (Seielstad et al. 1994); SRY-8299 G?Un (sant ' et al. 1999a); Adatto G?UN (Pandya et al. 1998); SRY +465 C?T ( stinco et al. 1999); LLY22g C?UN e Tat T?C transizione (Zerjal et al. 1997). Oltre, il M17 pennarello ( da basso et al. 1997) fu tipo, da uso del primo GTGGTTGCTGGTTGTTACGT e AGCTGACCACAAACTGATGTAGA adepto da AflIII digestione del PCR prodotto; il ancestrale allele fu non riassunto Il M20 pennarello (da basso et al. 1997) fu genotipo, da uso di il primo CACACAACAAGGCACCATC e GATTGGGTGTCTTCAGTGCT adepto da SspI digestione; il Un?G mutazione distruggere il sito a posizione 118 nel 413- punto di ebollizione prodotto. M11 (da basso et al. 1997) fu tipo, usando il primo TTCATCACAAGGAGCATAAACAA e CCCTCCCTCTCTCCTTGTATTCTACC adepto da digestione con MspI. Il 215- punto di ebollizione prodotto fu riassunto verso 193- punto di ebollizione e 22-punto di ebollizione frammento nel derivare allele. Il RPS4Y C?T mutazione (bergamotto et al. 1999) fu rilevare da BslI restrizione digestione di un 528- punto di ebollizione PCR prodotto ottenere da uso del primo CCACAGAGATGGTGTGGGTA e GAGTGGGAGGGACTGTGAGA. Il ancestrale C allele contenere due sito, e il derivare T allele contenere uno. M48 (da basso et al. 1997), unG, fu tipo da allele- specifico PCR usando il discriminare primo TGACAATTAGGATTAAGAATATTATA e TGACAATTAGGATTAAGAATATTATG e il comune primo AAAATTCCAAGTTTCAGTGTCACATA verso generare specifico 145- punto di ebollizione prodotti Il set di Y doppio pennarello alleles carried da un singolo individuale testamento essere rinvii verso come “the Y haplogroup.”

Del 718 campione, 717 caddi in haplogroups previsto sulla base di il saputo filogenetico, solo uno Sentiero campione (PKH134) essere insufficiente verso amplificare a il SRY –1532 e M17 luoghi. Egli fu assegnare verso haplogroup 3 sulla base di di alternativo SRY –1532 primo ( dettaglio a richiesta) e suo STR profilo.

Y-STR Battitura a macchina
Cinque trinucleotide- ripetizione polimorfismo (DYS388, DYS392, DYS425, DYS426, e DYS436), dieci tetranucleotide- ripetizione polimorfismo (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, e DYS439) e uno pentanucleotide microsatellite (DYS438) erano tipo in tutto Y cromosoma. Tre funzionamento in multiplex PCR reazione erano eseguire nonostante Y-STRs, in a10-µl finale reazione volume contenendo 20 ng Genova DNA, come descritto da qualche altra parte (Thomas et al. 1999; Ayub et al. 2000). PCR prodotti erano correre acceso un ABI 377 sequenza. ABIGS350 TAMRA fu usato come il interno carreggiata emblema. Il GENESI e GENOTIPO software pacco erano abituato a raccogliere il dati e verso analizzato frammento taglia Y-STR alleles erano nominato secondo il numero di ripetizione unitê essi contain.The numero di ripetizione unitê fu stabilito libero il uso di sequenza riferimento DNA campione. Allele lunghezza poich‚ DYS389b erano ottenere da sottrazione del DYS389II allele lunghezza da DYS389I.
Y-STR duplicazione erano trovato a diversi luoghi. DYS393 fu raddoppiato in PKH165 (13 e 15) e DYS437 fu raddoppiato in SDH181 (8 e 9). UN più complesso schema fu trovato in DYS425, dove due verso quattro alleles erano trovato in 36 individuale da haplogroups 8, 9, 13, e 21.

Dati Analisi
Principale- componenti analisi fu carried eliminato acceso haplogroup frequenze da uso del Vista ( visivo Statistica) sistema software, versione 5.0.2 (giovane e Interdetto 1996). Poich‚ grafico rappresentanza, il primo e secondo principale componenti erano periferica che permette di produrre grafici direttamente dai dati da il Microscala Ufficio Servit Eccellere Pacco acceso Finestra 2000. Biallelic polimorfismo dati poich‚ vario mondiale popolazione usato nel analisi erano ottenere da Martello et al. (2001). Mescolanza fu stimato da uso di tre diverso misura: Lungo peso il meno- quadrato (WLS) misura ( lungo 1991); signore, un il meno- quadrato estimatore (abito da cerimonia e Hiorns 1965); e m.? (Helgason et al. 2000).

Analisi di molecolare varibilitê (AMOVA) fu carried eliminato da uso del Arlequin pacco (Schneider et al. 1997). AMOVA misura il proporzione di mutazione divergenza trovato dentro e tra popolazione, rispettivamente. Sebbene molto del variazione a il rapido mutazione microsatellite luoghi ź previsto verso avere stato mostrare in il diverso Il pakistan subpopulations, il unico mutazione eventi a il doppio luoghi sei molto più vecchio e avere non caso nel contesto del suddivisione del Il pakistan popolazione. Noi lascito il seguendo strategia verso exploit il massimo quantitê di rilevante mutazione informazione da il Y- cromosoma haplotypes. STR variazione dentro haplogroups fu abituato a calcolare popolazione al paio FST valore poich‚ ciascuno individuale haplogroup. Poich‚ ciascuno popolazione paio, un peso cattivo FST fu calcolare, dove il valore ottenere poich‚ ciascuno haplogroup fu peso secondo il proporzione di al paio confronti coinvoluzione quello haplogroup. In assenza di di un particolare haplogroup da uno popolazione, Un, del paio UN e B, FST fu set verso 1, e il numero di al paio confronti fu possesso come il numero di cromosoma portare quello haplogroup in B. Valore di FST ignobile acceso STRs solo o acceso STRs di pi doppio pennarello, con doppio pennarello dato un 10- strato pi alto ponderazioni, erano calcolare poich‚ paragone. In tutto di questi analizzare, il distanza origine usato costituito del numero di passo da quale ciascuno paio di haplotypes differenza. Mensola del camino esame poich‚ il importanza di correlazione tra FST valore erano carried eliminato in Arlequin, e multidimensionale scalare (MDS) area erano costruire da uso del SPSS versione 7.0 software pacco.

Mezzi di comunicazione- unire rete erano costruire da Rete 2.0b ( gruppo et al. 1999). UN ponderazioni schema con un cinque volte intervallo fu usato nel costruzione del rete. Il peso assegnare erano specifico poich‚ ciascuno haplogroup e ha preso in conto il Y-STR variazione oltre il haplogroup in il intero Il pakistan popolazione. Il seguendo peso erano usato varibilitê 0-0.09, peso 5; varibilitê 0.1-0.19, peso 4; varibilitê 0.2-0.49, peso 3; varibilitê 0.5-0.99, peso di 2; e varibilitê 1.00, peso 1. Nonostante questo, il rete poich‚ haplogroup 1 contenitore molti alto dimensionale cubi e fu risolvere da applicare il ridotto mezzi di comunicazione e mezzi di comunicazione unire rete metodo sequentially. ridotto mezzi di comunicazione algoritmo (gruppo et al. 1995) fu abituato a generare un *.rmf schedario e il mezzi di comunicazione unire rete metodo fu applicato verso questo schedario.

BATWING (Wilson e Calvo 1998), Baies Analisi di Albero Con Interno Nodo Generazione, fu abituato a stimare il pausa al il pi recente comune antenato (TMRCA) di un set di cromosoma. Questo program usi un Segno catena Mese Carlo procedura verso generare filogenetico albero e associato parametro valore coerente con immissione dati ( un set di Y haplotypes) e genetico e demografico modello Il genetico modello assumere singolo- passo mutazione del STRs e il demografico modello scelto fu esponenzialmente crescita da un inizialmente costante- taglia popolazione, con o con all'esterno suddivisione in diverso funzionamenti del Tutto 16 STR luoghi erano usato; locusta- specifico mutazione quantitê precedente probabilitê ignobile sul dati di Kayser et al. (Kayser et al. 2000) erano costruire poich‚ il luoghi disponibile come raggio gamma distribuzione del forma raggio gamma(, b) dove un = (1 + numero di mutazione osservare da Kayser et al.), e b = (1 + numero di meiosi). Poich‚ luoghi non studi da Kayser et al., il distribuzione raggio gamma (1,416) fu usato, quale ha un cattivo di 0.0024. UN generazione pausa di 25 anni d'etê fu assumere. CosØ il 95% sicurezza intervallo dato tenere in conto incertezza in mutazione quantitê, popolazione crescita e ( dove appropiarsi) suddivisione, solo non generazione pausa.

Risultare

Y- Cromosoma Doppio Polimorfismo
Il 18 doppio pennarello usato identificare 20 haplogroups in universale popolazione fico 1A), solo solo 11 erano trovato in Il pakistan, e 5 conto poich‚ 92% del campione ( fico. 1 e da tavolo 2). Haplogroups 1 e 9 erano presente in tutto Il pakistan popolazione esaminato, haplogroup 3 fu presente in tutto perå il Gioco di dadi, e haplogroup 28 fu presente in tutto perå il Gioco di dadi e il Kashmiris. A sudovest popolazione mostrare pi alto frequenze di hg 9 e il Guaire+ haplogroups 21 e 8 di a nord-est popolazione (figs. 1D–E), solo, complessivo, piccolo geografico gruppo di haplogroup frequenze ź apparente dentro il campagna.

Principale- Componenti Analisi
Noi augurio verso comparare il Il pakistan Y haplogroup dati con dati da popolazione dal riposo del mondiale. Nessuno adatto dati set fu disponibile poich‚ il pieno set di 18 pennarello, solo il dati di Martello et al. (2001) permettere tutto eccetto 5 verso essere usato, perch‚ lo stesso o phylogenetically equivalente pennarello erano secondo quanto pubblicato. principale- componenti analisi fico 2A) mostrare alcuno di seconda classe per dal originale analisi di Martello et al., il principale uno essendo il affittuario separazione del Africano popolazione. Questo ź dovuto, verso un grande lunghezza, al sottoinsieme di pennarello usato, quale fa' non includere molti del Africa- specifico se stesso. Il pi Il pakistan popolazione gruppo con Sud Asia e Medio Orientale popolazione, e sei vicino verso Settentrionale Africano, Centrale Asia e Europeo popolazione, cosØ rappresentazioni un generale somiglianza con geograficamente vicino popolazione. Il uno eccezione ź il Gioco di dadi, chi sei piuttosto distinto. UN simile analisi del Il pakistan popolazione solo, usando tutto del doppio pennarello ( fico. 2B), incoraggiare il differenza tra il Gioco di dadi e il altro popolazione e anche più chiaramente mostrare il distinctness del Kalash e il Analizzi. Lo ź di spicco quello il lingua isolate–speaking Burusho e il Dravidian- parlare Brahuis fare non stare in piedi eliminato in questi analizzare.

Mescolanza Stimare
Ipotesi da ogni parte popolazione origine ( da tavolo 1) inscatolare essere considerare come quantitativo domanda da ogni parte mescolanza. Per esempio, verso esame il possibilitê quello il Baluch Y cromosoma avere un La Siria origine, noi inscatolare chiedere che proporzione del Baluch Ys sei derivare da La Siria e che proporzione sei da Il pakistan ( considerare verso essere il Il pakistan campione meno il Baluch). Dati acceso suggerire fonte popolazione erano possesso dal letteratura e tre misura di mescolanza erano calcolare. Il tre stimare diedi in generale coerente risultare, con piccolo sistematico di seconda classe per tipico m.? > signore > Lungo WLS poich‚ il stimato contributo dal esterno fonte popolazione ( da tavolo 3). Questi risultare provvedere prova poich‚ un esterno contributo al Gioco di dadi, Kalash, Negro Makrani, e Analizzi solo non al altro popolazione.

Y- Cromosoma STR Polimorfismo
Y-STR polimorfismo erano laboratorio di posa verso ottenere un più particolareggiato vista di Y variazione, tra il diverso Il pakistan etnico gruppo, quello vuole essere meno parziale da il pennarello- constatazione procedura Il diversitê di Y-STR haplotypes ( da tavolo 4) fu minimo poich‚ il Gioco di dadi (0.893) come suggerire da precedente analizzare (Ayub et al. 2000).
Il 16 Y-STRs definire 502 Y haplotypes, il vasto maggioranza essendo osservare in singolo individuale Il rimanente haplotypes erano porzione da 2–18 individuale ( dettaglio sei dato nel in linea- solo supplementare da tavolo). In tutto caso solo uno, il cromosoma compartecipazione un haplotype appartenere al stesso haplogroup ( in avanti, 503 combinazione haplotypes) e, in il pi caso, il individuale compartecipazione un haplotype appartenere al stesso popolazione (da tavolo 5).

Il GST e modale taglia del ripetizione unitê, nonostante 16 Y-STRs esaminato nel Il pakistan popolazione, sei dato in da tavolo 6. Il correlazione tra pennarello heterozygosity e GST fu trovato non verso essere importante (r0.329=; P=.213). Il modale taglia e varibilitê del 16 Y-STRs dentro haplogroups 1, 2, 3, 8, 9, 10, 21, 26, e 28 ź anche dato in da tavolo 6. Certo haplogroups avere un diverso modale allele taglia, e alcuno esempio di questo sei mostrare in neretto corsivo in da tavolo 6. Poich‚ esempio, DYS388 ha 15 ripetizione in haplogroup 9, comparare con 12 ripetizione in il pi del altro haplogroups in Il pakistan. Similmente, il modale allele poich‚ DYS438 ź 9 in haplogroup 9, solo 10 o 11 nel altro haplogroups. Il modale allele poich‚ DYS434 poich‚ haplogroup 10 ź 11, quale ź di spicco diverso dal allele taglia di questo locusta in altro haplogroups. Il completo mancanza di variability poich‚ DYS436 nel 233 maschio soggetto averi verso haplogroup 3 ź notevole. Haplogroup 10 apparire verso avere il il meno variability oltre il pi luoghi se non fosse che DYS390 ( da tavolo 6). Questi sentenza dimostrare il forte struttura di Y-STR variability da haplogroup.

Noi voluto verso calcolare un Y- ignobile misura di genetico distanza tra popolazione quello vuole riflettere il differenziazione quello avuto caso dentro Il pakistan e quello vuole non essere sproporzionatamente dominare da antico di seconda classe per quello avuto precedente accumulare tra haplogroups. Il emblema via verso fare questo sarei verso uso STR variazione, e da tavolo 7 ricapitola popolazione al paio valore di FST sul base di STR variazione solo ( un) o di doppio- pennarello di pi STR variazione (B), con doppio- pennarello di seconda classe per peso 10 pausa pi alto di STR di seconda classe per. Questi tabelle sei altamente mettere in correlazione (r0.95=; P.001<), come potrei essere previsto dal struttura di STR variazione da haplogroup. Comunque, questi misura sei importante influenza da antico di seconda classe per, e noi avere quindi sviluppato un modificato misura. Noi ragione quello molto del STR variazione dentro haplogroups vuole avere originato recentemente e potei essere usato poich‚ questo purpose.Nous avons calcolabileé donc valuta paio des valeurs de popolazione de FST, sur la ignobile du STR variazione dans des haplogroups, et utilisé une moyenne peseé de ces derniers versare mostrare une tabelle semplice de distanza de FST ( da tavolo 7C ; figue. 3) Questi distanze sei anche altamente mettere in correlazione con distanze ignobile acceso STRs solo (r0.76=; P.001<) o acceso STRs di pi doppio pennarello (r0.70=; P.001<), solo un pi grande proporzione del variazione ź visto tra popolazione (22%, comparare con 6% e 7%, rispettivamente). UN paragone di figura 3 con figura 2B ( quale fu ignobile acceso doppio pennarello frequenze solo) rivelare un di spicco complessivo somiglianza, con il Gioco di dadi essendo distinto da tutto del altro popolazione. Il altro di spicco popolazione sei il Kalash e Analizzi (come prima), il Kashmiris (forse a causa di il piccolo campione), e il Brahuis, chi sei cosØ più distinto in loro STR profilo di haplogroup frequenze. MDS area del distanze in cucchiaio da minestra 7A e 7B (non mostrare) guidare verso simile conclusioni, solo assomigliare figura 2B più strettamente in il via quello il Brahuis fare non stare in piedi eliminato cosØ molto.

Mezzi di comunicazione- Unire Rete
Il genetico relazione tra il diverso Il pakistan etnico gruppo erano esplorare ulteriore da disegno mezzi di comunicazione- unire rete ( gruppo et al. 1995), e esempio sei mostrare in figure 4, 5, e 6. Il haplogroup 1 rete fico 4) rivelare considerevole variazione, solo anche un alto grado di popolazione- specifico substructure. Per esempio, il 24 Analizzi haplogroup 1 cromosoma tutto cadere in uno di tre gruppi ( fico. 4, verde), 19 di 26 Burusho haplogroup 1 cromosoma cadere in due gruppi ( blu), e 12 di 14 Gioco di dadi haplogroup 1 cromosoma cadere in un singolo gruppo, e tutto di questi gruppi sei specifico verso loro rispettivo popolazione. Il haplogroup 10 rete fico 5) ź molto semplice, a causa di il minore numero di cromosoma, solo ancora rivelare popolazione- specifico gruppo poich‚ Burusho e Gioco di dadi haplotypes. Il haplogroup 28 rete ( fico. 6) mostrare un di spicco isolare Analizzi- specifico gruppo, in fondo a un lungo ramo, contenendo 15 di 16 Analizzi haplogroup 28 cromosoma. Gruppi di Kalash, Burusho, and—to un affittuario degree—Baluch cromosoma sei anche evidente, sebbene uno Baluch haplotype ź porzione con Sindhi e Makrani Baluch individuale da nelle vicinanze del sud popolazione.
BATWING TMRCAs erano calcolare poich‚ il haplogroup 28 rete e poich‚ selezionato lignaggio dentro un numero di haplogroups. Il risultare sei ricapitoli in da tavolo 8.

Discussione

Abbiamo carried eliminato il primo esteso analisi di Y diversitê dentro Il pakistan, esaminando 34 pennarello in 718 maschio soggetto da 12 popolazione Questo permettere ci verso comparare Il pakistan Y diversitê con quello precedente secondo quanto pubblicato in mondiale popolazione, verso studi di seconda classe per dentro Il pakistan, e verso valutare alcuno del suggerire popolazione dati storici da un Y prospettiva.

Confronti con Universale Dati
In un universale paragone, Il pakistan popolazione per la maggior parte gruppo in giro un biliardo Sud Asia campione e sdraiarsi vicino verso un Medio Orientale campione ( fico. 2A). Questo scoperta ź unsurprising, in parte perch‚ il Sud Asia campione incluso 62 Il pakistan individuale (i.e., 32% di 196 totale) e in parte perch‚ Y variazione in molti area del mondiale ź predominante struttura da geografia, non da lingua o etnico affiliazione (Rosser et al. 2000; Zerjal et al. 2001). Il pi grande genetico somiglianza di Il pakistan popolazione verso quelli nel ovest di verso orientale popolazione ź illustrare da il fatto quello quattro del cinque frequante haplogroups in Il pakistan (haplogroups 1, 2, 3, e 9, quale assieme trucco 79% del totale popolazione) sei anche frequante in ad ovest Asia e Europa solo non in Porcellane o Giappone; al contrario, il haplogroups quello sei frequante in Est Asia (e.g., 4, 5, 10, 13, e 20) sei raro o assente in Il pakistan, forma solo 2.5% del totale Se, come in alcuno interpretazione, un primo exodus da Africa lungo il del sud costa di Asia condotto al primo anatomicamente moderno umano popolazione in Il pakistan, e questi gente carried il orientale haplogroups o loro precursors, loro Y cromosoma avere presente stato largamente sostituire da successivo migrazione o gene fluire; certamente, il rappresentante del orientale haplogroups in Il pakistan Maggio essere derivare da moderno dietro- migrazione, non da antico sopravvissuto.

Il quinto haplogroup quello ź comune in Il pakistan, haplogroup 28, differire da tutto il altro in suo ) distribuzione. Dentro Il pakistan, lo fatto su 14% di nostro campione e fu presente in tutto eccetto due popolazione ( entrambi del quale avuto tutto piccolo campione taglia), cosØ è entrambi comune e diffuso Esterno Il pakistan e il nelle vicinanze paesi, comunque, è raro. Lo ha stato secondo quanto pubblicato in India (30%; presente in 3/3 popolazione), Tajikistan (10%; presente in 5/6 popolazione), e Uzbekistan (3%; presente in 10/13 popolazione), solo è raro in Russia (0.4%; presente in 1/6 popolazione) e il Caucaso (1.4%; presente in 1/6 popolazione (bene et al. 2001) e ha non stato trovato a tutto in Porcellane o Mongolo (unpublished osservazione BATWING stimare del TMRCA del Il pakistan haplogroup 28 cromosoma erano ~7,000 (4,000–14,000) anni d'etê ( da tavolo 8). CosØ, dentro questo pausa periodo, il Il pakistan popolazione avere diverso da un comune ancestrale popolazione o avere esperto considerevole maschio gene fluire tra loro stessi o da un comune fonte. Da allora il stimato etê corrispondere al primo Neolithic periodo, il diffusione di questo lignaggio potrei essere associato con il locale dilatazione di fattore.

Confronti dentro Il Pakistan
Haplogroup distribuzione in Il pakistan popolazione, ad eccezione di il Gioco di dadi ( discusso nel prossimo sezione), sei di spicco simile verso l'un l'altro (figs. 1 e 2), nonostante alcuno notevole linguisticamente di seconda classe per. Certamente, il lingua isolare- parlare Burusho, il Dravidian- parlare Brahuis, e il Sino-Tibetan–speaking Baltis did non stare in piedi eliminato dal altro popolazione a tutto nel haplogroup analizzare ( da tavolo 2 e fico. 2), suggerimento l'uno o l'altro quello il linguisticamente di seconda classe per sollevai dopo il comune Y schema fu stabilito o quello lØ ha stato sufficiente Y gene fluire tra popolazione verso eliminare qualsiasi iniziale di seconda classe per Ancora un più particolareggiato analisi del Y haplotypes (e.g., figs. 3–6) rivelare alcuno distinto tratti somatici del Brahui e considerevole popolazione specificità ; popolazione- specifico gruppi di correlare haplotypes sei comunemente trovato in questi rete Tale gruppi testamento solo essere visto se popolazione sei isolare da l'un l'altro. Lo Maggio essere quello un basso grado di gene fluire tra popolazione superiore un molto tempo ź sufficiente verso risultare in simile haplogroup frequenze con all'esterno produrre molti porzione gruppi.

Popolazione- specifico gruppi di haplotypes sei in particolare evidente in alcuno popolazione. Nel Gioco di dadi, dove il distinto haplogroup frequenze nota suddetto sei trovato, il pi cromosoma (19/23; 83%) cadere in uno di giusto due bene- isolare gruppi (figs. 4 e 5), mentre il Analizzi, il Kalash, e il Burusho anche mostrare rilevante gruppi. Il Gioco di dadi, Analizzi, e Kalash erano il tre popolazione rappresentazioni il il pi importante diverso popolazione al paio FST valore. Il alto valore del Gioco di dadi e Analizzi inscatolare parzialmente essere conto poich‚ da migrazione verso Il pakistan da altro piazza, solo un contribuire fattore ź probabile verso essere direzione, l'uno o l'altro dovuto verso un limitato numero di fondatore lignaggio o avvenimento successivo dentro piccolo popolazione. Tk valore (Ewens 1972) provvedere un via di confrontare effettivo popolazione taglia. Valore ignobile sul STRs poich‚ il Gioco di dadi, Analizzi, Kalash, e Burushos erano 8.9, 77.5, 25.8, e 74.2, rispettivamente, comparare con un cattivo di 181.8 poich‚ il altro popolazione con campione taglia >20. Effettivo popolazione taglia poich‚ Y cromosoma inscatolare differire grandemente da censimento popolazione taglia, solo è notevole quello il Analizzi e Kalash fare avere il minimo censimento taglia, uno- centesimo o uno- millesimo di il pi di quelli del altro popolazione (da tavolo 1), cosØ questi piccolo censimento taglia Maggio avere stato mantenere per molto tempo. In sommario, molti tratti somatici del presente Il pakistan Y haplotype distribuzione inscatolare essere conto poich‚ da un porzione ancestrale gene biliardo, con limitato gene fluire tra popolazione e direzione nel minore se stesso.

Perspicacia in Popolazione Origine
Il suggerire popolazione origine ( da tavolo 1) inscatolare presente essere considerare nel leggero di questi Y risultare. Informazione ź fornito da haplogroup frequenze, quale inscatolare essere abituato a mostrare mescolanza stimare, e questi sei facile verso interpretare se popolazione sei grande e isolare e il fonte popolazione avere diverso frequenze. Quando questi condizioni sei non venuto a contatto di, il presenza di distinto Y lignaggio inscatolare quieto essere educativo Il origine del Analizzi sei ben documentato (Nanavutty 1997) e cosØ provvedere un utile esame caso. Sono adepto del Iraniano profeta Zoroaster, chi migrare verso India dopo il crollo del Sassanian impero nel settimo secolo a.d. Essi sistemare in 900 a.d. in Il Goudjerate, India, dove essi erano visitatore il “Parsi” ( significativo “from Iran). Alla fine essi mossa verso Parlottare in India e Karachi in Il pakistan, da dove il presente popolazione fu campione ( fico. 7). Loro frequenze poich‚ haplogroups 3 (8%) e 9 (39%) fare certamente assomigliare quelli in Iran più di quelli di loro corrente neighbors in Il pakistan. Essi mostrare il minimo frequanza poich‚ haplogroup 3 in Il pakistan (a parte.. il Gioco di dadi; fico 1C). Il cattivo poich‚ otto Iraniano popolazione fu 14% (n401=) (Quintana-Murci et al. 2001), mentre quello poich‚ Il pakistan, escludendo il Analizzi, fu 36%. corrispondendo figure poich‚ haplogroup 9 erano 39% in il Analizzi, 40% in Iran, e 15% in Il pakistan escludendo il Analizzi. Questi figure guidare verso un mescolanza stimare di 100% da Iran ( da tavolo 3). Dato il piccolo effettivo popolazione taglia del Analizzi, il prossimità di loro incontro al Iraniano dati Maggio essere fortuito, e il presenza di haplogroup 28 cromosoma a 18% (4% in Iran; Bene et al. 2001) suggerire alcuno gene fluire dal vicinanze popolazione Il TMRCA poich‚ il Analizzi- specifico gruppo nel haplogroup 28 rete fu 1,800 (600–4,500) anni d'etê (da tavolo 8), coerente con il migrazione di un piccolo numero di lignaggio da Iran Complessivo, questi risultare dimostrare un vicino incontro tra il storico ricordi e il Y dati, e cosØ suggerire quello il Y dati testamento essere utile quando meno storico informazione ź disponibile.

Il popolazione questo è tutto genetically il pi distinto, il Gioco di dadi, reclamo lignaggio da Genghis Khan’s esercito; loro famoso ź derivare dal Persiano parola “hazar,” significativo “thousand,” perch‚ truppa erano sinistro dietro in distacco di un mille. Promettente il fine del diciannovesimo secolo, alcuno Gioco di dadi mossa da L'Afghanistan al Khurram Valle in Il pakistan, il fonte di il campione studi qui CosØ, loro orale storia identifica un origine in Mongolo e popolazione collo di bottiglia ~800 e ~100 anni d'etê passato. Del due predominante Y haplogroups presente in questo popolazione, haplogroup 1 ź diffuso in Il pakistan, molto di Asia, Europa, e il L'america, e cosØ provvedere piccolo informazione da ogni parte il piazza di origine. Haplogroup 10, in contrastare, ź raro in il pi Il pakistan popolazione (1.4%, quando il Gioco di dadi sei escluso) solo ź comune in Est Asia, includere Mongolo, dove lo espediente temporaneo su superiore mezzo del popolazione (unpublished risultare). Mescolanza stimare ( da tavolo 3) sei coerente con un sostanziale contributo da Mongolo. BATWING analisi del Gioco di dadi- specifico haplotype gruppi in haplogroups 1 e 10 suggerire TMRCAs di 400 (120–1,200) e 100 (6–600) anni d'etê ( da tavolo 8), rispettivamente CosØ, il genetico prova ź coerente con il orale tradizione e, in vista di suo ) indipendente natura, provvedere forte sostegno poich‚ lo ( fico. 7).

Alcuno altro suggerire origine ricevere più limitato sostegno dal Y dati. Il Negro Makrani, con un postulato origine in Africa, portare il il pi alto frequanza di haplogroup 8 cromosoma trovato in qualsiasi Il pakistan popolazione, come nota da qualche altra parte (Qamar et al. 1999). Questo haplogroup ź largamente confinare verso sotto- Sahariano Africa, dove lo costituire da ogni parte mezzo del popolazione (martello et al. 2001) e inscatolare cosØ essere riguardare come un pennarello di Africano Y cromosoma. Cionondimeno, lo espediente temporaneo su solo 9% del Negro Makrani campione, e haplogroup 28 (lungo con altro tipico Il pakistan haplogroups) ź presente in questo popolazione. Se il Y cromosoma erano inizialmente Africano ( fico. 7), il pi avere successivo stato sostituire: il complessivo stimare del Africano contributo ź ~12% ( da tavolo 3).

Il Balti sei pensiero verso avere originato in Il Tibet, dove il predominante haplogroups sei 4 e 26. Né l'uno fu presente nel campione da questo studio, fornire nessuno sostegno poich‚ un Il Tibet origine del Y cromosoma lignaggio e un mescolanza stimare di zero ( da tavolo 3). Comunque, questo risultare dovere essere inteprete con prudenza, a causa di il piccolo campione taglia. Tre popolazione avere possibile origine dal armies di Alessandria il Grande: il Burusho, il Kalash, e il Sentiero. Moderno Greco mostrare un moderato alto frequanza di haplogroup 21 (28%; Rosser et al. 2000), solo questo haplogroup fu non visto in l'uno o l'altro il Burusho o il Kalash campione e fu trovato in solo 2% di il Sentiero, mentre il locale haplogroup 28 fu presente a 17%, 25%, e 13%, rispettivamente. Greco- mescolanza stimare di 0% erano ottenere poich‚ il Burusho e il Sentiero, solo figure di 20–40%% erano osservare poich‚ il Kalash ( da tavolo 3). In vista del assenza di haplogroup 21, noi ascrivere questo risultare l'uno o l'altro verso direzione nel frequenze del altro haplogroups, in particolare haplogroups 2 e 1, o al povero risoluzione di lignaggio dentro questi haplogroups, risultare in distinto lignaggio essendo classificato in lo stesso paraphyletic haplogroups. Complessivo, nessuno sostegno poich‚ un Greco origine di loro Y cromosoma fu trovato, solo questo conclusione fa' esigere il assunzione quello moderno Greco sei rappresentante di Alexander’s armies. Due popolazione, il Kashmiris e il Sentiero, anche buttare a terra reclamo verso un possibile Ebreo origine Ebreo popolazione comunemente avere un moderato frequanza di haplogroup 21 (e.g., 20%) e un alto frequanza di haplogroup 9 (e.g., 36%; (martello et al. 2000). Il frequenze di entrambi di questi haplogroups sei basso nel Kashmiris e Sentiero, e haplogroup 28 ź presente a 13% in il Sentiero, cosØ nessuno sostegno poich‚ un Ebreo origine ź trovato, e il mescolanza stimare fu 0% ( da tavolo 3), sebbene, ancora, questo conclusione ź limitato entrambi da il piccolo campione taglia disponibile da Kashmir e da il assunzione quello il moderno campione sei rappresentante di antico popolazione.

Il suggerire origine del Baluch ź in La Siria. La Siria, simile Iraniani, sei caratterizzare da un basso frequanza di haplogroup 3 e un alto frequanza di haplogroup 9 (9% e 57%, rispettivamente; Martello et al. 2000), mentre il corrispondendo frequenze nel Baluch sei 29% e 12%. Questo differenza e il alto frequanza di haplogroup 28 nel Baluch (29%) fare un predominante La Siria origine poich‚ loro Y cromosoma improbabile, e il mescolanza stimare fu 0% (da tavolo 3), sebbene il 8% frequanza poich‚ haplogroup 21, il il pi alto identificato in Il pakistan cosØ lontano, fa' indicare alcuno ad ovest contributo verso loro Y lignaggio. Brahuis avere un possibile origine in Ovest Asia (Hughes- Pallottola 1991) e lo ha stato suggerire quello un diffusione di haplogroup 9 Y cromosoma fu associato con il dilatazione di Dravidian- parlare fattore (Quintana-Murci et al. 2001). Brahuis avere il il pi alto frequanza di haplogroup 9 cromosoma in Il pakistan (28%) dopo il Analizzi, fornire alcuno sostegno poich‚ questo ipotesi, solo loro pi alto frequanza di haplogroup 3 (39%) ź non tipico del Fertile Croissant (Quintana-Murci et al. 2001) e suggerire un più complesso origine, probabilmente con mescolanza da posteriore migrazione, cosØ quelli di Indo- Iraniano telecronista dal steppa di Centrale Asia e altro da ulteriore est Questo possibilitê ź sostenitore da il rilevazione di basso frequenze di haplogroups 10, 12, e 13 nel Brahuis, tutto raro in Il pakistan e tipico di Est Asia, Est e settentrionale Asia, e Sud-est Asia, rispettivamente.

Il fallimento verso trovare un lavoro Y maglia con un suggerire popolazione di origine fa' non confutare un storico associazione, solo lo fa' dimostrare quello il Y cromosoma derivare da tale storico eventi avere stato perso o sostituire. Analizzare di mitocondriale DNA e altro luoghi vuole aiuto verso elucidare il popolazione dati storici e sarei in particolare interessante in popolazione simile il Negro Makrani e il Balti, in quale c'ź un contrastare tra il fenotipo e il tipico Il pakistan Y haplotypes.

Riconoscimento

Questo lavoro fu sostenitore da un Wellcome Fiducia Di collaborazione Ricerca Iniziativa Concessione verso S.Q.M. T.Z. fu anche sostenitore da Il Wellcome Fiducia, e C.T.-S. da il Cancro Ricerca Campagna. Noi espresso nostro apprezzamento al originale DNA donatori chi fatto questo studio possibile. Il Dipartimento di Salute del Governo di Baluchistan e il Baluch Studente Federazione, Quetta, Il pakistan, assistere nel collezione del Brahui e Baluch campione. Sentiero campione erano adunato con il assistenza del Dipartimento di Pediatrico, Signora Lettura Posta Laureato Medico Ospedale, Peshawar, il pakistan Siamo anche grato verso Dott. io Kazmi e il Aga Khan Fondamenta Rurale Salute Sostegno Program poich‚ loro assistenza nel collezione di Burusho campione. Dott F. Sethna fornito di valore assistenza nel collezione del Analizzi campione. Noi grazie Luis Quintana-Murci poich‚ suo commenti sul manoscritto.

Elettronico- Database Informazione

URLs poich‚ dati in questo articolo sei come seguire:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Rete 2.0, http:/www.fluxus-engineering.com/.
/ Vista, http:/forrest.psych.unc.edu/.

Riferimento

Ahmad AKN (1952) Jesus in paradiso mai. Il Civile e Militare Gazzetta Srl, Lahore, Il pakistan.
Ayub Q, Mohyuddin Un, Qamar R, Mazhar K, Zerjal T, Mehdi Quadrato, Tyler- Distruggere C (2000) Identificazione e descrizione di romanzo umano Y- cromosomico microsatellites da sequenza database informazione. Nucleare Acido Ricerca 28e8: [ libero Pieno testo in PMC].
Nuoto sul dorso PC (1992) Balti. in Nuoto sul dorso PC, Radloff CF (eds) Sociolinguistic esame di settentrionale Il pakistan. Volume 2, Lingua di settentrionale area Nazionale Istituto di Il pakistan Laboratorio di posa, Islamabad, pp 3–27.
Gruppo HJ, Smettere P, Rohl UN (1999) Mezzi di comunicazione- unire rete poich‚ arguire intraspecific filogenetico Mol Biologico Evol 1637–48: [PubMed] [ libero Pieno Testo].
Gruppo HJ, Smettere P, Sykes BC, Richards MB (1995) Mitocondriale ritratto di umano popolazione usando mezzi di comunicazione rete. Genetica 141743–753: [PubMed] [ libero Pieno Testo].
Campana HW (1979) Il razza di L'Afghanistan. Cantai-e-Meel Pubblicazioni, Lahore, Il pakistan.
Campana HW (1998) Un investigazione in il ethnography di l'Afghanistan Avanguardia Conti, Lahore, Il pakistan.
Bergamotto AW, Wang C-Y, Tsai J, Jefferson K, Dey C, Distruggere KD, Parco S-C, Tsai S-J, Oro D (1999) Un Asian–Native Americano paterno lignaggio identificato da RPS4Y resequencing e da microsatellite haplotyping. Ann Ronzare Genetico 6363–80: [PubMed] [pieno Testo].
Biennale Nessuno, Bailliet G, Spavalderia Centimetro, Carneficina RF, Rothhammer F, Disciplina rigida- Tagete VL, Penale DEVIAZIONE STANDARD (1997) Origine di Amerindian Y- cromosoma come dedotto da il analisi di sei polimorfico pennarello. Di mattina J Medicina Antropoide 10279–89: [PubMed] [ pieno Testo].
Biddulph J (1977) Trub del Posteriore Koosh. Indus Pubblicazioni, Karachi, Il pakistan.
Burton RF (1851) Sindh e il razza quello abitare il valle del Indus. WH Allen e Co Srl, Londra.
Canzoncina di Natale O (1958) Il Sentiero. Scarpa da uomo classica con lacci Universitê Premere, Karachi, Il pakistan.
Casanova M., Leroy P, Boucekkine C, Weissenbach J, Vescovo C, Tipo M., Purrello M., Fiori G, Siniscalco M. (1985) UN umano Y- maglia DNA polimorfismo e suo ) potenziale poich‚ stimando genetico e evoluzione distanza Scienza 2301403–1406: [PubMed].
Gaio-Sforza LL, Menozzi P, Piazza UN (1994) Il storia e geografia di umano genesi. Principe Universitê Premere, Principe.
Valle GF (1991) Il fenomeno del Indus civiltà. in Jansen M., Muggine M., Urbano G (eds) Dimenticato cities sul Indus: primo civiltà in Il pakistan dal ottavo al secondo millenni BC. Verlag Filippino von Zabern, Principale, Germania, pp 129–144.
Ponte KD (1992) Sociolinguistic esame di Settentrionale Il pakistan. Volume 5, Lingua di Biglietto. Nazionale Istituto di Il pakistan Laboratorio di posa, Islamabad.
Ewens WJ (1972) Il campione teoria di selettivo neutrale alleles. Teoremi Massa Biologico 387–112: [PubMed].
Lordura BF (1992) Etnologia: lingua del mondiale. Estate Istituto di Linguistica, Civettare.
Martello MF (1994) UN recente inserzioni di un Alu elemento sul Y cromosoma ź un utile pennarello poich‚ umano popolazione laboratorio di posa. Mol Biologico Evol 11749–761: [PubMed] [libero Pieno Testo].
Martello MF, Horai S (1995) Y cromosomico DNA variazione e il gente di Giappone. Di mattina J Ronzare Genetico 56951–962: [PubMed].
Martello MF, Karafet TM, Arrossarsi AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Gerarchico schema di globale umano Y- cromosoma diversitê Mol Biologico Evol 181189–1203: [PubMed] [ libero Pieno Testo].
Martello MF, Arrossarsi AJ, A legna ET, Cuffia Signore, Jarjanazi H, Karafet T, Santachiara-Benerecetti S, Oppenheim Un, Disoccupato Madre, Jenkins T, Struzzo H, Cuffia- Addomesticare B (2000) Ebreo e Medio Orientale non-ebreo popolazione porzione un comune biliardo di Y- cromosoma biallelic haplotypes. Proc Natl Accademia Sci GLI S.U.A. 976769–6774: [ libero Pieno testo in PMC].
Helgason Un, Sigurdardottir S, Nicholson J, Sykes B, Collina EW, Bradley DG, La Bosnia V, Gulcher JR, Sotto osservazione R, Stefansson K (2000) Stimando Scandinavo e Gaelico ascendenza nel maschio colone di Islanda. Di mattina J Ronzare Genetico 67697–717: [PubMed] [ libero Pieno Testo].
Hughes- Pallottola R (1991) Imperiale gazzetta di India: provinciale serie, Baluchistan. Cantai-e-Meel, Lahore, Il pakistan.
Ussaro J (1997) UN storia del gente di Il pakistan promettente indipendenza. Scarpa da uomo classica con lacci Universitê Premere, Karachi, Il pakistan.
Ibbetson D (1883) Panjab casta Cantai-e-Meel, Lahore, Il pakistan.
Stonatura JF (1991) Mehrgarh: suo ) piazza nel sviluppo di antico cultura in Il pakistan. in Jansen M., Muggine M., Urbano G (eds) Dimenticato cities sul Indus: primo civiltà in Il pakistan dal ottavo al secondo millenni BC. Verlag Filippino von Zabern, Principale, Germania, pp 34–50.
Disoccupato Madre, Tyler- Distruggere C (2000) Nuovo usi poich‚ nuovo haplotypes: il umano Y cromosoma, malattia e selezione Corrente Genetico 16356–362: [PubMed] [ pieno Testo].
Karafet TM, Zegura SL, Posukh O, Osipova L, Bergamotto Un, Lungo J, Oro D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffiths RC, Tempio AR, Martello MF (1999) Ancestrale Asia fonte() di nuovo mondo Y- cromosoma fondatore haplotypes. Di mattina J Ronzare Genetico 64817–831: [PubMed] [libero Pieno Testo].
Kayser M., Roewer L, Hedman M., Henke L, Henke J, Brauer S, Kruger C, Krawczak M., Nagy M., Dobosz T, Szibor R, de Knijff P, Stoneking M., Sajantila UN (2000) Carattaristice e frequanza di germline mutazione a microsatellite luoghi dal umano Y cromosoma, come rivelare da diretto osservazione in padre/ figlio paio. Di mattina J Ronzare Genetico 661580–1588: [PubMed] [ libero Pieno Testo].
Kwok C, Tyler- Distruggere C, Mendonca BB, Hughes Io, Berkovitz GD, Goodfellow PN, Falco JR (1996) Mutazione analisi del 2 kb 5' verso SRY in XY femmina e XY intersechi soggetto J Med Genetico 33465–468: [PubMed].
Lungo JC (1991) Il genetico struttura di mescoli popolazione. Genetica 127417–428: [PubMed] [libero Pieno Testo].
Matematica N, Baies M., Tyler- Distruggere C (1994) Altamente educativo composto haplotypes poich‚ il umano Y cromosoma. Ronzare Mol Genetico 3115–123: [PubMed].
Mehdi Quadrato, Qamar R, Ayub Q, Kaliq S, Equipaggia Un, Ismail M., Martello MF, Da basso Papê, Gaio-Sforza LL (1999) Il origine di Il pakistan popolazione prova da Y cromosoma pennarello. in Più papier SS, Deka R, Chakraborty R (eds) Genova diversitê: applicazione in umano popolazione genetica Kluwer Accademico/ Assemblea plenaria Editore, Nuovo York, pp 83–90.
Mohyuddin Un, Ayub Q, Qamar R, Zerjal T, Helgason Un, Mehdi Quadrato, Tyler- Distruggere C (2001) Y- cromosomico STR haplotypes in Il pakistan popolazione Forense Sci Interno 118141–146: [PubMed] [pieno Testo].
Nanavutty P (1997) Il Analizzi. Nazionale Secondo i testi Fiducia, Nuovo Delhi, India.
Pandya Un, Re TE, Sant ' Franco, Sarto Pagina, Thangaraj K, Cantare L, Disoccupato Madre, Tyler- Distruggere C (1998) UN polimorfico umano Y- cromosomico G verso UN transizione trovato in India. Ind J Ronzare Genetico 452–61:.
Qamar R, Ayub Q, Khaliq S, Equipaggia Un, Karafet T, Mehdi Quadrato, Martello MF (1999) Africano e Levantine origine di Il pakistan Guaire+ Y cromosoma. Ronzare Biologico 71745–755: [PubMed].
Quddus SA (1990) Il tribale Baluchistan. Ferozsons (Pvt) Srl, Lahore, Il pakistan.
Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, Martello MF, Mehdi Quadrato, Ayub Q, Qamar R, Mohyuddin Un, Radhakrishna U, Disoccupato Madre, Tyler- Distruggere C, McElreavey K (2001) Y- cromosoma lignaggio traccia diffusione di gente e lingua in a sudovest Asia. Di mattina J Ronzare Genetico 68537–542: [PubMed] [libero Pieno Testo].
Abito da cerimonia DF, Hiorns R (1965) Metodo di analisi del genetico composizione di un ibrido popolazione. Ronzare Biologico 3738–43:.
Robertson GS (1896) Il Kafirs del Ind-Kush. Scarpa da uomo classica con lacci Universitê Premere, Karachi, Il pakistan.
Rosser ZH, Zerjal T, Lanciato con violenza Me, Adojaan M., Alavantic D, Amorale Un, AMO W, et al (2000) Y- cromosomico diversitê in Europa ź ripiegare e influenza soprattutto da geografia, piuttosto che da lingua. Di mattina J Ronzare Genetico 671526–1543: [PubMed] [ libero Pieno Testo].
Sant ' Franco, Carvalho- D'argento Dott, Penale SDJ (1999a) PCR- ignobile DNA delineamento di umano Y cromosoma in Epplen JT, Lubjuhn T (eds) Metodo e strumento in biosciences e medicina. Birkhauser Verlag, Linea di base, Svizzera, pp 133–152.
Sant ' Franco, Pandya Un, Kayser M., Mitchell RJ, Liu Un, Cantare L, Distruggere- Bisonte G, Novelletto Un, Qamar R, Mehdi Quadrato, Adhikari R, Knijff P, Tyler- Distruggere C (2000) UN polimorfico L1 retroposon inserzioni in il centromero del umano Y cromosoma. Ronzare Mol Genetico 9421–430: [PubMed] [ libero Pieno Testo].
Sant ' Franco, Pandya Un, Tyler- Distruggere C, Penale Deviazione standard, Schanfield M., Leonard WR, Osipova L, Gamberi MH, Mitchell RJ (1999b) Il centrale La Siberia origine poich‚ nativo Americano Y cromosoma. Di mattina J Ronzare Genetico 64619–628: [PubMed] [ libero Pieno Testo].
Schneider S, Kueffer J- M., Roessli D, Excoffier L (1997) Arlequin ver 1.1: un software poich‚ popolazione genetico dati analisi Genetica e Biometria Laboratorio, Universitê di Ginevra, Svizzera.
Seielstad MT, Hebert JM, Lin AA, Da basso Papê, Ibrahim M., Vollrath D, Gaio-Sforza LL (1994) Costruzione di umano Y- cromosomico haplotypes usando un nuovo polimorfico UN verso G transizione. Ronzare Mol Genetico 32159–1261: [PubMed].
Stinco T, Tomita K, Oggi T, Kotliarova SE, Protezione J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genetico variazione sul Y cromosoma nel Giapponese popolazione e implicazione poich‚ moderno umano Y cromosoma lignaggio. J Ronzare Genetico 44240–245: [PubMed].
Thomas Magnesio, Bradman N, Tirarsi indietro HM (1999) Alto libero analisi di 10 microsatellite e 11 composto polimorfismo sul umano Y- cromosoma. Ronzare Genetico 105577–581: [PubMed] [pieno Testo].
Tyler- Distruggere C (1999) Y- cromosomico DNA pennarello. in Più papier SS, Deka R, Chakraborty R (eds) Genova diversitê: applicazione in umano popolazione genetica Kluwer Accademico/ Assemblea plenaria Editore, Nuovo York, pp 65–73.
Da basso Papê, Jin L, Lin AA, Mehdi Quadrato, Jenkins T, Vollrath D, David RW, Gaio-Sforza LL, Oefner PJ (1997) Rilevazione di numeroso Y cromosoma biallelic polimorfismo da denaturing ad alto rendimento liquido cromatografia. Genova Ricerca 7996–1005: [PubMed] [libero Pieno Testo].
Bene RS, Yuldasheva N, Ruzibakiev R, Da basso Papê, Evseeva Io, Blu- Distruggere J, Jin L, et al (2001) Il Eurasian duro: un continentale prospettiva acceso Y- cromosoma diversitê Proc Natl Accademia Sci GLI S.U.A. 9810244–10249: [ libero Pieno testo in PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Sequenza variazione del umano Y cromosoma Natura 378379–380: [PubMed] [ pieno Testo].
Wilson IJ, Calvo DJ (1998) Genealogico deduzione da microsatellite dati. Genetica 150499–510: [PubMed] [ libero Pieno Testo].
Wolpert S (2000) UN nuovo storia di India. Scarpa da uomo classica con lacci Universitê Premere, NewYorkese.
Giovane FW, Interdetto CENTIMETRO (1996) UN visivo statistica sistema. in Pungiglione RA, Volpe J (eds) Statistico computazione ambienti poich‚ sociale ricercatore. Saggio Pubblicazioni, NewYorkese, pp 207–236.
Zerjal T, Gesto di richiamo L, Gesto di richiamo G, Mikelsaar Avoirdupois, Krumina Un, Kucinskas V, Lanciato con violenza Me, Tyler- Distruggere C (2001) Geografico, linguisticamente, e culturale influenza acceso genetico diversitê: Y- cromosomico distribuzione in Settentrionale Europeo popolazione. Mol Biologico Evol 181077–1087: [PubMed] [ libero Pieno Testo].
Zerjal T, Dashnyam B, Pandya Un, Kayser M., Roewer L, Sant ' Franco, Schiefenhovel W, Fretwell N, Disoccupato Madre, Harihara S, Luccicare K, Semjidmaa D, Sajantila Un, Salone P, Gamberi MH, Ginter EK, Evgrafov OV, Tyler- Distruggere C (1997) Genetico relazione di Asia e Settentrionale Europei, rivelare da Y- cromosomico DNA analisi. Di mattina J Ronzare Genetico 601174–1183: [PubMed].

 

 

 

 


  Ultimo della pagina aggiornato: Saturday, February 04, 2006 17:23:19 -0500