|
Chromosomal DNA απόκλιση μέσα Πακιστάν
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 χριστιανόs Tyler-Smith,2 και S. Qasim Mehdi1
1Biomedical και Genetic μηχανική διαίρεση, Dr. έναs Q. Khan έρευνα εργαστήριο, Islamabad; 2Cancer έρευνα Campaign, Chromosome μοριακός βιολογία σύνολο, τμήμα του βιοχημεία, και 3Institute του βιοχημικός Anthropology, πανεπιστήμιο του Oxford, Oxford, ενωμένος βασίλειο; και αποκρυπτογραφώ Genetics, Reykjavik.
αφαιρώ
δεκαοκτώ δυαδικός polymorphisms και 16 multiallelic, κοντός-tandem- επαναλαμβάνω (STR) loci από το nonrecombining μερίδα του human Y chromosome λυκάνθρωπος δακτυλογραφώ μέσα 718 αρσενικό θέμα υπάρχοντα σε 12 ethnic σύνολο του Πακιστάν. αυτοί αναγνώρισα 11 stable haplogroups και 503 συνδυασμόs δυαδικός μαρκαδόρος/STR haplotypes. Haplogroup συχνότητα λυκάνθρωπος γενικός όμοιος σε εκείνοι μέσα γείτονας γεωγραφικός περιοχή, και the Πακιστάν πληθυσμός μιλώ έναs γλώσσα απομονωμένος (the Burushos), έναs Dravidian γλώσσα (the Brahui), ή έναs Sino- Θιβέτ γλώσσα (the Βαλτική) έμοιασα the Indo-European–speaking majority. παρ'όλα αυτά, μεσαιωνικός- ενώνω δίκτυο του haplotypes αποκάλυψα σκέψη substructuring του Y απόκλιση με Πακιστάν, με πολλοί πληθυσμός δείχνω ξεχωριστός όμιλος του haplotypes. αυτοί πρότυπο μπορώ να είμαι λογαριασμός για από έναs κοινός pool του Y lineages, με substantial απομονωμένος ανάμεσα πληθυσμός και drift μέσα στο μικρότερο ones. λίγο comparative genetic ή ιστορικός δεδομένα είναι διαθέσιμος για most πληθυσμός, μα the αποτέλεσμα μπορώ να είμαι συμπαγέs με oral παράδοση για προέρχομαι The Y δεδομένα υποστηρίζω the καλά- ίδρυσα προέρχομαι του μαϊντανός μέσα Iran, the πρότεινα κάθοδος του κίνδυνοs από Genghis Khan’s στρατόs, και the προέρχομαι του the Νέγροs Makrani μέσα Αφρική, μα κάνω όχι υποστηρίζω παράδοση του Θιβέτ, Συρία, Ελληνικός, ή Εβραίοs προέρχομαι για άλλος πληθυσμός.
εισαγωγή
The νωρίτερα απόδειξη του Paleolithic human παρουσία μέσα στο νότοs Ασία θεωρώ του πέτρα εφαρμόζω βρήκα σκόρπισα τριγύρω the Soan ποτάμι κοιλάδα μέσα Βορειοανατολικά Πακιστάν (Hussain 1997). απελπίζομαι the έλλειψη από απολίθωμα απόδειξη, αυτοί εργαλεία εμφανίζομαι δείχνω the παρουσία του hominids μέσα στο νότοs Ασία όπως νωρίs όπως 200,000–400,000 χρόνια πριν (Wolpert 2000) και ούτως είναι πιθανό έχω been συσχέτισα με αρχαϊκός Homo είδος. Πακιστάν lies επάνω σε postulated Νοτιοανατολικό ακτή ρουτίνα ακολούθησα από ανατομικά μοντέρνος Homo Sapiens έξω του Αφρική, και so μπορώ έχω been κατοίκησα από μοντέρνος humans όπως νωρίs όπως 60,000–70,000 χρόνια πριν. υπάρχει απόδειξη του καταρρέω κάτοικοι μέσα Πακιστάν Βορειοδυτικά σύνορο, μα απολίθωμα απόδειξη από το Paleolithic έχει been αποσπασματικός (Hussain 1997). απόδειξη έχει been αποκαλυμμένος σε Mehrghar, μέσα Νοτιοδυτικό Πακιστάν, ένδειξη Neolithic settlements από όπως πολύ παλιά όπως 7,000 b.c. (Jarrige 1991), ο οποίος λυκάνθρωπος ακολούθησα με το παρακινώ κοιλάδα πολιτισμός ( συμπεριλαμβανομένου the πολίτηs του Harappa και Mohenjodaro) ότι άνθησα μέσα στο 3d και 2d χιλιετία b.c. (Dales 1991). τριγύρω 1500 b.c., the Indo-European–speaking νομάδας ιερατικόs φυλές από περισσότερο north—often κάλεσα the Aryans—crossed the Karakorum βουνά into the νότοs Ασία. επόμενος ιστορικά γεγονότα συμπεριλαμβάνω the εισβολή του Alexander the σπουδαίος (327–325 b.c.) και the Άραβας και Muslim conquest από 711 a.d. προς τα εμπρός (Wolpert 2000).
The παρουσία πληθυσμός του Πακιστάν θεωρώ του περισσότερο από 160 εκατομμύριο άτομα ( σύμφωνα σε 2005 ποιόs νούμερο) ποιόs υπάρχοντα σε τουλάχιστον 18 ethnic σύνολο και μιλώ περισσότερο από 60 γλώσσα ( λέρωμα 1992). Most του αυτοί γλώσσα είναι Indo- Ευρώπη, μα αυτοί επίσηs συμπεριλαμβάνω έναs απομονωμένος, Burushaski; έναs Dravidian γλώσσα, Brahui; και έναs Sino- Θιβέτ γλώσσα, Βαλτική. Punjabi- μιλώ άτομα μορφή the majority πληθυσμός του Πακιστάν, μα αυτοί εκπροσοπώ έναs ολοκληρώνω μίγμα του ethnic σύνολο (Ibbetson 1883) και είναι όχι ανέλυσα εδώ; 12 ethnic σύνολο είναι συμπεριλαμβανόμενος μέσα στο παρουσία έρευνα. πληροφορία διαθέσιμος για αυτούς is summarized μέσα τραπέζι 1, μαζί με hypotheses για δικό τουs προέρχομαι (Mehdi et al. 1999). παρ΄ όλο που μερικά του αυτοί hypotheses είναι καλά- υποστήριξα (e.g., the προέρχομαι του μαϊντανός μέσα Iran), most είναι βάση επάνω oral παράδοση και έχω όχι been δοκίμασα εναντίον άλλος πηγές του απόδειξη.
εξετάζω genetic δεδομένα είναι διαθέσιμος για αυτοί Πακιστάν ethnic σύνολο νωρίs μελέτησα του the ABO αίμα σύνολο και κλασικός προστατεύω μαρκαδόρος έκανα όχι συμπεριλαμβάνω όλος σύνολο και mostly ταξινομημένος αυτούς σύμφωνα με δικό τουs γλώσσα του διαμονή. έναs πληθυσμός δέντρο βάση επάνω 54 κλασικός ένζυμο μαρκαδόρος γλώσσα the κίνδυνοs και παθητικός μέσα στο δύση Ασία όμιλος περιέχω the Βορειοανατολικά Caucasoids (ιππικό-Sforza et al. 1994). μέσα another πληθυσμός δέντρο, βάση επάνω 47 κλασικός προστατεύω polymorphisms, the Πακιστάν δείγμα μορφή έναs μικρό subcluster με the Indo- Ευρώπη ομιλητής από Ινδία ( ιππικό-Sforza et al. 1994).
The Y chromosome προμηθεύω έναs μοναδικός πηγή του genetic απόδειξη (Tyler-Smith 1999; άνεργος και Tyler-Smith 2000). αυτό μετέφερα the μεγάλος nonrecombining segment μέσα the genome και περιέχω πολυάριθμος stable δυαδικός μαρκαδόρος, συμπεριλαμβανομένου βάση αντικατάσταση (βλέπω, e.g., Underhill et al. 1997) και retroposon insertions ( σφυρί 1994; Σαντορίνη et al. 2000), ο οποίος μπορώ να είμαι μεταχειρισμένος μέσα συνδυασμόs με περισσότερο- βιαστής evolving μαρκαδόρος, όπως microsatellites (βλέπω, e.g., Ayub et al. 2000). Consequently, πολύ λεπτομέρεια Y phylogenies μπορώ να είμαι constructed ότι επιτρέπω αρσενικό- ειδικός aspects του genetic ιστορία σε να είμαι investigated. αυτοί είναι δυνατός επιρροή με το μικρό αποτελεσματικόs πληθυσμός μέγεθος του Y chromosome, καθοδηγώ σε βιαστής genetic drift, και με το εξασκώ του patrilocality μέσα πολλοί κοινωνίες, καθοδηγώ σε ψηλός επίπεδο του γεωγραφικός διαφοροποίηση του Y haplotypes. μολονότι the καλλιτέχνημα Qamar et al. (1999) επάνω σε ανάλυση του YAP+ chromosomes (comprising ~2.6% του σύνολο) και αναλύω του STR απόκλιση (Ayub et al. 2000; Mohyuddin et al. 2001), μικρή ποσότητα δουλειά έχει been τελείωσα επάνω Πακιστάν Y chromosomes. επομένως, έχουμε τώρα performed έναs εκτεταμένος ανάλυση του Πακιστάν Y lineages, σε καθορίζω what ελαφρύς αυτοί μπορώ shed επάνω σε προέρχομαι και genetic ιστορία του υποομάδα ότι επινοώ the Πακιστάν πληθυσμός.
Material και μεθανόλη
δείγμα
The Y chromosomes του 718 unrelated αρσενικό θέμα, υπάρχοντα σε 12 ethnic σύνολο του Πακιστάν, λυκάνθρωπος ανέλυσα (τραπέζι 1 και 2; συκιά. 1). πληροφορημένος consent was απόκτησα από όλος participants μέσα this μελετώ. έναs Epstein στρατώνες virus–transformed lymphoblastoid cell ουρά was ίδρυσα από καθένας ατομικός, και DNA was εκχύλισμα από αυτοί cell τιμωρία σε μαθητές να γράφουν το ίδιο πολλές φορές για ανάλυση.
δυαδικός Polymorphism χαρακτηριστικός
εμείs δακτυλογραφώ 15 SNPs, έναs Alu παρεμβάλω ( σφυρί 1994; σφυρί και Horai 1995), έναs ουρά παρεμβάλω ( Σαντορίνη et al. 2000), και the 12f2 σβύνω (Casanova et al. 1985). The βάση αντικατάσταση λυκάνθρωπος 92R7 C?T (Mathias et al. 1994); M9 C?G (Underhill et al. 1997); SRY-2627 C?T (Bianchi et al. 1997); SRY-1532 έναsG?έναs (Whitfield et al. 1995; Kwok et al. 1996; Σαντορίνη et al. 1999b); sY81 (DYS271) έναs?G (Seielstad et al. 1994); SRY-8299 G?έναs (Σαντορίνη et al. 1999a); Apt G?έναs (Pandya et al. 1998); SRY +465 C?T ( αντικνήμιο et al. 1999); LLY22g C?έναs και Tat T?C transition (Zerjal et al. 1997). επιπλέον, the M17 μαρκαδόρος (Underhill et al. 1997) was δακτυλογραφώ, από χρήση του αλφαβητάρι GTGGTTGCTGGTTGTTACGT και AGCTGACCACAAACTGATGTAGA ακολούθησα από AflIII χώνεψη του PCR προϊόν; the προγονικός allele was όχι χώνεψα The M20 μαρκαδόρος (Underhill et al. 1997) was genotyped, από χρήση του the αλφαβητάρι CACACAACAAGGCACCATC και GATTGGGTGTCTTCAGTGCT ακολούθησα από SspI χώνεψη; the έναs?G mutation καταστρέφω the site σε θέση 118 μέσα στο 413-bp προϊόν. M11 (Underhill et al. 1997) was δακτυλογραφώ, χρησιμοποιώνταs the αλφαβητάρι TTCATCACAAGGAGCATAAACAA και CCCTCCCTCTCTCCTTGTATTCTACC ακολούθησα από χώνεψη με MspI. The 215-bp προϊόν was χώνεψα σε 193-bp και 22-bp αποσπασματικός μέσα στο αποκόμισα allele. The RPS4Y C?T mutation (Bergen et al. 1999) was εντοπισμός από BslI περιορίζω χώνεψη του έναs 528-bp PCR προϊόν απόκτησα από χρήση του αλφαβητάρι CCACAGAGATGGTGTGGGTA και GAGTGGGAGGGACTGTGAGA. The προγονικός C allele περιέχω δύο sites, και the αποκόμισα T allele περιέχω έναs. M48 (Underhill et al. 1997), έναsG, was δακτυλογραφώ από allele- ειδικός PCR χρησιμοποιώνταs the διάκριση αλφαβητάρι TGACAATTAGGATTAAGAATATTATA και TGACAATTAGGATTAAGAATATTATG και the κοινός αλφαβητάρι AAAATTCCAAGTTTCAGTGTCACATA σε γενικός ειδικός 145-bp προϊόντα The θέτω του Y δυαδικός μαρκαδόρος alleles μετέφερα από έναs μονό ατομικός θα να είμαι αναφέρθηκα όπως “the Y haplogroup.”
του 718 δείγμα, 717 έπεσα into haplogroups αναμενόμενος λόγω του ότι the γνωστός phylogeny, μα έναs παθητικός δείγμα (PKH134) απέτυχα σε ενισχύω στο SRY –1532 και M17 loci. αυτόs was ανέθεσα σε haplogroup 3 λόγω του ότι του εναλλακτικός SRY –1532 αλφαβητάρι ( λεπτομέρεια εφόσον ζητηθεί) και δικός του STR profile.
Y-STR χαρακτηριστικός
πέντε trinucleotide- επαναλαμβάνω polymorphisms (DYS388, DYS392, DYS425, DYS426, και DYS436), δέκα tetranucleotide- επαναλαμβάνω polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, και DYS439) και έναs pentanucleotide microsatellite (DYS438) λυκάνθρωπος δακτυλογραφώ μέσα όλος Y chromosomes. τρία πολλαπλός PCR αντιδράσεις λυκάνθρωπος performed για όλος Y-STRs, μέσα a10-µl τελικός αντίδραση τόμος περιέχω 20 ng genomic DNA, όπως περιγράφεται στο αλλού (Thomas et al. 1999; Ayub et al. 2000). PCR προϊόντα λυκάνθρωπος τρέχω επάνω έναs ABI 377 sequencer. ABIGS350 TAMRA was μεταχειρισμένος όπως the εσωτερικός δρομάκι επίπεδο. The GENESCAN και GENOTYPER λογισμικό δέματα λυκάνθρωπος συνήθιζα να εισπράτω the δεδομένα και αναλύω αποσπασματικός μέγεθος Y-STR alleles λυκάνθρωπος όνομα σύμφωνα με the αριθμόs του επαναλαμβάνω μονάδα αυτοί contain.The αριθμόs του επαναλαμβάνω μονάδα was ίδρυσα διαμέσου the χρήση του sequenced παραπομπή DNA δείγμα. Allele μήκος για DYS389b λυκάνθρωπος απόκτησα από αφαίρεση του DYS389II allele μήκος από DYS389I.
Y-STR duplications λυκάνθρωπος βρήκα σε διάφορος loci. DYS393 was διπλός μέσα PKH165 (13 και 15) και DYS437 was διπλός μέσα SDH181 (8 και 9). έναs περισσότερο ολοκληρώνω πρότυπο was βρήκα μέσα DYS425, πού δύο σε τέσσερα alleles λυκάνθρωπος βρήκα μέσα 36 άτομα από haplogroups 8, 9, 13, και 21.
δεδομένα ανάλυση
κύριος- συστατικό ανάλυση was τελείωσα επάνω haplogroup συχνότητα από χρήση του μακρινή θέα ( οπτικός στατιστικός) σύστημα λογισμικό, εκδοχή 5.0.2 (νέος και απαγορευμένος 1996). για γραφικός εκπρόσωποs, the πρώτος και δεύτερος κύριος συστατικό λυκάνθρωπος συνομώτης με το μικροσκόπιο γραφείο σουίτα έξοχοs πακέτο επάνω Windows 2000. Biallelic polymorphism δεδομένα για διάφορος κόσμοs πληθυσμός μεταχειρισμένος μέσα στο ανάλυση λυκάνθρωπος απόκτησα από σφυρί et al. (2001). μίγμα was υπολόγισα από χρήση του τρία διαφορετικός μέτρο: μακρύς βάροs εκμίσθωση- τετράγωνο (WLS) μέτρο ( μακρύς 1991); mR, έναs εκμίσθωση- τετράγωνο υπολογίζω (Ρόμπερτ και Hiorns 1965); και m? (Helgason et al. 2000).
ανάλυση του μοριακός αντίθεση (AMOVA) was τελείωσα από χρήση του Arlequin πακέτο (Schneider et al. 1997). AMOVA μέτρο the proportions του mutational απόκλιση βρήκα με και ανάμεσα πληθυσμός, respectively. παρ΄ όλο που much του απόκλιση στο βιαστής mutating microsatellite loci is αναμενόμενος έχω been παράγω μέσα the διαφορετικός Πακιστάν subpopulations, the μοναδικός mutation γεγονός στο δυαδικός loci είναι much παλαιότερος και έχω όχι συμβάν μέσα στο έρχομαι σε επαφή του υποδιαίρεση του Πακιστάν πληθυσμός. εμείs devised the επόμενος στρατηγική σε εκμεταλλεύομαι the μέγιστος ισοδυναμώ με of relevant mutational information from the Y-chromosome haplotypes. STR variation within haplogroups was used to calculate population pairwise FST values for each individual haplogroup. For each population pair, a weighted mean FST was calculated, where the value obtained for each haplogroup was weighted according to the proportion of pairwise comparisons involving that haplogroup. In the absence of a particular haplogroup from one population, A, of the pair A and B, FST was set to 1, and the number of pairwise comparisons was taken as the number of chromosomes carrying that haplogroup in B. Values of FST based on STRs alone or on STRs plus binary markers, with binary markers given a 10-fold higher weighting, were calculated for comparison. In all of these analyses, the distance matrix used consisted of the number of steps by which each pair of haplotypes differed. Mantel tests for the significance of correlations between FST values were carried out in Arlequin, and multidimensional scaling (MDS) plots were constructed by use of the SPSS version 7.0 software package.
Median-joining networks were constructed by Network 2.0b (Bandelt et al. 1999). A weighting scheme with a five-fold range was used in the construction of the networks. The weights assigned were specific for each haplogroup and took into account the Y-STR variation across the haplogroup in the whole Pakistani population. The following weights were used: variance 0-0.09, weight 5; variance 0.1-0.19, weight 4; variance 0.2-0.49, weight 3; variance 0.5-0.99, weight of 2; and variance 1.00, weight 1. Despite this, the network for haplogroup 1 contained many high dimensional cubes and was resolved by applying the reduced median and median joining network methods sequentially. reduced median algorithm (Bandelt et al. 1995) was used to generate a *.rmf file and the median joining network method was applied to this file.
BATWING (Wilson and Balding 1998), Bayesian Analysis of Trees With Internal Node Generation, was used to estimate the time to the most recent common ancestor (TMRCA) of a set of chromosomes. This program uses a Markov chain Monte Carlo procedure to generate phylogenetic trees and associated parameter values consistent with input data (a set of Y haplotypes) and genetic and demographic models. The genetic model assumes single-step mutations of the STRs and the demographic model chosen was exponential growth from an initially constant-sized population, with or without subdivision in different runs of the program. All 16 STR loci were used; locus-specific mutation rate prior probabilities based on the data of Kayser et al. (Kayser et al. 2000) were constructed for the loci available as gamma distributions of the form gamma(a, b) where a = (1 + number of mutations observed by Kayser et al.), and b = (1 + number of meioses). For loci not investigated by Kayser et al., the distribution gamma (1,416) was used, which has a mean of 0.0024. A generation time of 25 years was assumed. Thus the 95% confidence intervals given take into account uncertainty in mutation rate, population growth and (where appropriate) subdivision, but not generation time.
Results
Y-Chromosome Binary Polymorphisms
The 18 binary markers used identify 20 haplogroups in worldwide populations (fig. 1A), but only 11 were found in Pakistan, and 5 accounted for 92% of the sample (fig. 1 and table 2). Haplogroups 1 and 9 were present in all Pakistani populations examined, haplogroup 3 was present in all except the Hazaras, and haplogroup 28 was present in all except the Hazaras and the Kashmiris. Southwestern populations show higher frequencies of hg 9 and the YAP+ haplogroups 21 and 8 than northeastern populations (figs. 1D–E), but, overall, little geographical clustering of haplogroup frequencies is apparent within the country.
Principal-Components Analysis
We wished to compare the Pakistani Y haplogroup data with data from populations from the rest of the world. No suitable data set was available for the entire set of 18 markers, but the data of Hammer et al. (2001) allowed all but 5 to be used, because the same or phylogenetically equivalent markers were reported. principal-components analysis (fig. 2A) shows some differences from the original analysis of Hammer et al., the main one being the lesser separation of the African populations. This is due, to a large extent, to the subset of markers used, which does not include many of the Africa-specific ones. Most Pakistani populations cluster with South Asian and Middle Eastern populations, and are close to Northern African, Central Asian and European populations, thus showing a general similarity with geographically close populations. The one exception is the Hazara, who are quite distinct. A similar analysis of the Pakistani populations alone, using all of the binary markers (fig. 2B), confirms the difference between the Hazaras and the other populations and also more clearly shows the distinctness of the Kalash and the Parsis. It is striking that the language isolate–speaking Burusho and the Dravidian-speaking Brahuis do not stand out in these analyses.
Admixture Estimates
Hypotheses about population origins (table 1) can be considered as quantitative questions about admixture. For example, to test the possibility that the Baluch Y chromosomes have a Syrian origin, we can ask what proportion of the Baluch Ys are derived from Syria and what proportion are from Pakistan (considered to be the Pakistani sample minus the Baluch). Data on suggested source populations were taken from the literature and three measures of admixture were calculated. The three estimates gave broadly consistent results, with small systematic differences: typically m? > mR > Long’s WLS for the estimated contribution from the external source population (table 3). These results provide evidence for an external contribution to the Hazaras, Kalash, Negroid Makrani, and Parsis but not to the other populations.
Y-Chromosome STR Polymorphisms
Y-STR polymorphisms were studied to obtain a more detailed view of Y variation, among the different Pakistani ethnic groups, that would be less biased by the marker-ascertainment procedure. The diversity of Y-STR haplotypes (table 4) was lowest for the Hazara (0.893) as suggested by previous analyses (Ayub et al. 2000).
The 16 Y-STRs defined 502 Y haplotypes, the vast majority being observed in single individuals. The remaining haplotypes were shared by 2–18 individuals (details are given in the online-only supplementary table). In all cases but one, the chromosomes sharing a haplotype belonged to the same haplogroup (hence, 503 combination haplotypes) and, in most cases, the individuals sharing a haplotype belonged to the same population (table 5).
The GST and modal size of the repeat unit, for all 16 Y-STRs examined in the Pakistani population, are given in table 6. The correlation between marker heterozygosity and GST was found not to be significant (r=0.329; P=.213). The modal size and variance of the 16 Y-STRs within haplogroups 1, 2, 3, 8, 9, 10, 21, 26, and 28 is also given in table 6. Certain haplogroups have a different modal allele size, and some examples of this are shown in boldface italics in table 6. For instance, DYS388 has 15 repeats in haplogroup 9, compared with 12 repeats in most of the other haplogroups in Pakistan. Similarly, the modal allele for DYS438 is 9 in haplogroup 9, but 10 or 11 in the other haplogroups. The modal allele for DYS434 for haplogroup 10 is 11, which is strikingly different from the allele size of this locus in other haplogroups. The complete lack of variability for DYS436 in the 233 male subjects belonging to haplogroup 3 is notable. Haplogroup 10 appears to have the least variability across most loci except for DYS390 (table 6). These findings demonstrate the strong structuring of Y-STR variability by haplogroup.
We wanted to calculate a Y-based measure of genetic distance between populations that would reflect the differentiation that had occurred within Pakistan and that would not be disproportionately dominated by ancient differences that had previously accumulated between haplogroups. The standard way to do this would be to use STR variation, and table 7 summarizes population pairwise values of FST on the basis of STR variation alone (A) or of binary-marker plus STR variation (B), with binary-marker differences weighted 10 times higher than STR differences. These matrices are highly correlated (r=0.95; P<.001), as might be expected from the structuring of STR variation by haplogroup. However, these measures are significantly influenced by ancient differences, and we have therefore developed a modified measure. We reasoned that much of the STR variation within haplogroups would have originated recently and could be used for this purpose.Nous avons calculé donc par paires des valeurs de population de FST, sur la base du STR variation dans des haplogroups, et utilisé une moyenne pesée de ces derniers pour produire une matrice simple de distance de FST (table 7C ; figue. 3) These distances are also highly correlated with distances based on STRs alone (r=0.76; P<.001) or on STRs plus binary markers (r=0.70; P<.001), but a greater proportion of the variation is seen between populations (22%, compared with 6% and 7%, respectively). A comparison of figure 3 with figure 2B (which was based on binary marker frequencies alone) reveals a striking overall resemblance, with the Hazaras being distinct from all of the other populations. The other outstanding populations are the Kalash and Parsis (as before), the Kashmiris (perhaps because of the small sample), and the Brahuis, who are thus more distinct in their STR profiles than haplogroup frequencies. MDS plots of the distances in tables 7A and 7B (not shown) lead to similar conclusions, but resemble figure 2B more closely in the way that the Brahuis do not stand out so much.
Median-Joining Networks
The genetic relationships among the different Pakistani ethnic groups were explored further by drawing median-joining networks (Bandelt et al. 1995), and examples are shown in figures 4, 5, and 6. The haplogroup 1 network (fig. 4) reveals considerable variation, but also a high degree of population-specific substructure. For example, the 24 Parsi haplogroup 1 chromosomes all fall into one of three clusters (fig. 4, green), 19 of 26 Burusho haplogroup 1 chromosomes fall into two clusters (blue), and 12 of 14 Hazara haplogroup 1 chromosomes fall into a single cluster, and all of these clusters are specific to their respective populations. The haplogroup 10 network (fig. 5) is much simpler, because of the smaller number of chromosomes, but again reveals population-specific clustering for Burusho and Hazara haplotypes. The haplogroup 28 network (fig. 6) shows a striking isolated Parsi-specific cluster, at the end of a long branch, containing 15 of 16 Parsi haplogroup 28 chromosomes. Clusters of Kalash, Burusho, and—to a lesser degree—Baluch chromosomes are also evident, although one Baluch haplotype is shared with Sindhi and Makrani Baluch individuals from nearby southern populations.
BATWING TMRCAs were calculated for the haplogroup 28 network and for selected lineages within a number of haplogroups. The results are summarized in table 8.
Discussion
We have carried out the first extensive analysis of Y diversity within Pakistan, examining 34 markers in 718 male subjects from 12 populations. This allows us to compare Pakistani Y diversity with that previously reported in world populations, to investigate differences within Pakistan, and to evaluate some of the suggested population histories from a Y perspective.
Comparisons with Worldwide Data
In a worldwide comparison, Pakistani populations mostly cluster around a pooled South Asian sample and lie close to a Middle Eastern sample (fig. 2A). This finding is unsurprising, in part because the South Asian sample included 62 Pakistani individuals (i.e., 32% of 196 total) and in part because Y variation in many areas of the world is predominantly structured by geography, not by language or ethnic affiliation (Rosser et al. 2000; Zerjal et al. 2001). The greater genetic similarity of Pakistani populations to those in the west than to eastern populations is illustrated by the fact that four of the five frequent haplogroups in Pakistan (haplogroups 1, 2, 3, and 9, which together make up 79% of the total population) are also frequent in western Asia and Europe but not in China or Japan; conversely, the haplogroups that are frequent in East Asia (e.g., 4, 5, 10, 13, and 20) are rare or absent in Pakistan, forming only 2.5% of the total. If, as in some interpretations, an early exodus from Africa along the southern coast of Asia led to the first anatomically modern human populations in Pakistan, and these people carried the eastern haplogroups or their precursors, their Y chromosomes have now been largely replaced by subsequent migrations or gene flow; indeed, the representatives of the eastern haplogroups in Pakistan may be derived from modern back-migration, not from ancient survivors.
The fifth haplogroup that is common in Pakistan, haplogroup 28, differs from all the others in its distribution. Within Pakistan, it made up 14% of our sample and was present in all but two populations (both of which had very small sample sizes), so it is both common and widespread. Outside Pakistan and the nearby countries, however, it is rare. It has been reported in India (30%; present in 3/3 populations), Tajikistan (10%; present in 5/6 populations), and Uzbekistan (3%; present in 10/13 populations), but it is rare in Russia (0.4%; present in 1/6 populations) and the Caucasus (1.4%; present in 1/6 populations (Wells et al. 2001) and has not been found at all in China or Mongolia (unpublished observations). BATWING estimates of the TMRCA of the Pakistani haplogroup 28 chromosomes were ~7,000 (4,000–14,000) years (table 8). Thus, within this time period, the Pakistani populations have diverged from a common ancestral population or have experienced considerable male gene flow between themselves or from a common source. Since the estimated age corresponds to the early Neolithic period, the spread of this lineage might be associated with the local expansion of farmers.
Comparisons within Pakistan
Haplogroup distributions in Pakistani populations, with the exception of the Hazara (discussed in the next section), are strikingly similar to one another (figs. 1 and 2), despite some notable linguistic differences. Indeed, the language isolate-speaking Burusho, the Dravidian-speaking Brahuis, and the Sino-Tibetan–speaking Baltis did not stand out from the other populations at all in the haplogroup analyses (table 2 and fig. 2), suggesting either that the linguistic differences arose after the common Y pattern was established or that there has been sufficient Y gene flow between populations to eliminate any initial differences. Yet a more detailed analysis of the Y haplotypes (e.g., figs. 3–6) reveals some distinct features of the Brahui and considerable population specificity; population-specific clusters of related haplotypes are commonly found in these networks. Such clusters will only be seen if populations are isolated from one another. It may be that a low degree of gene flow between populations over a long time is sufficient to result in similar haplogroup frequencies without producing many shared clusters.
Population-specific clusters of haplotypes are particularly evident in some populations. In the Hazaras, where the distinct haplogroup frequencies noted above are found, most chromosomes (19/23; 83%) fall into one of just two well-isolated clusters (figs. 4 and 5), whereas the Parsis, the Kalash, and the Burusho also show prominent clusters. The Hazaras, Parsis, and Kalash were the three populations showing the most significantly different population pairwise FST values. The high values of the Hazaras and Parsis can partly be accounted for by migration to Pakistan from other places, but a contributing factor is likely to be drift, either due to a limited number of founder lineages or occurring subsequently within small populations. Tk values (Ewens 1972) provide a way of comparing effective population sizes. Values based on the STRs for the Hazaras, Parsis, Kalash, and Burushos were 8.9, 77.5, 25.8, and 74.2, respectively, compared with a mean of 181.8 for the other populations with sample sizes >20. Effective population size for Y chromosomes can differ greatly from census population size, but it is notable that the Parsis and Kalash do have the smallest census sizes, one-hundredth or one-thousandth of most of those of the other populations (table 1), so these small census sizes may have been maintained for a long time. In summary, many features of the present Pakistani Y haplotype distributions can be accounted for by a shared ancestral gene pool, with limited gene flow between populations and drift in the smaller ones.
Insights into Population Origins
The suggested population origins (table 1) can now be considered in the light of these Y results. Information is provided by haplogroup frequencies, which can be used to produce admixture estimates, and these are easy to interpret if populations are large and isolated and the source populations have different frequencies. When these conditions are not met, the presence of distinct Y lineages can still be informative. The origins of the Parsis are well-documented (Nanavutty 1997) and thus provide a useful test case. They are followers of the Iranian prophet Zoroaster, who migrated to India after the collapse of the Sassanian empire in the 7th century a.d. They settled in 900 a.d. in Gujarat, India, where they were called the “Parsi” (meaning “from Iran”). Eventually they moved to Mumbai in India and Karachi in Pakistan, from where the present population was sampled (fig. 7). Their frequencies for haplogroups 3 (8%) and 9 (39%) do indeed resemble those in Iran more than those of their current neighbors in Pakistan. They show the lowest frequency for haplogroup 3 in Pakistan (apart from the Hazaras; fig. 1C). The mean for eight Iranian populations was 14% (n=401) (Quintana-Murci et al. 2001), whereas that for Pakistan, excluding the Parsis, was 36%. corresponding figures for haplogroup 9 were 39% in the Parsis, 40% in Iran, and 15% in Pakistan excluding the Parsis. These figures lead to an admixture estimate of 100% from Iran (table 3). Given the small effective population size of the Parsis, the closeness of their match to the Iranian data may be fortuitous, and the presence of haplogroup 28 chromosomes at 18% (4% in Iran; Wells et al. 2001) suggests some gene flow from the surrounding populations. The TMRCA for the Parsi-specific cluster in the haplogroup 28 networks was 1,800 (600–4,500) years (table 8), consistent with the migration of a small number of lineages from Iran. Overall, these results demonstrate a close match between the historical records and the Y data, and thus suggest that the Y data will be useful when less historical information is available.
The population that is genetically most distinct, the Hazaras, claims descent from Genghis Khan’s army; their name is derived from the Persian word “hazar,” meaning “thousand,” because troops were left behind in detachments of a thousand. Toward the end of the 19th century, some Hazaras moved from Afghanistan to the Khurram Valley in Pakistan, the source of the samples investigated here. Thus, their oral history identifies an origin in Mongolia and population bottlenecks ~800 and ~100 years ago. Of the two predominant Y haplogroups present in this population, haplogroup 1 is widespread in Pakistan, much of Asia, Europe, and the Americas, and so provides little information about the place of origin. Haplogroup 10, in contrast, is rare in most Pakistani populations (1.4%, when the Hazaras are excluded) but is common in East Asia, including Mongolia, where it makes up over half of the population (unpublished results). Admixture estimates (table 3) are consistent with a substantial contribution from Mongolia. BATWING analysis of the Hazara-specific haplotype clusters in haplogroups 1 and 10 suggested TMRCAs of 400 (120–1,200) and 100 (6–600) years (table 8), respectively. Thus, the genetic evidence is consistent with the oral tradition and, in view of its independent nature, provides strong support for it (fig. 7).
Some other suggested origins receive more limited support from the Y data. The Negroid Makrani, with a postulated origin in Africa, carry the highest frequency of haplogroup 8 chromosomes found in any Pakistani population, as noted elsewhere (Qamar et al. 1999). This haplogroup is largely confined to sub-Saharan Africa, where it constitutes about half of the population (Hammer et al. 2001) and can thus be regarded as a marker of African Y chromosomes. Nevertheless, it makes up only 9% of the Negroid Makrani sample, and haplogroup 28 (along with other typical Pakistani haplogroups) is present in this population. If the Y chromosomes were initially African (fig. 7), most have subsequently been replaced: the overall estimate of the African contribution is ~12% (table 3).
The Balti are thought to have originated in Tibet, where the predominant haplogroups are 4 and 26. Neither was present in the sample from this study, providing no support for a Tibetan origin of the Y chromosome lineages and an admixture estimate of zero (table 3). However, this result must be interpreted with caution, because of the small sample size. Three populations have possible origins from the armies of Alexander the Great: the Burusho, the Kalash, and the Pathans. Modern Greeks show a moderately high frequency of haplogroup 21 (28%; Rosser et al. 2000), but this haplogroup was not seen in either the Burusho or the Kalash sample and was found in only 2% of the Pathans, whereas the local haplogroup 28 was present at 17%, 25%, and 13%, respectively. Greek-admixture estimates of 0% were obtained for the Burusho and the Pathans, but figures of 20%–40% were observed for the Kalash (table 3). In view of the absence of haplogroup 21, we ascribe this result either to drift in the frequencies of the other haplogroups, particularly haplogroups 2 and 1, or to the poor resolution of lineages within these haplogroups, resulting in distinct lineages being classified into the same paraphyletic haplogroups. Overall, no support for a Greek origin of their Y chromosomes was found, but this conclusion does require the assumption that modern Greeks are representative of Alexander’s armies. Two populations, the Kashmiris and the Pathans, also lay claim to a possible Jewish origin. Jewish populations commonly have a moderate frequency of haplogroup 21 (e.g., 20%) and a high frequency of haplogroup 9 (e.g., 36%; (Hammer et al. 2000). The frequencies of both of these haplogroups are low in the Kashmiris and Pathans, and haplogroup 28 is present at 13% in the Pathans, so no support for a Jewish origin is found, and the admixture estimate was 0% (table 3), although, again, this conclusion is limited both by the small sample size available from Kashmir and by the assumption that the modern samples are representative of ancient populations.
The suggested origin of the Baluch is in Syria. Syrians, like Iranians, are characterized by a low frequency of haplogroup 3 and a high frequency of haplogroup 9 (9% and 57%, respectively; Hammer et al. 2000), whereas the corresponding frequencies in the Baluch are 29% and 12%. This difference and the high frequency of haplogroup 28 in the Baluch (29%) make a predominantly Syrian origin for their Y chromosome unlikely, and the admixture estimate was 0% (table 3), although the 8% frequency for haplogroup 21, the highest identified in Pakistan thus far, does indicate some western contribution to their Y lineages. Brahuis have a possible origin in West Asia (Hughes-Buller 1991) and it has been suggested that a spread of haplogroup 9 Y chromosomes was associated with the expansion of Dravidian-speaking farmers (Quintana-Murci et al. 2001). Brahuis have the highest frequency of haplogroup 9 chromosomes in Pakistan (28%) after the Parsis, providing some support for this hypothesis, but their higher frequency of haplogroup 3 (39%) is not typical of the Fertile Crescent (Quintana-Murci et al. 2001) and suggests a more complex origin, possibly with admixture from later migrations, such as those of Indo-Iranian speakers from the steppes of Central Asia and others from further east. This possibility is supported by the detection of low frequencies of haplogroups 10, 12, and 13 in the Brahuis, all rare in Pakistan and typical of East Asia, East and northern Asia, and Southeast Asia, respectively.
The failure to find a Y link with a suggested population of origin does not disprove a historical association, but it does demonstrate that the Y chromosomes derived from such historical events have been lost or replaced. Analyses of mitochondrial DNA and other loci would help to elucidate the population histories and would be particularly interesting in populations like the Negroid Makrani and the Balti, in which there is a contrast between the phenotype and the typical Pakistani Y haplotypes.
Acknowledgments
This work was supported by a Wellcome Trust Collaborative Research Initiative Grant to S.Q.M. T.Z. was also supported by The Wellcome Trust, and C.T.-S. by the Cancer Research Campaign. We express our appreciation to the original DNA donors who made this study possible. The Department of Health of the Government of Baluchistan and the Baluch Student Federation, Quetta, Pakistan, assisted in the collection of the Brahui and Baluch samples. Pathan samples were collected with the assistance of the Department of Paediatrics, Lady Reading Post Graduate Medical Hospital, Peshawar, Pakistan. We are also grateful to Dr. I. Kazmi and the Aga Khan Foundation Rural Health Support Program for their assistance in the collection of Burusho samples. Dr. F. Sethna provided valuable assistance in the collection of the Parsi samples. We thank Luis Quintana-Murci for his comments on the manuscript.
Electronic-Database Information
URLs for data in this article are as follows:
Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Network 2.0, http:/www.fluxus-engineering.com/.
/ ViSta, http:/forrest.psych.unc.edu/.
/
References
Ahmad AKN (1952) Jesus in heaven on earth. The Civil and Military Gazette Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin A, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler-Smith C (2000) Identification and characterisation of novel human Y-chromosomal microsatellites from sequence database information. Nucleic Acids Res 28:e8 [Free Full text in PMC].
Backstrom PC (1992) Balti. In: Backstrom PC, Radloff CF (eds) Sociolinguistic survey of northern Pakistan. Vol 2, Languages of northern areas. National Institute of Pakistan Studies, Islamabad, pp 3–27.
Bandelt HJ, Forster P, Rohl A (1999) Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol 16:37–48 [PubMed] [Free Full Text].
Bandelt HJ, Forster P, Sykes BC, Richards MB (1995) Mitochondrial portraits of human populations using median networks. Genetics 141:743–753 [PubMed] [Free Full Text].
Bellew HW (1979) The races of Afghanistan. Sang-e-Meel Publications, Lahore, Pakistan.
Bellew HW (1998) An enquiry into the ethnography of Afghanistan. Vanguard Books, Lahore, Pakistan.
Bergen AW, Wang C-Y, Tsai J, Jefferson K, Dey C, Smith KD, Park S-C, Tsai S-J, Goldman D (1999) An Asian–Native American paternal lineage identified by RPS4Y resequencing and by microsatellite haplotyping. Ann Hum Genet 63:63–80 [PubMed] [Full Text].
Bianchi NO, Bailliet G, Bravi CM, Carnese RF, Rothhammer F, Martinez-Marignac VL, Pena SD (1997) Origin of Amerindian Y-chromosomes as inferred by the analysis of six polymorphic markers. Am J Phys Anthropol 102:79–89 [PubMed] [Full Text].
Biddulph J (1977) Tribes of the Hindoo Koosh. Indus Publications, Karachi, Pakistan.
Burton RF (1851) Sindh and the races that inhabit the valley of the Indus. WH Allen and Co Ltd, London.
Caroe O (1958) The Pathans. Oxford University Press, Karachi, Pakistan.
Casanova M, Leroy P, Boucekkine C, Weissenbach J, Bishop C, Fellous M, Purrello M, Fiori G, Siniscalco M (1985) A human Y-linked DNA polymorphism and its potential for estimating genetic and evolutionary distance. Science 230:1403–1406 [PubMed].
Cavalli-Sforza LL, Menozzi P, Piazza A (1994) The history and geography of human genes. Princeton University Press, Princeton.
Dales GF (1991) The phenomenon of the Indus civilization. In: Jansen M, Mulloy M, Urban G (eds) Forgotten cities on the Indus: early civilization in Pakistan from the 8th to the 2nd millennia BC. Verlag Philipp von Zabern, Mainz, Germany, pp 129–144.
Decker KD (1992) Sociolinguistic survey of Northern Pakistan. Vol 5, Languages of Chitral. National Institute of Pakistan Studies, Islamabad.
Ewens WJ (1972) The sampling theory of selectively neutral alleles. Theor Popul Biol 3:87–112 [PubMed].
Grimes BF (1992) Ethnologue: languages of the world. Summer Institute of Linguistics, Dallas.
Hammer MF (1994) A recent insertion of an Alu element on the Y chromosome is a useful marker for human population studies. Mol Biol Evol 11:749–761 [PubMed] [Free Full Text].
Hammer MF, Horai S (1995) Y chromosomal DNA variation and the peopling of Japan. Am J Hum Genet 56:951–962 [PubMed].
Hammer MF, Karafet TM, Redd AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarchical patterns of global human Y-chromosome diversity. Mol Biol Evol 18:1189–1203 [PubMed] [Free Full Text].
Hammer MF, Redd AJ, Wood ET, Bonner MR, Jarjanazi H, Karafet T, Santachiara-Benerecetti S, Oppenheim A, Jobling MA, Jenkins T, Ostrer H, Bonne-Tamir B (2000) Jewish and Middle Eastern non-Jewish populations share a common pool of Y-chromosome biallelic haplotypes. Proc Natl Acad Sci USA 97:6769–6774 [Free Full text in PMC].
Helgason A, Sigurdardottir S, Nicholson J, Sykes B, Hill EW, Bradley DG, Bosnes V, Gulcher JR, Ward R, Stefansson K (2000) Estimating Scandinavian and Gaelic ancestry in the male settlers of Iceland. Am J Hum Genet 67:697–717 [PubMed] [Free Full Text].
Hughes-Buller R (1991) Imperial gazetteer of India: provincial series, Baluchistan. Sang-e-Meel, Lahore, Pakistan.
Hussain J (1997) A history of the peoples of Pakistan towards independence. Oxford University Press, Karachi, Pakistan.
Ibbetson D (1883) Panjab castes. Sang-e-Meel, Lahore, Pakistan.
Jarrige JF (1991) Mehrgarh: its place in the development of ancient cultures in Pakistan. In: Jansen M, Mulloy M, Urban G (eds) Forgotten cities on the Indus: early civilization in Pakistan from the 8th to the 2nd millennia BC. Verlag Philipp von Zabern, Mainz, Germany, pp 34–50.
Jobling MA, Tyler-Smith C (2000) New uses for new haplotypes: the human Y chromosome, disease and selection. Trends Genet 16:356–362 [PubMed] [Full Text].
Karafet TM, Zegura SL, Posukh O, Osipova L, Bergen A, Long J, Goldman D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffiths RC, Templeton AR, Hammer MF (1999) Ancestral Asian source(s) of new world Y-chromosome founder haplotypes. Am J Hum Genet 64:817–831 [PubMed] [Free Full Text].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila A (2000) Characteristics and frequency of germline mutations at microsatellite loci from the human Y chromosome, as revealed by direct observation in father/son pairs. Am J Hum Genet 66:1580–1588 [PubMed] [Free Full Text].
Kwok C, Tyler-Smith C, Mendonca BB, Hughes I, Berkovitz GD, Goodfellow PN, Hawkins JR (1996) Mutation analysis of the 2 kb 5' to SRY in XY females and XY intersex subjects. J Med Genet 33:465–468 [PubMed].
Long JC (1991) The genetic structure of admixed populations. Genetics 127:417–428 [PubMed] [Free Full Text].
Mathias N, Bayes M, Tyler-Smith C (1994) Highly informative compound haplotypes for the human Y chromosome. Hum Mol Genet 3:115–123 [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansoor A, Ismail M, Hammer MF, Underhill PA, Cavalli-Sforza LL (1999) The origins of Pakistani populations: evidence from Y chromosome markers. In: Papiha SS, Deka R, Chakraborty R (eds) Genomic diversity: applications in human population genetics. Kluwer Academic/Plenum Publishers, New York, pp 83–90.
Mohyuddin A, Ayub Q, Qamar R, Zerjal T, Helgason A, Mehdi SQ, Tyler-Smith C (2001) Y-chromosomal STR haplotypes in Pakistani populations. Forensic Sci Int 118:141–146 [PubMed] [Full Text].
Nanavutty P (1997) The Parsis. National Book Trust, New Delhi, India.
Pandya A, King TE, Santos FR, Taylor PG, Thangaraj K, Singh L, Jobling MA, Tyler-Smith C (1998) A polymorphic human Y-chromosomal G to A transition found in India. Ind J Hum Genet 4:52–61.
Qamar R, Ayub Q, Khaliq S, Mansoor A, Karafet T, Mehdi SQ, Hammer MF (1999) African and Levantine origins of Pakistani YAP+ Y chromosomes. Hum Biol 71:745–755 [PubMed].
Quddus SA (1990) The tribal Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, Hammer MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin A, Radhakrishna U, Jobling MA, Tyler-Smith C, McElreavey K (2001) Y-chromosome lineages trace diffusion of people and languages in southwestern Asia. Am J Hum Genet 68:537–542 [PubMed] [Free Full Text].
Roberts DF, Hiorns R (1965) Methods of analysis of the genetic composition of a hybrid population. Hum Biol 37:38–43.
Robertson GS (1896) The Kafirs of the Hindu-Kush. Oxford University Press, Karachi, Pakistan.
Rosser ZH, Zerjal T, Hurles ME, Adojaan M, Alavantic D, Amorim A, Amos W, et al (2000) Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Am J Hum Genet 67:1526–1543 [PubMed] [Free Full Text].
Santos FR, Carvalho-Silva DR, Pena SDJ (1999a) PCR-based DNA profiling of human Y chromosomes. In: Epplen JT, Lubjuhn T (eds) Methods and tools in biosciences and medicine. Birkhauser Verlag, Basel, Switzerland, pp 133–152.
Santos FR, Pandya A, Kayser M, Mitchell RJ, Liu A, Singh L, Destro-Bisol G, Novelletto A, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler-Smith C (2000) A polymorphic L1 retroposon insertion in the centromere of the human Y chromosome. Hum Mol Genet 9:421–430 [PubMed] [Free Full Text].
Santos FR, Pandya A, Tyler-Smith C, Pena SD, Schanfield M, Leonard WR, Osipova L, Crawford MH, Mitchell RJ (1999b) The central Siberian origin for native American Y chromosomes. Am J Hum Genet 64:619–628 [PubMed] [Free Full Text].
Schneider S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: a software for population genetic data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland.
Seielstad MT, Hebert JM, Lin AA, Underhill PA, Ibrahim M, Vollrath D, Cavalli-Sforza LL (1994) Construction of human Y-chromosomal haplotypes using a new polymorphic A to G transition. Hum Mol Genet 3:2159–1261 [PubMed].
Shinka T, Tomita K, Toda T, Kotliarova SE, Lee J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genetic variations on the Y chromosome in the Japanese population and implications for modern human Y chromosome lineage. J Hum Genet 44:240–245 [PubMed].
Thomas MG, Bradman N, Flinn HM (1999) High throughput analysis of 10 microsatellite and 11 diallelic polymorphisms on the human Y-chromosome. Hum Genet 105:577–581 [PubMed] [Full Text].
Tyler-Smith C (1999) Y-chromosomal DNA markers. In: Papiha SS, Deka R, Chakraborty R (eds) Genomic diversity: applications in human population genetics. Kluwer Academic/Plenum Publishers, New York, pp 65–73.
Underhill PA, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, Davis RW, Cavalli-Sforza LL, Oefner PJ (1997) Detection of numerous Y chromosome biallelic polymorphisms by denaturing high-performance liquid chromatography. Genome Res 7:996–1005 [PubMed] [Free Full Text].
Wells RS, Yuldasheva N, Ruzibakiev R, Underhill PA, Evseeva I, Blue-Smith J, Jin L, et al (2001) The Eurasian heartland: a continental perspective on Y-chromosome diversity. Proc Natl Acad Sci USA 98:10244–10249 [Free Full text in PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Sequence variation of the human Y chromosome. Nature 378:379–380 [PubMed] [Full Text].
Wilson IJ, Balding DJ (1998) Genealogical inference from microsatellite data. Genetics 150:499–510 [PubMed] [Free Full Text].
Wolpert S (2000) A new history of India. Oxford University Press, New York.
Young FW, Bann CM (1996) A visual statistics system. In: Stine RA, Fox J (eds) Statistical computing environments for social researches. Sage Publications, New York, pp 207–236.
Zerjal T, Beckman L, Beckman G, Mikelsaar AV, Krumina A, Kucinskas V, Hurles ME, Tyler-Smith C (2001) Geographical, linguistic, and cultural influences on genetic diversity: Y-chromosomal distribution in Northern European populations. Mol Biol Evol 18:1077–1087 [PubMed] [Free Full Text].
Zerjal T, Dashnyam B, Pandya A, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Fretwell N, Jobling MA, Harihara S, Shimizu K, Semjidmaa D, Sajantila A, Salo P, Crawford MH, Ginter EK, Evgrafov OV, Tyler-Smith C (1997) Genetic relationships of Asians and Northern Europeans, revealed by Y-chromosomal DNA analysis. Am J Hum Genet 60:1174–1183 [PubMed].
|