Genetics

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Chromosomal DNA Variation dans Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Baptiser Tyler- Forgeron et donc. Qasim Mehdi1

1Biomedical et Genetic Mécanique Vote, Dr. A. Q. Khan Recherche Laboratoire, Islamabad; 2Cancer Recherche Faire campagne, Chromosome Moléculaire Biologie Grouper, Service de Biochimie, et 3Institute de Biologique Anthropologie, Université de Oxford, Oxford, Uni Royaume; et décoder Génétique, Reykjavik.


Résumé

Dix-huit binaire polymorphisms et 16 multiallelic, sèche-tandem- répéter (STR) loci de les nonrecombining portion de les être humain Y chromosome étions type dans 718 mâle thème appartenant à à 12 ethnique. groupes de Pakistan. Ceux-ci identifiants 11 écurie haplogroups et 503 combinaison binaire l'étude de marché/STR haplotypes. Haplogroup fréquence étions généralement semblable à là dans voisin géographique la zone, et les Pakistanaise populations s'entretenir une langue isoler ( les Burushos), une Dravidian langue ( les Brahui), ou une Sino-Tibet langue ( les Balti) ressembler à les Indo-European–speaking plus grande partie Néanmoins, média- jonction réseaux de haplotypes révéler considérable substructuring de Y variation à l'intérieur de Pakistan, à un grand nombre populations projection tranché se rassembler de haplotypes. Ceux-ci échantillon can être raconté pour près de une usitée poule de Y lignée, à substantiel isolement entre populations et sens général dans les plus petites soi même Peu de comparative genetic ou historique données êtes disponible pour très populations, mais les résultats can être la société à oral tradition autour de origine Les Y données supporter les sain- original établi de les Parsis dans Iran, les suggérer origine de les Risquer de Genghis Khan’s armée, et l'origine de les Nègre Makrani dans Afrique, mais font pas supporter tradition de Tibet, Syrie, Grecque, ou Juive origine pour autre populations.


Présentation

Les plus tôt témoignage de Paleolithic être humain présence dans les Le Sud Asie consister en de pierre ustensile établir épars autour de les Soan Rivière Vallée dans septentrionale Pakistan (Hussain 1997). Malgré l'absence de fossile témoignage, ceux-ci outils sembler à signaler les présence de hominids dans les Le Sud Asie que plus tôt que 200,000–400,000 l'année il y a (Wolpert 2000) et donc êtes vraisemblable à prendre été l'associé à archaique Homo espèce. Pakistan lies one les postuler sud côtier route ont près de anatomiquement moderne Homo Sapiens sur Afrique, et tellement Mai ont été habiter près de moderne être humain que tôt que 60,000–70,000 l'année il y a. Il y a témoignage de grotte habitants dans Pakistan le nordouest frontière, mais fossile témoignage de les Paleolithic a été fragmentaire (Hussain 1997). Témoignage a été découvert à Mehrghar, dans le sudouest Pakistan, signalant Neolithic établissements de que long il y a que 7,000 avant J.C. (Jarrige 1991), quoi étions ont par le Indus Vallée civilisation ( incluant les villes de Tracasser et Mohenjodaro) thanksggiving prospérer dans les 3d et 2d millénaires avant J.C. (vallées 1991). Autour de 1500 avant J.C., les Indo-European–speaking nomade pastoral tribus de supplémentaire north—often appelé les Aryans—crossed les Karakorum Montagnes en les Le Sud Asie. Ultérieur historique événement épreuve regrouper les invasion de Alexander les Grand (327–325 avant J.C.) et les Arabe et Musulmane conquête de 711 a.d. en avant (Wolpert 2000).

Les le présent population de Pakistan consister en de plus de que 160 la manufacture individus ( selon à 2005 OMS numéros) qui appartenir à au moins 18 ethnique. groupes et s'entretenir plus de que 60 langue ( saleté 1992). La plus grande partie de ceux-ci langue êtes Indo-Européen, mais ils aussi incluant une isoler, Burushaski; une Dravidian langue, Brahui; et une Sino- Tibet langue, Balti. Punjabi- s'entretenir individus formel les plus grande partie population de Pakistan, mais ils représenter une la société mélange de ethnique. groupes (Ibbetson 1883) et êtes pas analyzed voici; 12 ethnique. groupes êtes compris dans les le présent étude. informative disponible autour de leur c'est sommairement dans table 1, ensemble à hypothèse autour de à eux origine (Mehdi et al. 1999). Malgré quelques-unes de ces hypothèse êtes sain- supporter m ( par exemple, les origine de les Parsis dans Iran), très êtes installé à one oral tradition et prendre pas été épreuve contre autre sources de témoignage.

Peu abondant genetic données êtes disponible pour ceux-ci Pakistanaise ethnique. groupes Plus tôt recherché de les ABO sang groupes et classique protéine l'étude de marché ont fait pas incluant toutes groupes et surtout classifié leur d'après à eux situer de résidence. UNE population arbre installé à one 54 classique enzyme l'étude de marché lieux les Risquer et Trajet dans les L'Ouest Asiatique se rassembler renfermer les le Nordest Caucasoids (désinvolte-Sforza et al. 1994). Dans une autre population arbre, installé à one 47 classique protéine polymorphisms, les Pakistanaise l'échantillon formel une petit subcluster à l'intérieur de les Indo- Européen interlocuteurs de Inde ( désinvolte-Sforza et al. 1994).

Les Y chromosome suppléer une unique source de genetic témoignage (Tyler- Forgeron 1999; Sans travail et Tyler- Forgeron 2000). Le porte les grand nonrecombining segment dans les gênes et renfermer nombreux écurie binaire l'étude de marché, incluant socle substitution (voyons, par exemple, Sournoise et al. 1997) et retroposon insertion ( éreinter 1994; Santos et al. 2000), quoi can être utilisée dans combinaison à plus de- rapide évoluer l'étude de marché, tel que microsatellites (voyons, par exemple, Ayub et al. 2000). Par conséquent, véritable détaillé Y phylogenies can être construire thanksggiving permettre mâle- spécifique aspects de genetic histoire à être étudier. Ceux-ci êtes énergiquement influence par le petit efficace population dimension de les Y chromosome, principal à rapide genetic sens général, et par le usage de patrilocality dans un grand nombre sociétés, principal à élevé égaliser de géographique différenciation de Y haplotypes. Quoique l'oeuvre de Qamar et al. (1999) one l'analyse de YAP+ chromosomes ( embrasser ~2.6% de les total) et analyse de STR variation (Ayub et al. 2000; Mohyuddin et al. 2001), peu travailler a été porté éteint one Pakistanaise Y chromosomes. Par conséquent, nous avons maintenant artiste une étendu analyse de Pakistanaise Y lignée, à déterminer se que éclairer ils can verser one les origine et genetic histoire de les subgroups thanksggiving se maquiller les Pakistanaise population.


Étoffe et Méthode

l'échantillon
Les Y chromosomes de 718 sans rapport mâle thème, appartenant à à 12 ethnique. groupes de Pakistan, étions analyzed (grande cuiller 1 et 2; figue. 1). Bien renseigné financier réel était obtenir de toutes entrant dans ça étudier. Une Epstein Caserne virus–transformed lymphoblastoid élément ligne était établir de chaque personnage, et DNA était soutirer de ceux-ci élément lignes pour analyse.


Binaire Polymorphism Écrivant

Nous type 15 SNPs, une Alu insertion ( éreinter 1994; Éreinter et Horai 1995), une Ligne insertion (Santos et al. 2000), et les 12f2 suppression (Casanova et al. 1985). Les socle substitution étions 92R7 C?T (Mathias et al. 1994); M9 C?G ( sournoise et al. 1997); SRY-2627 C?T (Bianchi et al. 1997); SRY-1532 uneG?UNE (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) Une?G (Seielstad et al. 1994); SRY-8299 G?Une (Santos et al. 1999a); Pertinent G?UNE ( panda et al. 1998); SRY +465 C?T ( tibia et al. 1999); LLY22g C?UNE et Tat T?C transition (Zerjal et al. 1997). Dans addition, les M17 l'étude de marché ( sournoise et al. 1997) était type, près de utilité de les premier livre GTGGTTGCTGGTTGTTACGT et AGCTGACCACAAACTGATGTAGA ont près de AflIII digestion de les PCR produire; les ancestral allele était pas digéré Les M20 signet (sournoise et al. 1997) était genotyped, près de utilité de les premier livre CACACAACAAGGCACCATC et GATTGGGTGTCTTCAGTGCT ont près de SspI digestion; les Une?G mutation dévaster l'endroit à position 118 dans les 413- fdp produire. M11 (sournoise et al. 1997) était type, utilisant les premier livre TTCATCACAAGGAGCATAAACAA et CCCTCCCTCTCTCCTTGTATTCTACC ont près de digestion à MspI. Les 215- fdp produit était digéré à 193- fdp et 22-fdp parcelle dans les dérivé de allele. Les RPS4Y C?T mutation (mont et al. 1999) était surprendre près de BslI restriction digestion de une 528- fdp PCR produire obtenir près de utilité de les premier livre CCACAGAGATGGTGTGGGTA et GAGTGGGAGGGACTGTGAGA. Les ancestral C allele renfermer deux sítios, et les dérivé de T allele renfermer une. M48 (sournoise et al. 1997), uneG, était type près de allele- spécifique PCR utilisant les qui a du discernement premier livre TGACAATTAGGATTAAGAATATTATA et TGACAATTAGGATTAAGAATATTATG et les usitée premier livre AAAATTCCAAGTTTCAGTGTCACATA à produire spécifique 145- fdp produire Les établir de Y binaire l'étude de marché alleles porté près de une unique personnage vouloir être soumettre à que “the Y haplogroup.”
De les 718 l'échantillon, 717 tombé en haplogroups attendu one les base de les sus phylogeny, mais une Trajet l'échantillon (PKH134) l'échec à amplifier dans les SRY –1532 et M17 loci. Il était assigné à haplogroup 3 one les base de interchangeable SRY –1532 premier livre ( des détails one requête) et son STR le profit.


Y-STR Écrivant
Cinq trinucleotide- répéter polymorphisms (DYS388, DYS392, DYS425, DYS426, et DYS436), dix tetranucleotide- répéter polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, et DYS439) et une pentanucleotide microsatellite (DYS438) étions type dans toutes Y chromosomes. Trois multiple PCR réaction étions artiste pour toutes Y-STRs, dans a10-µ financier primitif ultime réaction volume renfermer 20 ng gênes DNA, comme décrit dans autre part (Thomas et al. 1999; Ayub et al. 2000). PCR produire étions être valide one une ABI 377 série. ABIGS350 TAMRA était utilisée que les intérieur voie standard. Les GENESCAN et GENOTYPER software paquets étions utilisée à recueillir les données et à anal parcelle tailles Y-STR alleles étions nommé d'après le numéro de téléphone est de répéter unité ils contain.The numéroter de répéter unité était établir à travers les utilité de série répondant DNA l'échantillon. Allele morceau pour DYS389b étions obtenir près de soustraction de les DYS389II allele morceau de DYS389I.
Y-STR duplications étions établir à plusieurs loci. DYS393 était ronéotyper dans PKH165 (13 et 15) et DYS437 était ronéotyper dans SDH181 (8 et 9). UNE plus de la société échantillon était établir dans DYS425, où deux à quatre alleles étions établir dans 36 individus de haplogroups 8, 9, 13, et 21.


Données Analyse
Principal- des composants analyse était porté éteint one haplogroup fréquence près de utilité de les Échappéede vue ( visuel Statistiques) système software, version 5.0.2 (jeune et Interdit 1996). Pour vivant représentation, la première et second principal des composants étions traceur par le Microscope Fonction Suite Surpasser Paquet one Vitre 2000. Biallelic polymorphism données pour plusieurs mondial populations utilisée dans l'analyse étions obtenir de Éreinter et al. (2001). Mélange était supposée près de utilité de trois différent règle graduée: Long poids plus petit- équerre (WLS) règle graduée ( long 1991); monsieur, une plus petit- équerre évaluateur (robe et Hiorns 1965); et m? (Helgason et al. 2000).
Analyse de moléculaire écart (AMOVA) était porté éteint près de utilité de les Arlequin paquet (Schneider et al. 1997). AMOVA règle graduée les proportionner de mutation divergence établir à l'intérieur de et entre populations, respectivement. Malgré très de les variation dans les rapide mutation microsatellite loci c'est attendu à ont été produire dans les différent Pakistanaise subpopulations, les unique mutation événement épreuve dans les binaire loci êtes très plus vieux et prendre pas présence dans les le contrat de les subdivision de les Pakistanaise population. Nous inventer les suivant stratégie à exploiter les maximum somme de utile mutation informative de les Y-chromosome haplotypes. STR variation à l'intérieur de haplogroups était utilisée à supputer population pairwise FST évaluer pour chaque personnage haplogroup. Pour chaque population paire, une poids vouloir dire FST était calculé, où les évaluer obtenir pour chaque haplogroup était poids d'après les proportionner de pairwise comparaisons nécessiter thanksggiving haplogroup. Dans l'absence de une spécial haplogroup de une population, Une, de les paire UNE et B, FST était établir à 1, et le numéro de téléphone est de pairwise comparaisons était saisir que le numéro de téléphone est de chromosomes transportant thanksggiving haplogroup dans B. Évaluer de FST installé à one STRs seul ou one STRs signe plus binaire l'étude de marché, à binaire l'étude de marché indiqué une 10- plier supérieur pesamment, étions calculé pour comparaison. Dans tout de ceux-ci analyse, les distance matrice utilisée consistance de le numéro de téléphone est de étapes près de quoi chaque paire de haplotypes désaccord. Mantel tests pour un jour importance de corrélation entre FST évaluer étions porté éteint dans Arlequin, et multidimensional escalade (MDS) complots étions construire près de utilité de les SPSS version 7.0 software paquet.

Média- jonction réseaux étions construire près de Réseau 2.0b ( bandeau et al. 1999). UNE pesamment l'horaire à une cinq- plier portée était utilisée dans les construction de les réseaux. Les poids assigné étions fort spécifiques chaque haplogroup et prenions en terme les Y-STR variation en travers de les haplogroup dans l'ensemble Pakistanaise population. Les suivant poids étions utilisée écart 0-0.09, poids 5; écart 0.1-0.19, poids 4; écart 0.2-0.49, poids 3; écart 0.5-0.99, poids de 2; et écart 1.00, poids 1. Malgré ça, le réseau pour haplogroup 1 récipient un grand nombre élevé dimensional cube et était résolu près de appliquant les réduire média et média jonction réseau méthode sequentially. réduire média algorithme (bandeau et al. 1995) était utilisée à produire une *.rmf lime et les média jonction réseau méthode était appliquée à ça lime.

BATWING (Wilson et Chauve 1998), Bayesian Analyse de Tresse À Intérieur Noeuds Génération, était utilisée à évaluer les le temps aux très récent usitée ancêtre (TMRCA) de une établir de chromosomes. Ça répertoire emplois une Trace le président Le mois Carlo procédure à produire phylogenetic tresse et l'associé paramètre évaluer en accord avec énergie données ( une établir de Y haplotypes) et genetic et démographique modèles Les genetic travailler comme mannequin supposer unique- trace mutation de les STRs et les démographique travailler comme mannequin choisi était représentant tumeur de une initialement incessant- dimension population, à ou sans subdivision dans différent pistes de les répertoire Toutes 16 STR loci étions utilisée; sauterelle- spécifique mutation évaluer précédent probabilités installé à one les données de Kayser et al. (Kayser et al. 2000) étions construire pour un jour loci disponible que quartier de lard fumé distributions de du formulaire quartier de lard fumé(, b) où une = (1 + numéroter de mutation observer près de Kayser et al.), et b = (1 + numéroter de meioses). Pour loci pas étudier près de Kayser et al., les distribution quartier de lard fumé (1,416) était utilisée, quoi a une vouloir dire de 0.0024. UNE génération le temps de 25 l'année était supposé. Donc les 95% confiance récréation indiqué tenir compte de incertitude dans mutation évaluer, population tumeur et ( où s'approprier) subdivision, mais pas génération le temps.

Résultat

Y-Chromosome Binaire Polymorphisms
Les 18 binaire l'étude de marché utilisée identifier 20 haplogroups dans mondial populations figue 1A), mais unique 11 étions établir dans Pakistan, et 5 représenté 92% de les l'échantillon ( figue. 1 et table 2). Haplogroups 1 et 9 étions le présent dans toutes Pakistanaise populations interroger, haplogroup 3 était le présent dans toutes à l'exception de les Risquer, et haplogroup 28 était le présent dans toutes à l'exception de les Risquer et les Kashmiris. Le sudouest populations être visible supérieur fréquence de hg 9 et les YAP+ haplogroups 21 et 8 que le Nordest populations ( figues. 1D–E), mais, total, peu géographique se rassembler de haplogroup fréquence c'est apparent à l'intérieur de les le compteur.


Principal- Des composants Analyse
Nous souhaiter à la société les Pakistanaise Y haplogroup données à données de populations de les support de les mondial. Pas de qui convient données établir était disponible pour un jour tout établir de 18 l'étude de marché, mais les données de Éreinter et al. (2001) permis tout mais 5 être âgé utilisée, parce que les mêmes ou phylogenetically équivalent l'étude de marché étions signaler. principal- des composants analyse figue 2A) démonstrations quelques-unes différences de l'original analyse de Éreinter et al., les principaux une être les locataire séparation de les Africain populations. Ça c'est dû à, une grand étendue, aux subset de l'étude de marché utilisée, quoi fait pas incluant un grand nombre de les Afrique- spécifique soi même. Très Pakistanaise populations se rassembler à Le Sud Asiatique et Taille L'Est populations, et êtes fermer à Le Nordest Africain, Central Asiatique et Européen populations, donc projection une général siding à geographically fermer populations. Les une exception c'est les Risquer, qui êtes tout à fait tranché. UNE similaire analyse de les Pakistanaise populations seul, utilisant tout de les binaire l'étude de marché ( figue. 2B), ratifier les désaccord entre les Risquer et les autre populations et aussi plus de manifestement démonstrations les clarté de les Kalash et les Parsis. Le c'est saisissante thanksggiving les langue isolate–speaking Burundi et les Dravidian- s'entretenir Brahuis font pas ressortir dans ceux-ci analyse.


Mélange Évaluer
Hypothèse autour de population origine ( table 1) can être prendre en considération que quantitative question autour de mélange. Par exemple, à épreuve les éventualité thanksggiving les Balustre Y chromosomes prendre une Syrie origine, nous can prier se que proportionner de les Balustre Ys êtes dérivé de de Syrie et se que proportionner êtes de Pakistan ( prendre en considération être âgé les Pakistanaise l'échantillon signe moins les Balustre). Données one suggérer source populations étions saisir de les prospectus et trois règle graduée de mélange étions calculé. Les trois évaluer donné largement logique résultat, à petit systématique différences typiquement m? > monsieur > Long WLS pour un jour supposée contribution de les extérieur source population ( table 3). Ceux-ci résultat suppléer témoignage pour une extérieur contribution aux Risquer, Kalash, Nègre Makrani, et Parsis mais pas aux autre populations.


Y-Chromosome STR Polymorphisms
Y-STR polymorphisms étions recherché à obtenir une plus de détaillé vue de Y variation, parmi les différent Pakistanaise ethnique. groupes, thanksggiving would être moins de partial par le l'étude de marché-ascertainment procédure Les variété de Y-STR haplotypes ( table 4) était le plus bas pour un jour Risquer (0.893) que suggérer près de précédent analyse (Ayub et al. 2000).
Les 16 Y-STRs déterminer 502 Y haplotypes, les vaste plus grande partie être observer dans unique individus Les qui reste haplotypes étions quote-part près de 2–18 individus ( des détails êtes indiqué dans les online- unique supplémentaire table). Dans toutes étui mais une, les chromosomes quote-part une haplotype appartenu à aux pareille haplogroup ( de là, 503 combinaison haplotypes) et, dans très étui, les individus quote-part une haplotype appartenu à aux pareille population (table 5).

Les GST et modalité dimension de les répéter unité, pour toutes 16 Y-STRs interroger dans les Pakistanaise population, êtes indiqué dans table 6. Les corrélation entre l'étude de marché heterozygosity et GST était établir pas à être significative (r0.329=; P=.213). Les modalité dimension et écart de les 16 Y-STRs à l'intérieur de haplogroups 1, 2, 3, 8, 9, 10, 21, 26, et 28 c'est aussi indiqué dans table 6. Sûr haplogroups prendre une différent modalité allele dimension, et quelques-unes exemple de cette êtes être visible dans caractères gras italique dans table 6. Pour exemple, DYS388 a 15 répéter dans haplogroup 9, la société à 12 répéter dans la plus grande partie de les autre haplogroups dans Pakistan. De la même façon, les modalité allele pour DYS438 c'est 9 dans haplogroup 9, mais 10 ou 11 dans les autre haplogroups. Les modalité allele pour DYS434 pour haplogroup 10 c'est 11, quoi c'est remarquablement différent de les allele dimension de ça sauterelle dans autre haplogroups. Les remplir manque de variabilité pour DYS436 dans les 233 mâle thème appartenant à à haplogroup 3 c'est notable. Haplogroup 10 paraît à prendre le plus petit variabilité en travers de très loci à l'exception de pour DYS390 ( table 6). Ceux-ci résultats prouver les vigoureux découpage de Y-STR variabilité près de haplogroup.

Nous désiré à supputer une Y- installé à règle graduée de genetic distance entre populations thanksggiving would réfléchir les différenciation thanksggiving eu présence à l'intérieur de Pakistan et thanksggiving would pas être disproportionné dominer près de vieux différences thanksggiving eu précédemment accumulé entre haplogroups. standard voie à font ça would être à utilité STR variation, et table 7 sommairement population pairwise évaluer de FST one les base de STR variation seul ( une) ou de binaire- signet signe plus STR variation (B), à binaire- l'étude de marché différences poids 10 le temps supérieur que STR différences. Ceux-ci matrices êtes très mettre en corrélation (r0.95=; P.001<), que puissance être attendu de les découpage de STR variation près de haplogroup. Toutefois, ceux-ci règle graduée êtes significative influence près de vieux différences, et nous avons par conséquent développé une modified règle graduée. Nous raisonné thanksggiving très de les STR variation à l'intérieur de haplogroups would prendre originelle récemment et pouvions être utilisée pour ça intention Nous par conséquent calculé population pairwise évaluer de FST, one les base de STR variation à l'intérieur de haplogroups, et utilisée une poids moyenne de ces à produire une unique FST distance matrice ( table 7C; figue. 3). Ceux-ci distance êtes aussi très mettre en corrélation à distance installé à one STRs seul (r0.76=; P.001<) ou one STRs signe plus binaire l'étude de marché (r0.70=; P.001<), mais une grand proportionner de les variation c'est vu entre populations (22%, la société à 6% et 7%, respectivement). UNE comparaison de forme 3 à forme 2B ( quoi était installé à one binaire l'étude de marché fréquence seul) révéler une saisissante total ressemblance, à les Risquer être tranché de tout de les autre populations. Les autre remarquable populations êtes les Kalash et Parsis (que précédemment), les Kashmiris (peut-être parce que les petit l'échantillon), et les Brahuis, qui êtes donc plus de tranché dans à eux STR le profit que haplogroup fréquence. MDS complots de les distance dans grande cuiller 7A et 7B ( pas être visible) être à la tête de à similaire conclusion, mais ressembler à forme 2B plus de étroitement dans l'entrée thanksggiving les Brahuis font pas être situé éteint tellement.


Média- Jonction Réseaux
Les genetic relations parmi les différent Pakistanaise ethnique. groupes étions étudier supplémentaire près de dessin média- jonction réseaux ( bandeau et al. 1995), et exemple êtes être visible dans numéros 4, 5, et 6. Les haplogroup 1 réseau figue 4) révéler considérable variation, mais aussi une élevé grade de population- spécifique substructure. Par exemple, les 24 Parsi haplogroup 1 chromosomes toutes chute en une de trois se rassembler ( figue. 4, verte), 19 de 26 Burundi haplogroup 1 chromosomes chute en deux se rassembler ( bleu), et 12 de 14 Risquer haplogroup 1 chromosomes chute en une unique se rassembler, et toutes de ces se rassembler êtes spécifique à à eux respective populations. Les haplogroup 10 réseau figue 5) c'est très simple, parce que les petit numéroter de chromosomes, mais à nouveau révéler population- spécifique se rassembler pour Burundi et Risquer haplotypes. Les haplogroup 28 réseau ( figue. 6) démonstrations une saisissante isolé Parsi- spécifique se rassembler, à la fin de une long succursale, renfermer 15 de 16 Parsi haplogroup 28 chromosomes. Se rassembler de Kalash, Burundi, and—to une locataire degree—Baluch chromosomes êtes aussi évident, malgré une Balustre haplotype c'est quote-part à Sindhi et Makrani Balustre individus de près de le sudest populations.
BATWING TMRCAs étions calculé pour un jour haplogroup 28 réseau et pour sélectionnée lignée dans quelques numéroter de haplogroups. Les résultats êtes sommairement dans table 8.

Débat

Nous avons porté là-bas première étendu analyse de Y variété à l'intérieur de Pakistan, examining 34 l'étude de marché dans 718 mâle thème de 12 populations Ça permit nous à la société Pakistanaise Y variété à thanksggiving précédemment signaler dans mondial populations, à étudier différences à l'intérieur de Pakistan, et à évaluer quelques-unes de les suggérer population historienne de une Y perspective.


Comparaisons à Mondial Données
Dans une mondial comparaison, Pakistanaise populations surtout se rassembler autour de une poule Le Sud Asiatique l'échantillon et binds fermer à une Taille Oriental l'échantillon ( figue. 2A). Ça résultats c'est unsurprising, dans pièce parce que les Le Sud Asiatique l'échantillon incluant 62 Pakistanaise individus ( c'est à dire, 32% de 196 total) et dans pièce parce que Y variation dans un grand nombre secteurs de les mondial c'est surtout structure près de géographie, pas près de langue ou ethnique. affilier (Rosser et al. 2000; Zerjal et al. 2001). Les grand genetic siding de Pakistanaise populations à là dans l'Ouest que à l'Est populations c'est illustré par le l'usine thanksggiving quatre de les cinq fréquenter haplogroups dans Pakistan (haplogroups 1, 2, 3, et 9, quoi ensemble se maquiller 79% de les total population) êtes aussi fréquenter dans ouest Asie et L'euro mais pas dans Porcelaine ou Japon; réciproquement, les haplogroups thanksggiving êtes fréquenter dans L'Est Asie ( par exemple, 4, 5, 10, 13, et 20) êtes saignant ou s'absenter dans Pakistan, formel unique 2.5% de les total Si, que dans quelques-unes interprétation, une plus tôt exode de Afrique le long de les le sudest littoral de Asie led aux première anatomiquement moderne être humain populations dans Pakistan, et ceux-ci peupler porté les l'Est haplogroups ou à eux précurseur, à eux Y chromosomes prendre maintenant été grand replacer près de ultérieur émigration ou gene s'écouler; vraiment, les representative de les l'Est haplogroups dans Pakistan Mai être dérivé de de moderne verso- émigration, pas de vieux survivants.
Les cinquième haplogroup thanksggiving c'est usitée dans Pakistan, haplogroup 28, être différent de toutes les autre dans son distribution. À l'intérieur de Pakistan, le ont en haut 14% de notre l'échantillon et était le présent dans tout mais deux populations ( tous les deux de quoi eu véritable petit l'échantillon tailles), tellement le c'est tous les deux usitée et très répandu À l'extérieur de Pakistan et les près de countries, toutefois, le c'est saignant. Le a été signaler dans Inde (30%; le présent dans 3/3 populations), Tajikistan (10%; le présent dans 5/6 populations), et Uzbekistan (3%; le présent dans 10/13 populations), mais le c'est saignant dans Russie (0.4%; le présent dans 1/6 populations) et les Caucase (1.4%; le présent dans 1/6 populations (sain et al. 2001) et a pas été établir du tout dans Porcelaine ou Mongolie ( inédit surveillance BATWING évaluer de les TMRCA de les Pakistanaise haplogroup 28 chromosomes étions ~7,000 (4,000–14,000) l'année ( table 8). Donc, à l'intérieur de ça le temps époque, les Pakistanaise populations prendre diverger de une usitée ancestral population ou prendre expérimenté considérable mâle gene s'écouler entre eux-mêmes ou de une usitée source. Puisque les supposée âge correspondre aux plus tôt Neolithic époque, les étendre de cette lignée puissance être l'associé à les local expansion de fermiers.


Comparaisons à l'intérieur de Pakistan
Haplogroup distributions dans Pakistanaise populations, à l'exception de les Risquer ( discuter de dans les suvant section), êtes remarquablement semblable à l'une l'autre ( figues. 1 et 2), malgré quelques-unes notable linguistique différences. Vraiment, les langue isoler- s'entretenir Burundi, les Dravidian- s'entretenir Brahuis, et les Sino-Tibetan–speaking Balti ont fait pas ressortir de les autre populations du tout dans les haplogroup analyse ( table 2 et figue. 2), suggestion soit soit thanksggiving les linguistique différences élevé à la suite les usitée Y échantillon était établir ou thanksggiving y a été suffisante Y gene s'écouler entre populations à éliminer tout paraphé différences Pourtant une plus de détaillé analyse de les Y haplotypes ( par exemple, figues. 3–6) révéler quelques-unes tranché caractères de les Brahui et considérable population spécificité; population- spécifique se rassembler de apparenté haplotypes êtes généralement établir dans ceux-ci réseaux Tellement se rassembler vouloir unique être vu si populations êtes isolé de l'une l'autre. Le Mai être thanksggiving une mugir grade de gene s'écouler entre populations terminé une longtemps c'est suffisante à se terminer par similaire haplogroup fréquence sans produire un grand nombre quote-part se rassembler.
Population- spécifique se rassembler de haplotypes êtes particulièrement évident dans quelques-unes populations. Dans les Risquer, où les tranché haplogroup fréquence la remarque en haut êtes établir, très chromosomes (19/23; 83%) chute en une de deux seulement sain- isolé se rassembler ( figues. 4 et 5), tandis que les Parsis, les Kalash, et les Burundi aussi être visible proéminent se rassembler. Les Risquer, Parsis, et Kalash étions les trois populations projection les très significative différent population pairwise FST évaluer. Les élevé évaluer de les Risquer et Parsis can partiellement être raconté pour près de émigration à Pakistan de autre lieux, mais une contribution l'usine c'est vraisemblable à être sens général, soit soit due à une restreint numéroter de sombrer lignée ou présence ultérieurement à l'intérieur de petit populations. Tk évaluer (Ewens 1972) suppléer une voie de comparaison efficace population tailles. Évaluer installé à one les STRs pour un jour Risquer, Parsis, Kalash, et Burushos étions 8.9, 77.5, 25.8, et 74.2, respectivement, la société à une vouloir dire de 181.8 pour un jour autre populations à l'échantillon tailles >20. Efficace population dimension pour Y chromosomes can être différent très de recensement population dimension, mais le c'est notable thanksggiving les Parsis et Kalash font prendre les petit recensement tailles, une- centième ou une- millième de la plus grande partie de là de les autre populations (table 1), tellement ceux-ci petit recensement tailles Mai ont été soutenir longuement. Dans sommaire, un grand nombre caractères de les le présent Pakistanaise Y haplotype distributions can être représenté près de une quote-part ancestral gene poule, à restreint gene s'écouler entre populations et sens général dans les plus petites soi même.


Perspicacité en Population Origine
Les suggérer population origine ( table 1) can maintenant être prendre en considération dans l'illumination de ces Y résultat. Informative c'est suppléer près de haplogroup fréquence, quoi can être utilisée à produire mélange évaluer, et ceux-ci êtes facile à servir d'interprète si populations êtes grand et isolé et les source populations prendre différent fréquence. Quand ceux-ci conditions êtes pas met, les le présent de tranché Y lignée can tranquille être informative Les origine de les Parsis êtes sain- document (Nanavutty 1997) et donc suppléer une utile épreuve étui. Ils sont serviteur de les Iranien la proposition Zoroaster, qui émigrer à Inde à la suite l'écroulement de les Sassanian empire dans le 7 siècle a.d. Ils réglé dans 900 a.d. dans Gujarat, Inde, où ils étaient appelé les “Parsi” ( signification “from Iran). Finalement ils ont déplacé à Marmotter dans Inde et Karachi dans Pakistan, de où les le présent population était l'échantillon ( figue. 7). À eux fréquence pour haplogroups 3 (8%) et 9 (39%) font vraiment ressembler à là dans Iran plus de que là de à eux tendance voisines dans Pakistan. Ils être visible les le plus bas fréquence pour haplogroup 3 dans Pakistan (à part de les Risquer; figue 1C). Les vouloir dire pour huit Iranien populations était 14% (n401=) (Quintana-Murci et al. 2001), tandis que thanksggiving pour Pakistan, exclure les Parsis, était 36%. correspondre numéros pour haplogroup 9 étions 39% dans les Parsis, 40% dans Iran, et 15% dans Pakistan exclure les Parsis. Ceux-ci numéros être à la tête de à une mélange évaluer de 100% de Iran ( table 3). Indiqué les petit efficace population dimension de les Parsis, les proximité de à eux être assorti aux Iranien données Mai être fortuit, et les présence de haplogroup 28 chromosomes à 18% (4% dans Iran; Sain et al. 2001) suggérer quelques-unes gene s'écouler de l'alentours populations Les TMRCA pour les Parsi- spécifique se rassembler dans les haplogroup 28 réseaux était 1,800 (600–4,500) années (table 8), en accord avec les émigration de une petit numéroter de lignée de Iran Total, ces résultats la démonstration une fermer être assorti entre les historique récit et les Y données, et donc suggérer thanksggiving les Y données seront utile quand moins de historique informative c'est disponible.
Les population thanksggiving c'est genetically très tranché, les Risquer, réclamer origine de Genghis Khan’s armée; à eux réputation c'est dérivé de de les Persan rédiger “hazar,” signification “thousand,” parce que troupes étions êtes parti postérieur dans indifférence de mille. À l'égard de les la fin de le 19 siècle, quelques-unes Risquer mouvrions de Afghanistan aux Khurram Vallée dans Pakistan, les source de les échantillons étudier voici Donc, à eux oral histoire identifiants une origine dans Mongolie et population goulots ~800 et ~100 l'année il y a. De les deux prédominant Y haplogroups le présent dans ça population, haplogroup 1 c'est très répandu dans Pakistan, très de Asie, L'euro, et les Amérique, et donc suppléer peu des renseignements concernant la place de origine. Haplogroup 10, dans le contrat, c'est saignant dans très Pakistanaise populations (1.4%, quand les Risquer êtes exclure) mais c'est usitée dans L'Est Asie, incluant Mongolie, où le fait en haut terminé la moitié de les population (inédit résultat). Mélange évaluer ( table 3) êtes en accord avec une substantiel contribution de Mongolie. BATWING analyse de les Risquer- spécifique haplotype se rassembler dans haplogroups 1 et 10 suggérer TMRCAs de 400 (120–1,200) et 100 (6–600) l'année ( table 8), respectivement Donc, les genetic témoignage c'est logique à les oral tradition et, en vue de son indépendant plain, suppléer vigoureux supporter pour le ( figue. 7).

Quelques-unes autre suggérer origine recevoir plus de restreint supporter de les Y données. Les Nègre Makrani, à une postuler origine dans Afrique, voter les supérieur fréquence de haplogroup 8 chromosomes établir dans tout Pakistanaise population, que la remarque autre part (Qamar et al. 1999). Ça haplogroup c'est grand réduit à sub-Saharan Afrique, où le constituer autour de la moitié de les population (éreinter et al. 2001) et can donc être respect que une l'étude de marché de Africain Y chromosomes. Néanmoins, le fait en haut unique 9% de les Nègre Makrani l'échantillon, et haplogroup 28 (le long de avec d'autres typique Pakistanaise haplogroups) c'est le présent dans ce population. Si les Y chromosomes étions paraphé Africain ( figue. 7), très prendre ultérieurement été replacer: les total évaluer de les Africain contribution c'est ~12% ( table 3).

Les Balti êtes réflexion à prendre originelle dans Tibet, où les prédominant haplogroups êtes 4 et 26. Ni l'un ni l'autre était le présent dans les échantillons de ça étudier, à condition que pas de supporter pour une Tibet origine de les Y chromosome lignée et une mélange évaluer de zéro ( table 3). Toutefois, ça résultat doit être interprète à prudence, parce que le menu fretin l'échantillon dimension. Trois populations prendre possible origine de les armées de Alexander les Grand: les Burundi, les Kalash, et les Trajet. Moderne Grecque être visible une modérément élevé fréquence de haplogroup 21 (28%; Rosser et al. 2000), mais ça haplogroup était pas vu dans soit soit les Burundi ou les Kalash l'échantillon et était établir dans unique 2% de les Trajet, tandis que les local haplogroup 28 était le présent à 17%, 25%, et 13%, respectivement. Grecque- mélange évaluer de 0% étions obtenir pour un jour Burundi et les Trajet, mais numéros de 20–40%% étions observer pour les Kalash ( table 3). Dans vue de l'absence de haplogroup 21, nous attribuer ça résultat soit soit à sens général dans les fréquence de les autre haplogroups, particulièrement haplogroups 2 et 1, ou aux pauvre résolution de lignée à l'intérieur de ceux-ci haplogroups, résultat dans tranché lignée être classifié en les mêmes paraphyletic haplogroups. Total, pas de supporter pour une Grecque origine de à eux Y chromosomes était établir, mais ça conclusion fait vouloir les supposition thanksggiving moderne Grecque êtes representative de Alexander’s armées. Deux populations, les Kashmiris et les Trajet, aussi élaborer réclamer à une possible Juive origine Juive populations généralement prendre une se modérer fréquence de haplogroup 21 (par exemple, 20%) et une élevé fréquence de haplogroup 9 (par exemple, 36%; ( éreinter et al. 2000). Les fréquence de tous les deux de ces haplogroups êtes mugir dans les Kashmiris et Trajet, et haplogroup 28 c'est le présent à 13% dans les Trajet, tellement pas de supporter pour une Juive origine c'est établir, et les mélange évaluer était 0% ( table 3), malgré, à nouveau, ça conclusion c'est restreint tous les deux par le petit l'échantillon dimension disponible de Kashmir et par le supposition thanksggiving les moderne échantillons êtes representative de vieux populations.

Les suggérer origine de les Balustre est au lit Syrie. Syrie, semblable à Iranien, êtes caractériser près de une mugir fréquence de haplogroup 3 et une élevé fréquence de haplogroup 9 (9% et 57%, respectivement; Éreinter et al. 2000), tandis que les correspondre fréquence dans les Balustre êtes 29% et 12%. Ça désaccord et les élevé fréquence de haplogroup 28 dans les Balustre (29%) font une surtout Syrie origine pour à eux Y chromosome invraisemblable, et les mélange évaluer était 0% (table 3), malgré les 8% fréquence pour haplogroup 21, les supérieur identifiants dans Pakistan donc loin, fait signaler quelques-unes l'Ouest contribution à à eux Y lignée. Brahuis prendre une possible origine dans L'Ouest Asie (Hughes- Balle 1991) et le a été suggérer thanksggiving une étendre de haplogroup 9 Y chromosomes était associé à l'expansion de Dravidian- s'entretenir fermiers (Quintana-Murci et al. 2001). Brahuis prendre les supérieur fréquence de haplogroup 9 chromosomes dans Pakistan (28%) à la suite les Parsis, à condition que quelques-unes supporter pour ça hypothèse, mais à eux supérieur fréquence de haplogroup 3 (39%) c'est pas typique de les Fertile Rue en arc de cercle (Quintana-Murci et al. 2001) et suggérer une plus de la société origine, peut-être à mélange de ultérieur émigration, tel que là de Indo- Iranien interlocuteurs de les steppe de Central Asie et autre de supplémentaire l'Est Ça éventualité c'est supporter m par le détection de mugir fréquence de haplogroups 10, 12, et 13 dans les Brahuis, toutes saignant dans Pakistan et typique de L'Est Asie, L'Est et le Nordest Asie, et Le sudest Asie, respectivement.

Les l'échec à trouver une Y unir à une suggérer population de origine fait pas réfuter une historique society, mais le fait prouver thanksggiving les Y chromosomes dérivé de de tellement historique événement épreuve ont été égaré ou replacer. Analyse de mitochondrial DNA et autre loci would aider à élucider les population historienne et would être particulièrement intéressant dans populations semblable à les Nègre Makrani et les Balti, dans lequel il y a une le contrat entre les phenotype et les typique Pakistanaise Y haplotypes.

Remerciement

Ça travailler était supporter m près de une Wellcome Trust Collaboration Recherche Initiative Subvention à S.Q.M. T.Z. était aussi supporter m par le Wellcome Trust, et C.T.-S. par le Annulé Recherche Faire campagne. Nous rapide notre valorisation aux originelle DNA donateurs qui ont ça étudier possible. Les Service de Santé de les Ministère de l'état de Baluchistan et les Balustre Étudiante Fédération, Quetta, Pakistan, secourir dans les retrait de les Brahui et Balustre l'échantillon. Trajet l'échantillon étions recueillir avec l'aide de les Service de Pédiatrie, Dame Lecture Poteau Obtenir un diplôme d'université Médical L'hôpital, Peshawar, Pakistan Nous sommes aussi reconnaissant à Dr. moi Kazmi et les Aga Khan Fondement Rural Santé Supporter Répertoire pour à eux secours dans les retrait de Burundi l'échantillon. Dr. F. Sethna suppléer précieux secours dans les retrait de les Parsi l'échantillon. Nous remercier Luis Quintana-Murci pour son faire des remarques one les manuscrit.


Électronique- Base de données Informative

URLs pour données dans ce article êtes comme suit:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Réseau 2.0, http:/www.fluxus-engineering.com/.
/ Échappéede vue, http:/forrest.psych.unc.edu/.

Postes

Ahmad AKN (1952) Jésuite dans paradis one terre. Les Civil et Militaire Dictionnaire géographique Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin Une, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Forgeron C (2000) Identification et characterisation de Novembre être humain Y-chromosomal microsatellites de série base de données informative. Nucléaire Acides Res 28e8: [ libérer Repli texte dans PMC].
Coup de revers PC (1992) Balti. dans Coup de revers PC, Radloff CF (eds) Sociolinguistic étude de le Nordest Pakistan. Vol 2, Langue de septentrionale la zone Ressortissant Établir de Pakistan Recherché, Islamabad, pp 3–27.
Bandeau HJ, Abandonner P, Rohl UNE (1999) Média- jonction réseaux pour inferring intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ libérer Manuel plein].
Bandeau HJ, Abandonner P, Sykes BC, Richards MB (1995) Mitochondrial portrait de être humain populations utilisant média réseaux. Génétique 141743–753: [PubMed] [ libérer Manuel plein].
Sonnette HW (1979) Les race de Afghanistan. Chanté- financier préalablement-Meel Publications, Lahore, Pakistan.
Sonnette HW (1998) Une information en les ethnography de Afghanistan Avant-garde Livres, Lahore, Pakistan.
Mont AW, Wang C-Y, Tsai J, Jefferson K, Dey C, Forgeron KD, Parquer à S-C, Tsai S-J, Mine d'or D (1999) Une Asian–Native Américain paternelle lignée identifiants près de RPS4Y resequencing et près de microsatellite haplotyping. Anne Vrombissement Genet 6363–80: [PubMed] [manuel plein].
Bianchi Pas de, Bailliet G, Bravant CM, Carnage RF, Rothhammer F, Martini- Souci VL, Pénal SD (1997) Origine de Amerindians Y-chromosomes que déduire par le analyse de six polymorphic l'étude de marché. Suis J Physique Anthropol 10279–89: [PubMed] [ manuel plein].
Biddulph J (1977) Tribus de les Biche Koosh. Indus Publications, Karachi, Pakistan.
Burton RF (1851) Sindh et les race thanksggiving habiter les vallée de les Indus. WH Allen et Co Ltd, Londres.
Chant de Noël O (1958) Les Trajet. Oxford Université Repasser, Karachi, Pakistan.
Casanova M, Leroy P, Boucekkine C, Weissenbach J, Évêque C, Membre M, Purrello M, Fjord G, Siniscalco M (1985) UNE être humain Y- unir DNA polymorphism et son potentielle pour opinion genetic et évolution distance Science 2301403–1406: [PubMed].
Désinvolte-Sforza LL, Menozzi P, Piazza UNE (1994) L'histoire et géographie de être humain genes. Prince Université Repasser, Prince.
Vallées GF (1991) Les phénomène de les Indus civilisation. dans Jansen M, Méditer M, Urbain G (eds) Forgotten villes one les Indus: tôt civilisation dans Pakistan de le 8 aux 2nd millénaires BC. Verlag Philippines von Zabern, Principal, Allemagne, pp 129–144.
Decker KD (1992) Sociolinguistic étude de Le Nordest Pakistan. Vol 5, Langue de Chitral. Ressortissant Établir de Pakistan Recherché, Islamabad.
Ewens WJ (1972) L'échantillonnage théorie de ºa recrutement sélectif point mort alleles. Théorème Peuple Biol 387–112: [PubMed].
Saleté BF (1992) Ethnologie: langue de les mondial. Été Établir de Linguistique, Tardé.
Éreinter MF (1994) UNE récent insertion de une Alu élément one les Y chromosome c'est une utile l'étude de marché pour être humain population recherché. Mol Biol Evol 11749–761: [PubMed] [libérer Manuel plein].
Éreinter MF, Horai S (1995) Y chromosomal DNA variation et les peupler de Japon. Suis J Vrombissement Genet 56951–962: [PubMed].
Éreinter MF, Karachi TM, Rougir AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarchical échantillon de mondial être humain Y-chromosome variété Mol Biol Evol 181189–1203: [PubMed] [ libérer Manuel plein].
Éreinter MF, Rougir AJ, Bois ET, Capuchon Monsieur, Jarjanazi H, Karachi T, Santachiara-Benerecetti S, Oppenheim Une, Sans travail MA, Jenkins T, Ostrer H, Capuchon-Tamir B (2000) Juive et Taille L'Est non- Juive populations quote-part une usitée poule de Y-chromosome biallelic haplotypes. Proc Natl Académie Sci USAS 976769–6774: [ libérer Repli texte dans PMC].
Helgason Une, Sigurdardottir S, Nicolas J, Sykes B, Montagne EW, Bradley DG, Bosnes V, Gulcher JR, Section électorale R, Stefansson K (2000) Opinion Scandinave et Gaélique ascendance dans les mâle colonisatrice de Islande. Suis J Vrombissement Genet 67697–717: [PubMed] [ libérer Manuel plein].
Hughes- Balle R (1991) Impérial dictionnaire géographique de Inde: provincial série, Baluchistan. Chanté- financier préalablement-Meel, Lahore, Pakistan.
Hussain J (1997) UNE histoire de les peupler de Pakistan à l'égard de indépendance. Oxford Université Le présent, Karachi, Pakistan.
Ibbetson D (1883) Panjab classe sociale Chanté- financier préalablement-Meel, Lahore, Pakistan.
Jarrige JF (1991) Mehrgarh: son situer dans l'évolution de vieux culture dans Pakistan. dans Jansen M, Méditer M, Urbain G (eds) Forgotten villes one les Indus: tôt civilisation dans Pakistan de le 8 aux 2nd millénaires BC. Verlag Philippines von Zabern, Principal, Allemagne, pp 34–50.
Sans travail MA, Tyler- Forgeron C (2000) Nouvelle emplois pour nouvelle haplotypes: les être humain Y chromosome, maladie et tri Tendance Genet 16356–362: [PubMed] [ repli Texte].
Karachi TM, Zegura SL, Posukh O, Osipova Financier primitif, Mont Une, Long J, Mine d'or D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffiths RC, Temple Dai, Éreinter MF (1999) Ancestral Asiatique sources() de nouvelle mondial Y-chromosome sombrer haplotypes. Suis J Vrombissement Genet 64817–831: [PubMed] [libérer Manuel plein].
Kayser M, Roewer Financier primitif, Hedman M, Henke Financier primitif, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila UNE (2000) Caractéristique et fréquence de germline mutation à microsatellite loci de les être humain Y chromosome, que révéler près de ======================================= surveillance dans père/ fils paires. Suis J Vrombissement Genet 661580–1588: [PubMed] [ libérer Manuel plein].
Kwok C, Tyler- Forgeron C, Mendonca BB, Hughes Moi, Berkovitz GD, Goodfellow PN, Faucon JR (1996) Mutation analyse de les 2 kb 5' à SRY dans XY femmes et XY se croiser thème J Med Genet 33465–468: [PubMed].
Long JC (1991) Les genetic structure de mélangé populations. Génétique 127417–428: [PubMed] [libérer Manuel plein].
Mathias N, Aboyé M, Tyler- Forgeron C (1994) Très informative enclos haplotypes pour les être humain Y chromosome. Vrombissement Mol Genet 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansoor Une, Ismail M, Éreinter MF, Sournoise Papa, Désinvolte-Sforza LL (1999) Les origine de Pakistanaise populations témoignage de Y chromosome l'étude de marché. dans Papiha SS, Deka R, Chakraborty R (eds) Gênes variété: candidatures dans être humain population génétique Kluwer Universitaire/Plenum L'éditeur, Nouvelle York, pp 83–90.
Mohyuddin Une, Ayub Q, Qamar R, Zerjal T, Helgason Une, Mehdi SQ, Tyler- Forgeron C (2001) Y-chromosomal STR haplotypes dans Pakistanaise populations Judiciaire Sci Int 118141–146: [PubMed] [manuel plein].
Nanavutty P (1997) Les Parsis. Ressortissant Réserver Trust, Nouvelle Delhi, Inde.
Panda Une, Roi TE, Santos FR, Taylor PG, Thangaraj K, Célébrer Financier primitif, Sans travail MA, Tyler- Forgeron C (1998) UNE polymorphic être humain Y-chromosomal G à UNE transition établir dans Inde. Ind J Vrombissement Genet 452–61:.
Qamar R, Ayub Q, Khaliq S, Mansoor Une, Karachi T, Mehdi SQ, Éreinter MF (1999) Africain et Levantine origine de Pakistanaise YAP+ Y chromosomes. Vrombissement Biol 71745–755: [PubMed].
Quddus SA (1990) Les tribal Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Quintana-Murci Financier primitif, Krausz C, Zerjal T, Sayar SH, Éreinter MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin Une, Radhakrishna U, Sans travail MA, Tyler- Forgeron C, McElreavey K (2001) Y-chromosome lignée tracer diffusion de peupler et langue dans le sudouest Asie. Suis J Vrombissement Genet 68537–542: [PubMed] [libérer Manuel plein].
Robe DF, Hiorns R (1965) Méthode de analyse de les genetic rédaction de une hybride population. Vrombissement Biol 3738–43:.
Robertson GS (1896) Les Kafirs de les Hindou-Kush. Oxford Université Repasser, Karachi, Pakistan.
Rosser ZH, Zerjal T, Lancé Myself, Adojaan M, Alavantic D, Amoral Une, Amos W, et al (2000) Y-chromosomal variété dºeurope c'est sceller et influence principalement près de géographie, plutôt que près de langue. Suis J Vrombissement Genet 671526–1543: [PubMed] [ libérer Manuel plein].
Santos FR, Carvalho- En argent DR, Pénal SDJ (1999a) PCR- installé à DNA profil de être humain Y chromosomes. dans Epplen JT, Lubjuhn T (eds) Méthode et outils dans biosciences et remède. Birkhauser Verlag, Sans base, Suisse, pp 133–152.
Santos FR, Panda Une, Kayser M, Mitchell RJ, Liu Une, Célébrer Financier primitif, Dévaster- Bison G, Novelletto Une, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Forgeron C (2000) UNE polymorphic L1 retroposon insertion dans les centromere de l'humaniste Y chromosome. Vrombissement Mol Genet 9421–430: [PubMed] [ libérer Manuel plein].
Santos FR, Panda Une, Tyler- Forgeron C, Pénal SD, Schanfield M, Leonard WR, Osipova Financier primitif, Crawford MH, Mitchell RJ (1999b) Les central Sibérie origine pour natif Américain Y chromosomes. Suis J Vrombissement Genet 64619–628: [PubMed] [ libérer Manuel plein].
Schneider S, Kueffer J-M, Roessli D, Excoffier FINANCIER PRIMITIF (1997) Arlequin ver 1.1: une software pour population genetic données analyse Génétique et Biometry Laboratoire, Université de Genève, Suisse.
Seielstad MT, Hebert JM, Lin AA, Sournoise Papa, Ibrahim M, Vollrath D, Désinvolte-Sforza LL (1994) Construction de être humain Y-chromosomal haplotypes à l'aide d'un nouvelle polymorphic UNE à G transition. Vrombissement Mol Genet 32159–1261: [PubMed].
Tibia T, Tomita K, Aujourd'hui T, Kotliarova SE, Côté sous le vent J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genetic variation one les Y chromosome dans les Japonais population et implications pour moderne être humain Y chromosome lignée. J Vrombissement Genet 44240–245: [PubMed].
Thomas MG, Bradman N, Tressaillir HM (1999) Élevé à travers analyse de 10 microsatellite et 11 diallelic polymorphisms one les être humain Y-chromosome. Vrombissement Genet 105577–581: [PubMed] [manuel plein].
Tyler- Forgeron C (1999) Y-chromosomal DNA l'étude de marché. dans Papiha SS, Deka R, Chakraborty R (eds) Gênes variété: candidatures dans être humain population génétique Kluwer Universitaire/Plenum L'éditeur, Nouvelle York, pp 65–73.
Sournoise Papa, Jin Financier primitif, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, David RW, Désinvolte-Sforza LL, Oefner PJ (1997) Détection de nombreux Y chromosome biallelic polymorphisms près de denaturing élevé- séance liquide chromatography. Gênes Res 7996–1005: [PubMed] [libérer Manuel plein].
Sain RS, Yuldasheva N, Ruzibakiev R, Sournoise Papa, Evseeva Moi, Bleu- Forgeron J, Jin Financier primitif, et al (2001) Les Eurasien sans coeur: une continental perspective one Y-chromosome variété Proc Natl Académie Sci USAS 9810244–10249: [ libérer Repli texte dans PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Série variation de les être humain Y chromosome. Plain 378379–380: [PubMed] [ manuel plein].
Wilson IJ, Chauve DJ (1998) Genealogical déduction de microsatellite données. Génétique 150499–510: [PubMed] [ libérer Manuel plein].
Wolpert S (2000) UNE nouvelle histoire de Inde. Oxford Université Le présent, Nouvelle York.
Jeune FW, Interdit CM (1996) UNE visuel statistiques système. dans Piqûre RA, Renard J (eds) Statistique informatique ambience pour social chercheuse. Sauge Publications, Nouvelle York, pp 207–236.
Zerjal T, Faites signe Financier primitif, Faites signe G, Mikelsaar AV, Krumina Une, Kucinskas V, Lancé Myself, Tyler- Forgeron C (2001) Géographique, linguistique, et culturelle influences one genetic variété: Y-chromosomal distribution dans Le Nordest Européen populations. Mol Biol Evol 181077–1087: [PubMed] [ libérer Manuel plein].
Zerjal T, Dashnyam B, Panda Une, Kayser M, Roewer Financier primitif, Santos FR, Schiefenhovel W, Fretwell N, Sans travail MA, Harihara S, Miroiter K, Semjidmaa D, Sajantila Une, Salon P, Crawford MH, Ginter EK, Evgrafov OV, Tyler- Forgeron C (1997) Genetic relations de Asiatiques et Le Nordest Européen, révéler près de Y-chromosomal DNA analyse. Suis J Vrombissement Genet 601174–1183: [PubMed].

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


  Le bout de page a mis à jour: Friday, November 25, 2005 22:33:11 -0500