Genética

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Cromosoma DNA Variación en Paquistán
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Cristo Tyler- Herrero y S. Qasim Mehdi1

1Biomedical y Genético Ingeniería División, Dr. un Q. Khan Laboratorios de investigación, Islamabad; 2Cancer Investigación Campaña, Cromosoma Molecular Biología Grupo, Departamento de Bioquímica, y 3Institute de Biológico Antropología, Universidad de Oxford, Oxford, Unido Reino; y descifrar Genética, Reykjavik.


Abstracto

Dieciocho binario polimorfismo y 16 multiallelic, breve-tandem- repetición (STR) loci del nonrecombining porción de la humanismo Y cromosoma estado tipo en 718 varón materias pertenencia a 12 grupos étnicos de Paquistán. Éstos identificable 11 estable haplogroups y 503 combinación binario marcador/STR haplotypes. Haplogroup frecuencias estado generalmente semejante a esos en vecino geográfico áreas, y el Paquistán poblaciones hablando un lengua aislar ( el Burushos), un Dravidian lengua ( el Brahui), o un Sino- Tibet lengua ( el Báltico) asemejarse el Indo-European–speaking mayoría No obstante, medio- juntura redes de haplotypes revelar considerable substructuring de Y variación adentro Paquistán, con mucho poblaciones actuación distinto racimos de haplotypes. Éstos modelos lata estar cuenta por por una común charco de Y abolengos, con substancial aislamiento entre poblaciones y madera flotante en el más pequeño se Poco comparativo genético o histórico datos está disponible por más poblaciones, pero el resultados lata estar comparado con oral tradiciones acerca de orígenes El Y datos apoyo el pozo- establecido origen de la Analizar sintácticamente en Irán, el sugerido describir de la Peligro desde Genghis Khan’s ejército, y el origen de el Negra Makrani en Africa, pero hacer no apoyo tradiciones de Tibet, Sirio, Griego, o Judía orígenes por otro poblaciones.


Introducción

El la más temprana evidencia de Paleolítico humanismo presencia en el Sur Asia consistir de piedra herramientas fundar esparcido alrededor del Soan Río Valle en del norte Paquistán ( húsar 1997). A pesar del falta de fósil evidencia, éstos herramientas aparecer a indicar el presencia de maíz machacado en el Sur Asia como temprano como 200,000–400,000 años hace (Wolpert 2000) y así está probable tener estado asociado con arcaico Homo especie. Paquistán mentiras en la postular meridional costera ruta seguido por anatómicamente moderno Homo Sapiencia afuera de Africa, y así mayo haber estado habitado por moderno humanismo como temprano como 60,000–70,000 años hace. Allí es evidencia de caverna habitantes en Paquistán noroeste frontera, pero fósil evidencia del Paleolítico has estado fragmentario ( húsar 1997). Evidencia has estado descubierto a Mehrghar, en del sudoeste Paquistán, indicación Neolithic acuerdos desde como hace mucho tiempo como 7,000 b.c. (discordante 1991), cuál estado seguido por el Indus Valle civilizaciones ( incluso el ciudades de Harappa y Mohenjodaro) aquel floreos en el 3d y 2d milenario b.c. (valles 1991). A la vuelta de 1500 b.c., el Indo-European–speaking nómada pastoral tribus desde más distante north—often llamado el Aryans—crossed el Karakorum Montañas a el Sur Asia. Subsiguiente acontecimientos históricos contener el invasión de Alexander el Gran (327–325 b.c.) y el Árabe y Musulmán conquista desde 711 a.d. adelante (Wolpert 2000).

El presente población de Paquistán consistir de más que 160 millón individuos ( según a 2005 QUIÉN figuras) quién pertenecer a a lo menos 18 étnica grupos y hablar más que 60 lenguajes ( mugre 1992). Más de estas lenguajes está Indo- Europea, pero ellos también contener un aislar, Burushaski; un Dravidian lengua, Brahui; y un Sino- Tibet lengua, Báltico. Punjabi- hablando individuos forma el mayoría población de Paquistán, pero ellos representar un complejo mezcla de étnica grupos (Ibbetson 1883) y está no analizado aquí; 12 grupos étnicos está inclusivo en el presente examen. información disponible acerca de ellas es resumir en el cuadro 1, junto con hypotheses acerca de su orígenes (Mehdi et al. 1999). Aunque unos de estas hypotheses está pozo- apoyo (e.g., el origen de la Analizar sintácticamente en Irán), más está con base en en oral tradiciones y haber no estado probado contra otro orígenes de evidencia.

Escaso genético datos está disponible por éstos Paquistán étnica grupos Temprano estudios de el ABO sangre grupos y clásico proteína marcadores hecho no contener todo grupos y principalmente clasificado ellas según su local de residencia. UN población árbol con base en en 54 clásico enzima marcadores locales el Peligro y Paso en el Occidente Asiático racimo contener el del norte Caucasoids (cabalgata-Sforza et al. 1994). En otro población árbol, con base en en 47 clásico proteína polimorfismo, el Paquistán muestras forma un pequeño subcluster adentro el Indo- Europea conferencistas desde India ( cabalgata-Sforza et al. 1994).

El Y cromosoma proporcionar un único origen de genético evidencia (Tyler- Herrero 1999; Sin empleo y Tyler- Herrero 2000). Trae el más grande nonrecombining segmento en el genocidio y contener numeroso estable binario marcadores, incluso base substituciones (ver, e.g., Secreto et al. 1997) y retroposon inserciones ( martillo 1994; Santos et al. 2000), cuál lata ser usado para en combinación con más- rápidamente evolucionar marcadores, tal como microsatellites (ver, e.g., Ayub et al. 2000). En consecuencia, muy detalle Y phylogenies lata estar construir aquel permitir varón- específico aspectos de genético historia ser investigar. Éstos está fuertemente influencia por el pequeño efectiva población tamaño de la Y cromosoma, que guía a rápido genético madera flotante, y por el práctica de patrilocality en mucho sociedades, que guía a alto niveles de geográfico differentiation de Y haplotypes. A pesar de el obra de arte Qamar et al. (1999) en la análisis de YAP+ cromosoma ( abarcar ~2.6% de la total) y análisis de STR variación (Ayub et al. 2000; Mohyuddin et al. 2001), pequeño obra has estado llevado afuera en Paquistán Y cromosoma. Por lo tanto, tenemos ahora actuar un vasto análisis de Paquistán Y abolengos, a determinar cuál luz ellos lata cobertizo en la orígenes y genético historia de la subgrupos aquel componer el Paquistán población.


Material y Métodos

Muestras
El Y cromosoma de 718 unrelated varón materias, pertenencia a 12 grupos étnicos de Paquistán, estado analizado (mesas 1 y 2; higo. 1). Informe consentimiento estado obtenido desde todo participantes en esto estudio. Un Epstein Cuartel virus–transformed lymphoblastoid célula línea estado establecido desde cada individuo, y DNA estado extracto desde éstos célula líneas por análisis.


Binario Polimorfismo Típico
Nosotros tipo 15 SNPs, un Alu inserción ( martillo 1994; Martillo y Horai 1995), un Línea inserción (Santos et al. 2000), y el 12f2 borradura (Casanova et al. 1985). El base substituciones estado 92R7 C?T (Mathias et al. 1994); M9 C?G ( secreto et al. 1997); SRY-2627 C?T (Bianchi et al. 1997); SRY-1532 unG?UN (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) Un?G (Seielstad et al. 1994); SRY-8299 G?Un (Santos et al. 1999a); Apto G?UN ( panda et al. 1998); SRY +465 C?T ( espinilla et al. 1999); LLY22g C?UN y Tat T?C transición (Zerjal et al. 1997). Además, el M17 marcador ( secreto et al. 1997) estado tipo, por uso de la cartilla GTGGTTGCTGGTTGTTACGT y AGCTGACCACAAACTGATGTAGA seguido por AflIII digestión de la PCR producto; el ancestral allele estado no digerido El M20 marcador (secreto et al. 1997) estado genotyped, por uso de el cartilla CACACAACAAGGCACCATC y GATTGGGTGTCTTCAGTGCT seguido por SspI digestión; abecé?G mutación destruir el sitio a posición 118 en el 413-bp producto. M11 (secreto et al. 1997) estado tipo, usando el cartilla TTCATCACAAGGAGCATAAACAA y CCCTCCCTCTCTCCTTGTATTCTACC seguido por digestión con MspI. El 215-bp producto estado digerido a 193-bp y 22-bp añicos en el derived allele. El RPS4Y C?T mutación (Bergen et al. 1999) estado detectado por BslI restricción digestión de un 528-bp PCR producto obtenido por uso de la cartilla CCACAGAGATGGTGTGGGTA y GAGTGGGAGGGACTGTGAGA. El ancestral C allele contener dos sitios, y el derived T allele contener un. M48 (secreto et al. 1997), unG, estado tipo por allele- específico PCR usando el discriminando cartilla TGACAATTAGGATTAAGAATATTATA y TGACAATTAGGATTAAGAATATTATG y el terreno municipal para el pastoreo cartilla AAAATTCCAAGTTTCAGTGTCACATA a generar específico 145-bp productos El colección de Y binario marcador alleles llevado por un individual individuo testamento estar remitido por a como “the Y haplogroup.”
De la 718 muestras, 717 maligno a haplogroups esperada en consonancia con el conocido phylogeny, pero un Paso muestra (PKH134) fallado a amplificar al SRY –1532 y M17 loci. Él estaba asignar a haplogroup 3 en consonancia con de alternativo SRY –1532 cartilla ( detalles a petición) y de él STR perfil.


Y-STR Típico
Cinco trinucleotide- repetición polimorfismo (DYS388, DYS392, DYS425, DYS426, y DYS436), ten tetranucleotide- repetición polimorfismo (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, y DYS439) y un pentanucleotide microsatellite (DYS438) estado tipo en todo Y cromosoma. Tres múltiple PCR reacciones estado actuar por todo Y-STRs, en a10-µl final reacción volumen contener 20 ng genocidio DNA, como se describe en en otra parte (Thomas et al. 1999; Ayub et al. 2000). PCR productos estado ejecutar en un ABI 377 secuencia. ABIGS350 TAMRA estado usado como el interno camino estándar. El GÉNESIS y GENOTYPER software paquetes estado acostumbró coleccionar el datos y a analizar fragmento tamaños Y-STR alleles estado nombrado según la número de repetición unidades ellos contain.The número de repetición unidades estado establecido a través el uso de secuencia referencia DNA muestras. Allele longitudes por DYS389b estado obtenido por substracción de la DYS389II allele duración desde DYS389I.
Y-STR duplications estado fundar a algunos loci. DYS393 estado duplicar en PKH165 (13 y 15) y DYS437 estado duplicar en SDH181 (8 y 9). UN más complejo modelo estado fundar en DYS425, adonde dos a cuatro alleles estado fundar en 36 individuos desde haplogroups 8, 9, 13, y 21.


Datos Análisis
Principio- componentes análisis estado llevado afuera en haplogroup frecuencias por uso de la ViSta ( visual Estadísticas) sistema software, versión 5.0.2 (joven y Prohibido 1996). Por gráfico representación, el primero y segundo principio componentes estado conspirador por el Microscopio Oficina Serie Superar Paquete en Ventanas 2000. Biallelic polimorfismo datos por vario mundo poblaciones usado en el análisis estado obtenido desde Martillo et al. (2001). Mezcla estado estimado por uso de tres diferente medidas: Largo peso menor- cuadrados (WLS) medida ( largo 1991); mR, un menor- cuadrados estimación (manto y Hiorns 1965); y m? (Helgason et al. 2000).
Análisis de molecular variación (AMOVA) estado llevado afuera por uso de la Arlequin paquete (Schneider et al. 1997). AMOVA medidas el proporciones de mutación divergence fundar adentro y entre poblaciones, respectivamente. Aunque mucho de la variación al rápidamente mutación microsatellite loci es esperada haber sido producto en el diferente Paquistán subpopulations, el único mutación eventos al binario loci está mucho más viejo y haber no ocurrido en el contexto de la subdivisión de la Paquistán población. Nosotros apartar el partidarias estrategia a hazaña el máximo cantidad de pertinente mutación información desde el Y- cromosoma haplotypes. STR variación adentro haplogroups estado acostumbró calcular población pairwise FST valores por cada individuo haplogroup. Por cada población pareja, un peso bajo FST estado calculado, adonde el valor obtenido por cada haplogroup estado peso según el proporción de pairwise comparaciones enredado aquel haplogroup. En ausencia de un particular haplogroup desde un población, Un, de la pareja UN y B, FST estado colección a 1, y el número de pairwise comparaciones estado llevado como el número de cromosoma llevando aquel haplogroup en B. Valores de FST con base en en STRs solo o en STRs más binario marcadores, con binario marcadores dado un 10- redil más alto peso, estado calculado por comparación. En todo de éstos análisis, el distancia matriz usado consistencia de la número de pasos por cuál cada pareja de haplotypes diferido. Mantis ensayos por lo significancia de correlaciones entre FST valores estado llevado afuera en Arlequin, y multidimensional subiendo (MDS) complotes estado construir por uso de la SPSS versión 7.0 software paquete.

Medio- juntura redes estado construir por Red 2.0b ( banda et al. 1999). UN peso esquema con un cinco- redil alcance estado usado en el construcción de la redes. El pesos asignar estado específico por cada haplogroup y took a cuenta el Y-STR variación a través de el haplogroup en el todo Paquistán población. El partidarias pesos estado usado variación 0-0.09, peso 5; variación 0.1-0.19, peso 4; variación 0.2-0.49, peso 3; variación 0.5-0.99, peso de 2; y variación 1.00, peso 1. A pesar del esto, el red por haplogroup 1 contenedor mucho alto dimensional cubos y estado resuelto por aplicar el reducido medio y medio juntura red métodos sequentially. reducido medio algoritmo (banda et al. 1995) estado acostumbró generar un *.rmf lima y el medio juntura red método estado aparato a esto lima.

BATWING (Wilson y Calvo 1998), Bayesian Análisis de Árboles Con Interno Nodo Generación, estado acostumbró estimación el tiempo al más reciente común antecesor (TMRCA) de un colección de cromosoma. Esto programa usos un Marca cadena Mes Furgonada procedimiento a generar phylogenetic árboles y asociado parámetro valores coherente con ingreso datos ( un colección de Y haplotypes) y genético y demográfico modelos El genético modelo asumir individual- paso mutaciones de la STRs y el demográfico modelo escogido estado exponente acrecentamiento desde un inicialmente constante- tamaño población, con o sin subdivisión en diferente carreras de la programa Todo 16 STR loci estado usado; sitio- específico mutación tasa anterior probabilidades con base en en la datos de Kayser et al. (Kayser et al. 2000) estado construir por lo loci disponible como gama distribuciones de la forma gama(, b) adonde un = (1 + número de mutaciones observado por Kayser et al.), y b = (1 + número de meioses). Por loci no investigar por Kayser et al., el distribución gama (1,416) estado usado, cuál has un bajo de 0.0024. UN generación tiempo de 25 años estado asumido. Así el 95% confianza intervalos dado tener en cuenta incertidumbre en mutación tasa, población acrecentamiento y ( adonde apropiado) subdivisión, pero no generación tiempo.

Resultados

Y- Cromosoma Binario Polimorfismo
El 18 binario marcadores usado identificar 20 haplogroups en mundial poblaciones higo 1A), pero único 11 estado fundar en Paquistán, y 5 cuenta por 92% de la muestra ( higo. 1 y mesa 2). Haplogroups 1 y 9 estado presente en todo Paquistán poblaciones examinado, haplogroup 3 estado presente en todo excepto el Peligro, y haplogroup 28 estado presente en todo excepto el Peligro y el Kashmiris. Del sudoeste poblaciones presentación más alto frecuencias de hg 9 y el YAP+ haplogroups 21 y 8 de del nordeste poblaciones ( higos. 1D–E), pero, global, pequeño geográfico racimo de haplogroup frecuencias es aparente adentro el país.


Principio- Componentes Análisis
Nosotros deseos a comparar el Paquistán Y haplogroup datos con datos desde poblaciones del descanso de la mundo. No apropiado datos colección estado disponible por lo entera colección de 18 marcadores, pero el datos de Martillo et al. (2001) permitido casi 5 ser usado, porque lo mismo o phylogenetically equivalente marcadores estado comunicado. principio- componentes análisis higo 2A) presentaciones unos diferencias del original análisis de Martillo et al., el principal un siendo el mas pequeño separación de la Africano poblaciones. Esto es due, a un grande grado, al avances de marcadores usado, cuál does no contener mucho de la Africa- específico se. Más Paquistán poblaciones racimo con Sur Asiático y Entero Oriental poblaciones, y está cerca de Del norte Africano, Central Asiático y Europea poblaciones, así actuación un general semejanza con geográficamente cerca poblaciones. El que excepción es el Peligro, quién está bastante distinto. UN semejante análisis de la Paquistán poblaciones solo, usando todo de el binario marcadores ( higo. 2B), confirmar el diferencia entre el Peligro y el otro día poblaciones y también más claramente presentaciones el distinctness de la Kalash y el Analizar sintácticamente. Él es golpeando aquel el lengua isolate–speaking Burundi y el Dravidian- hablando Brahuis hacer no sobresalir en éstos análisis.


Mezcla Estimaciones
Hypotheses acerca de población orígenes ( mesa 1) lata estar considerado como cuantitativo preguntas acerca de mezcla. Por ejemplo, a prueba el posibilidad aquel el Palo de pasamano Y cromosoma haber un Sirio origen, nosotros lata preguntar cuál proporción de la Palo de pasamano Ys está derived desde Siria y cuál proporción está desde Paquistán ( considerado ser el Paquistán muestra menos el Palo de pasamano). Datos en sugerido origen poblaciones estado llevado del literatura y tres medidas de mezcla estado calculado. Los conocimientos fundamentales estimaciones dió ampliamente consistente resultados, con pequeño sistemático diferencias típicamente m? > mR > Largo WLS por lo estimado contribución del externa origen población ( mesa 3). Éstos resultados presentar pruebas por un externa contribución al Peligro, Kalash, Negra Makrani, y Analizar sintácticamente pero no al otro poblaciones.


Y- Cromosoma STR Polimorfismo
Y-STR polimorfismo estado estudiado a obtener un más detalle presentación de Y variación, entre el diferente Paquistán grupos étnicos, aquel haría estar menos parcial por el marcador- determinación procedimiento El diversión de Y-STR haplotypes ( mesa 4) estado el más bajo por lo Peligro (0.893) como sugerido por anterior análisis (Ayub et al. 2000).
El 16 Y-STRs definir 502 Y haplotypes, el vasto mayoría siendo observado en individual individuos El otro haplotypes estado compartido por 2–18 individuos ( detalles está dado en el en línea- único suplementario mesa). En todo cajas pero un, el cromosoma compartiendo un haplotype pertenecido al mismo haplogroup ( de aquí, 503 combinación haplotypes) como en, más cajas, el individuos compartiendo un haplotype pertenecido al mismo población (mesa 5).

El GST y modalidad tamaño de la repetición unidad, por todo 16 Y-STRs examinado en el Paquistán población, está dado en mesa 6. El correlación entre marcador heterozygosity y GST estado fundar no a estar importante (r0.329=; P=.213). El modalidad tamaño y variación de la 16 Y-STRs adentro haplogroups 1, 2, 3, 8, 9, 10, 21, 26, y 28 es también dado en el cuadro 6. Cierto haplogroups haber un diferente modalidad allele tamaño, y unos ejemplos de este está presentación en negrita letra cursiva en el cuadro 6. Por ejemplo, DYS388 has 15 repeticiones en haplogroup 9, comparado con 12 repeticiones en más de la otro haplogroups en Paquistán. Semejantemente, el modalidad allele por DYS438 es 9 en haplogroup 9, pero 10 o 11 en el otro haplogroups. El modalidad allele por DYS434 por haplogroup 10 es 11, cuál es golpeando diferente del allele tamaño de esto sitio en otro haplogroups. El completo falta de variabilidad por DYS436 en el 233 varón materias pertenencia a haplogroup 3 es notable. Haplogroup 10 aparecer tener lo menos variabilidad a través de más loci excepto por DYS390 ( mesa 6). Éstos descubrimientos demostración el fuerte estructuración de Y-STR variabilidad por haplogroup.

Nosotros querido a calcular un Y- con base en medida de genético distancia entre poblaciones aquel haría reflejar el differentiation aquel tenido ocurrido adentro Paquistán y aquel haría no estar disproportionately dominar por antiguo diferencias aquel tenido anteriormente acumulado entre haplogroups. estándar camino hacer esto haría estar a uso STR variación, y mesa 7 resumir población pairwise valores de FST en el base de STR variación solo ( un) o de binario- marcador más STR variación (B), con binario- marcador diferencias peso 10 períodos más alto de STR diferencias. Éstos matriarca está altamente correlacionar (r0.95=; P.001<), como podría esperada del estructuración de STR variación por haplogroup. However, éstos medidas está importantemente influencia por antiguo diferencias, y tenemos por lo tanto desarrollada para un modified medida. Nosotros razonado aquel mucho de la STR variación adentro haplogroups haría haber originado recientemente y puedes ser usado para esto propósito Nosotros por lo tanto calculado población pairwise valores de FST, en consonancia con STR variación adentro haplogroups, y usado un peso medio de estas a producto un individual FST distancia matriz ( mesa 7C; higo. 3). Éstos distancias está también altamente correlacionar con distancias con base en en STRs solo (r0.76=; P.001<) o en STRs más binario marcadores (r0.70=; P.001<), pero un mayor proporción de el variación es seen entre poblaciones (22%, comparado con 6% y 7%, respectivamente). UN comparación de figura 3 con figura 2B ( cuál estado con base en en binario marcador frecuencias solo) informar un golpeando global semejanza, con el Peligro siendo distinto desde todo de el otro día poblaciones. El otro día sobresaliente poblaciones está el Kalash y Analizar sintácticamente (como ante), el Kashmiris (acaso a causa de el pequeño muestra), y el Brahuis, quién está así más distinto en su STR perfiles de haplogroup frecuencias. MDS complotes de la distancias en mesas 7A y 7B ( no presentación) llevar a semejante conclusiones, pero asemejarse figura 2B más cuidadosamente en el camino aquel el Brahuis hacer no estante afuera tanto.


Medio- Juntura Redes
El genético parentescos entre el diferente Paquistán grupos étnicos estado explorar más distante por chupar medio- juntura redes ( banda et al. 1995), y ejemplos está presentación en figuras 4, 5, y 6. El haplogroup 1 red higo 4) informar considerable variación, pero también un alto grado de población- específico substructure. Por ejemplo, el 24 Analizar sintácticamente haplogroup 1 cromosoma todo caída a un de tres racimos ( higo. 4, verde), 19 de 26 Burundi haplogroup 1 cromosoma caída a dos racimos ( azul), y 12 de 14 Peligro haplogroup 1 cromosoma caída a un individual racimo, y todo de estas racimos está específico a su respectivo poblaciones. El haplogroup 10 red higo 5) es mucho sencillo, a causa de el número bajo de cromosoma, pero de nuevo informar población- específico racimo por Burundi y Peligro haplotypes. El haplogroup 28 red ( higo. 6) presentaciones un golpeando aislado Analizar sintácticamente- específico racimo, a finales de abril largo rama, contener 15 de 16 Analizar sintácticamente haplogroup 28 cromosoma. Racimos de Kalash, Burundi, and—to un mas pequeño degree—Baluch cromosoma está también evidente, aunque un Palo de pasamano haplotype es compartido con Sindhi y Makrani Palo de pasamano individuos desde cercano meridional poblaciones.
BATWING TMRCAs estado calculado por lo haplogroup 28 red y por seleccionado abolengos adentro un número de haplogroups. El resultados está resumir en el cuadro 8.

Discurso

Hemos traido allá afuera primero vasto análisis de Y diversión adentro Paquistán, examining 34 marcadores en 718 varón materias desde 12 poblaciones Esto permitir estemos comparar Paquistán Y diversión con aquel anteriormente comunicado en mundo poblaciones, a investigar diferencias adentro Paquistán, y a evaluar unos de la sugerido población historias desde un Y perspectiva.


Comparaciones con Mundial Datos
En un mundial comparación, Paquistán poblaciones principalmente racimo a la vuelta de un charco Sur Asiático muestra y embuste cerca de un Entero Oriental muestra ( higo. 2A). Esto descubrimiento es unsurprising, en parte porque el Sur Asiático muestra inclusivo 62 Paquistán individuos (i.e., 32% de 196 total) como en parte porque Y variación en mucho áreas de la mundo es predominantemente estructura por geografía, no por lengua o étnica afiliación (Rosser et al. 2000; Zerjal et al. 2001). El mayor genético semejanza de Paquistán poblaciones a esos en el occidente de a oriental poblaciones es ilustrado por el realidad aquel cuatro de la cinco frecuente haplogroups en Paquistán (haplogroups 1, 2, 3, y 9, cuál junto componer 79% de la total población) está también frecuente en occidental Asia y Europa pero no en China o Japón; a la inversa, el haplogroups aquel está frecuente en Oriente Asia (e.g., 4, 5, 10, 13, y 20) está raro o ausente en Paquistán, formación único 2.5% de la total Si, como en unos interpretaciones, un temprano éxodo desde Africa a lo largo de el meridional costa de Asia led al primero anatómicamente moderno humanismo poblaciones en Paquistán, y éstos personas llevado el oriental haplogroups o su precursores, su Y cromosoma haber ahora estado ampliamente reponer por subsiguiente migraciones o gene flujo; de veras, el representantes de la oriental haplogroups en Paquistán mayo derivar desde moderno dorso- migración, no desde antiguo sobrevivientes.
El quinto haplogroup aquel es común en Paquistán, haplogroup 28, diferido desde todo el otros en su distribución. Adentro Paquistán, hizo arriba 14% de nuestro muestra y estado presente en casi dos poblaciones ( ambos de que tenido muy pequeño muestra tamaños), así está ambos común y extensiva Exterior Paquistán y el cercano países, however, está raro. Él has estado comunicado en India (30%; presente en 3/3 poblaciones), Tajikistan (10%; presente en 5/6 poblaciones), y Uzbekistan (3%; presente en 10/13 poblaciones), pero está raro en Rusia (0.4%; presente en 1/6 poblaciones) y el Caucásico (1.4%; presente en 1/6 poblaciones (pozos et al. 2001) y has no estado fundar a todo en China o Mongolia ( inédito observaciones BATWING estimaciones de la TMRCA de la Paquistán haplogroup 28 cromosoma estado ~7,000 (4,000–14,000) años ( mesa 8). Así, adentro esto tiempo ciclo, el Paquistán poblaciones haber diverso desde un común ancestral población o haber experto considerable varón gene flujo entre ellas mismas o desde un común origen. Desde el estimado edad corresponder al temprano Neolithic ciclo, el propagación de este abolengo podría asociado con el local ampliación de hacendados.


Comparaciones adentro Paquistán
Haplogroup distribuciones en Paquistán poblaciones, con excepción de el Peligro ( discutir en el contiguo sección), está golpeando semejante a un otro ( higos. 1 y 2), a pesar del unos notable lingüístico diferencias. De veras, el lengua aislar- hablando Burundi, el Dravidian- hablando Brahuis, y el Sino-Tibetan–speaking Báltico hecho no sobresalir del otro poblaciones a por lo general el haplogroup análisis ( mesa 2 y higo. 2), sugiriendo o aquel el lingüístico diferencias arose después de el terreno municipal para el pastoreo Y modelo estado establecido o aquel he tenido bastante Y gene flujo entre poblaciones a eliminar cualquier inicial diferencias Aún un más detalle análisis de la Y haplotypes (e.g., higos. 3–6) informar unos distinto facciones de la Brahui y considerable población específico; población- específico racimos de relacionado haplotypes está comunalmente fundar en éstos redes Tal racimos testamento único estar seen si poblaciones está aislado desde un otro. Esté aquel un bajo grado de gene flujo entre poblaciones por un tiempo largo es bastante a acarrear semejante haplogroup frecuencias sin produciendo mucho compartido racimos.
Población- específico racimos de haplotypes está particularmente evidente en unos poblaciones. En el Peligro, adonde el distinto haplogroup frecuencias célebre sobre está fundar, más cromosoma (19/23; 83%) caída a un de justa dos pozo- aislado racimos ( higos. 4 y 5), considerando que el Analizar sintácticamente, el Kalash, y el Burundi también presentación prominente racimos. El Peligro, Analizar sintácticamente, y Kalash estado el tres poblaciones actuación el más importantemente diferente población pairwise FST valores. El alto valores de la Peligro y Analizar sintácticamente lata en parte estar cuenta por por migración a Paquistán desde otro locales, pero también contribución factor es probable ser madera flotante, o due a un limitado número de fundador abolengos o ocurrido subsiguientemente adentro pequeño poblaciones. Tk valores (Ewens 1972) proporcionar un camino de comparación efectiva población tamaños. Valores con base en en la STRs por lo Peligro, Analizar sintácticamente, Kalash, y Burushos estado 8.9, 77.5, 25.8, y 74.2, respectivamente, comparado con un bajo de 181.8 por lo otro poblaciones con muestra tamaños >20. Efectiva población tamaño por Y cromosoma lata diferido grandemente desde censo población tamaño, pero está notable aquel el Analizar sintácticamente y Kalash hacer haber el menor censo tamaños, un-hundredth o un- mil de más de esos de la otro poblaciones (mesa 1), así éstos pequeño censo tamaños mayo haber estado mantener por mucho tiempo. En suma, mucho facciones de la presente Paquistán Y haplotype distribuciones lata estar cuenta por por un compartido ancestral gene charco, con limitado gene flujo entre poblaciones y madera flotante en el más pequeño se.


Comprensiones a Población Orígenes
El sugerido población orígenes ( mesa 1) lata ahora estar considerado en el luz de estas Y resultados. Información es con tal que por haplogroup frecuencias, cuál lata estar acostumbró producto mezcla estimaciones, y éstos está fácil a interpretar si poblaciones está grande y aislado y el origen poblaciones haber diferente frecuencias. Cuándo éstos condiciones está no met, el presencia de distinto Y abolengos lata aún estar informativo El orígenes de la Analizar sintácticamente está pozo- documento (Nanavutty 1997) y así proporcionar un útil prueba mayúsculas y minúsculas. Son partidarias de la Iranio profeta Zoroaster, quién emigrar a India después de el colapso de la Sassanian imperio en el 7th siglo a.d. Ellos establecido en 900 a.d. en Gujarat, India, adonde fueron llamado el “Parsi” ( sentido “from Irán). Eventualmente ellos movido a Murmullo en India y Quilate en Paquistán, de dónde el presente población estado muestra ( higo. 7). Su frecuencias por haplogroups 3 (8%) y 9 (39%) hacer de veras asemejarse esos en Irán más de esos de su corriente vecinos en Paquistán. Ellos presentación el el más bajo frecuencia por haplogroup 3 en Paquistán (aparte de el Peligro; higo 1C). El bajo por ocho Iranio poblaciones estado 14% (n401=) (Quintana-Murci et al. 2001), considerando que aquel por Paquistán, sin incluir el Analizar sintácticamente, estado 36%. correspondiente figuras por haplogroup 9 estado 39% en el Analizar sintácticamente, 40% en Irán, y 15% en Paquistán sin incluir el Analizar sintácticamente. Éstos figuras llevar a un mezcla estimación de 100% desde Irán ( mesa 3). Dado el pequeño efectiva población tamaño de la Analizar sintácticamente, el cercanía de su partido al Iranio datos mayo estar fortuito, y el presencia de haplogroup 28 cromosoma a 18% (4% en Irán; Pozos et al. 2001) sugerir unos gene flujo del rodeando poblaciones El TMRCA por el Analizar sintácticamente- específico racimo en el haplogroup 28 redes estado 1,800 (600–4,500) años (mesa 8), coherente con el migración de un pequeño número de abolengos desde Irán Global, esos resultados demostración un cerca partido entre el histórico archivos y el Y datos, y así sugerir aquel el Y datos testamento ser útil cuándo menos histórico información es disponible.

El población o sea genetically más distinto, el Peligro, reclamos describir desde Genghis Khan’s ejército; su nombre es derived del Persa palabra “hazar,” sentido “thousand,” porque tropas estado izquierdo atrás en detachments de mil. Hacia el fin de la 19th siglo, unos Peligro movido desde Afganistán al Khurram Valle en Paquistán, el origen de el muestras investigar aquí Así, su historia oral identificable un origen en Mongolia y población gollete ~800 y ~100 años hace. De la dos predominante Y haplogroups presente en esto población, haplogroup 1 es extensiva en Paquistán, mucho de Asia, Europa, y el América, y así proporcionar pequeño información acerca de el local de origen. Haplogroup 10, en contraste, es raro en más Paquistán poblaciones (1.4%, cuándo el Peligro está excluido) pero es común en Oriente Asia, incluso Mongolia, adonde ella hace arriba por medio de la población (inédito resultados). Mezcla estimaciones ( mesa 3) está coherente con un substancial contribución desde Mongolia. BATWING análisis de la Peligro- específico haplotype racimos en haplogroups 1 y 10 sugerido TMRCAs de 400 (120–1,200) y 100 (6–600) años ( mesa 8), respectivamente Así, el genético evidencia es consistente con el oral tradición como en, presentación de sus independiente índole, proporcionar fuerte apoyo le ( higo. 7).

Unos otro sugerido orígenes recibir más limitado apoyo del Y datos. El Negra Makrani, con un postular origen en Africa, llevar el el más alto frecuencia de haplogroup 8 cromosoma fundar en cualquier Paquistán población, como célebre en otra parte (Qamar et al. 1999). Esto haplogroup es ampliamente confinado a substituta-Saharan Africa, adonde él constituir acerca de medio de la población (martillo et al. 2001) y lata así estar aprecio como un marcador de Africano Y cromosoma. No obstante, ella hace arriba único 9% de la Negra Makrani muestra, y haplogroup 28 (a lo largo de con otro típico Paquistán haplogroups) es presente en este población. Si el Y cromosoma estado inicialmente Africano ( higo. 7), más haber subsiguientemente estado reponer: el global estimación de la Africano contribución es ~12% ( mesa 3).

El Báltico está pensamiento tener originado en Tibet, adonde el predominante haplogroups está 4 y 26. Ni estado presente en la muestra desde esto estudio, proporcionando no apoyo por un Tibet origen de la Y cromosoma abolengos y un mezcla estimación de cero ( mesa 3). However, esto resultado mosto estar intérprete con cautela, a causa de el pequeño muestra tamaño. Tres poblaciones haber posible orígenes del ejércitos de Alexander el Gran: el Burundi, el Kalash, y el Paso. Moderno Griegos presentación un moderadamente alta frecuencia de haplogroup 21 (28%; Rosser et al. 2000), pero esto haplogroup estado no seen en o el Burundi o el Kalash muestra y estado fundar en único 2% de el Paso, considerando que el local haplogroup 28 estado presente a 17%, 25%, y 13%, respectivamente. Griego- mezcla estimaciones de 0% estado obtenido por lo Burundi y el Paso, pero figuras de 20–40%% estado observado por el Kalash ( mesa 3). En presentación de la ausencia de haplogroup 21, nosotros atribuir esto resultado o a madera flotante en el frecuencias de la otro haplogroups, particularmente haplogroups 2 y 1, o al pobre resolución de abolengos adentro éstos haplogroups, resultado en distinto abolengos siendo clasificado a lo mismo paraphyletic haplogroups. Global, no apoyo por un Griego origen de su Y cromosoma estado fundar, pero esto conclusión does exigir el supuesto aquel moderno Griegos está representante de Alexander’s ejércitos. Dos poblaciones, el Kashmiris y el Paso, también poner reclamo a un posible Judía origen Judía poblaciones comunalmente haber un moderado frecuencia de haplogroup 21 (e.g., 20%) y un alto frecuencia de haplogroup 9 (e.g., 36%; (martillo et al. 2000). El frecuencias de ambos de estas haplogroups está bajo en el Kashmiris y Paso, y haplogroup 28 es presente a 13% en el Paso, así no apoyo por un Judía origen es fundar, y el mezcla estimación estado 0% ( mesa 3), aunque, de nuevo, esto conclusión es limitado ambos por el pequeño muestra tamaño disponible desde Kashmir y por el supuesto aquel el moderno muestras está representante de antiguo poblaciones.

El sugerido origen de la Palo de pasamano es en Siria. Sirios, como Iranios, está caracterizado por una bajo frecuencia de haplogroup 3 y un alta frecuencia de haplogroup 9 (9% y 57%, respectivamente; Martillo et al. 2000), considerando que el correspondiente frecuencias en el Palo de pasamano está 29% y 12%. Esto diferencia y el alta frecuencia de haplogroup 28 en el Palo de pasamano (29%) hacer la cama predominantemente Sirio origen por su Y cromosoma improbable, y el mezcla estimación estado 0% (mesa 3), aunque la 8% frecuencia por haplogroup 21, el el más alto identificable en Paquistán así distante, does indicar unos occidental contribución a su Y abolengos. Brahuis haber un posible origen en Occidente Asia (Hughes- Viñeta 1991) y ha estado sugerido aquel un propagación de haplogroup 9 Y cromosoma estado asociado con el ampliación de Dravidian- hablando hacendados (Quintana-Murci et al. 2001). Brahuis haber el el más alto frecuencia de haplogroup 9 cromosoma en Paquistán (28%) después de el Analizar sintácticamente, proporcionando unos apoyo para este hypothesis, pero su más alto frecuencia de haplogroup 3 (39%) es no típico de la Fecundo Creciente (Quintana-Murci et al. 2001) y sugerir un más complejo origen, posiblemente con mezcla desde posterior migraciones, tal como esos de Indo- Iranio conferencistas del estepas de Central Asia y otros desde más distante oriente Esto posibilidad es apoyo por el detective de bajo frecuencias de haplogroups 10, 12, y 13 en el Brahuis, todo raro en Paquistán y típico de Oriente Asia, Oriente y del norte Asia, y Sudeste Asia, respectivamente.

El fallo a obtener empleo Y vínculo con un sugerido población de origen does no disprove un histórico asociación, pero hace demostración aquel el Y cromosoma derived desde tal acontecimientos históricos haber estado perdido o reponer. Análisis de mitochondrial DNA y otro loci haría ayuda a aclarar el población historias y haría estar particularmente interesante en poblaciones como el Negra Makrani y el Báltico, en cuál allí es un contraste entre el phenotype y el típico Paquistán Y haplotypes.

Reconocimientos


Esto obra estado apoyo por una Wellcome Confianza Colaboración Investigación Iniciativa Concesión a S.Q.M. T.Z. estado también apoyo por el Wellcome Confianza, y C.T.-S. por el Cáncer Investigación Campaña. Nosotros rápida nuestro agradecimiento al original DNA donantes quién hecho esto estudio posible. El Departamento de Salud de la Gobierno de Baluchistan y el Palo de pasamano Estudiante Confederación, Quetta, Paquistán, asistido en el colección de la Brahui y Palo de pasamano muestras. Paso muestras estado acumulado con el asistencia de la Departamento de Paediatrics, Dama Leyendo Poste Graduado Médico Hospital, Peshawar, Paquistán Nosotros estamos también agradecido a Dr. yo Kazmi y el Aga Khan Fundación Campestre Salud Apoyo Programa por su asistencia en el colección de Burundi muestras. Dr. F. Sethna con tal que valioso asistencia en el colección de la Analizar sintácticamente muestras. Nosotros agradecer Luis Quintana-Murci por de él comentarios en la manuscrito original.


Electrónica- Banco de datos Información

URLs por datos en este artículo está a continuación:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Red 2.0, http:/www.fluxus-engineering.com/.
/ ViSta, http:/forrest.psych.unc.edu/.

Referencias

Ahmad AKN (1952) Jesús en cielo en tierra. El Civil y Militar Gaceta Ltd, Lahore, Paquistán.
Ayub Q, Mohyuddin Un, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Herrero C (2000) Identificación y characterisation de novela humanismo Y- cromosoma microsatellites desde secuencia banco de datos información. Nuclear Ácidos Res 28e8: [ libre Lleno texto en PMC].
Braza de espalda COMPUTADORA PERSONAL (1992) Báltico. en Braza de espalda Computadora personal, Radloff CF (eds) Sociolinguistic examen de del norte Paquistán. Vol 2, Lenguajes de del norte áreas Nacional Instituto de Paquistán Estudios, Islamabad, pp 3–27.
Banda HJ, Abandonar P, Rohl UN (1999) Medio- juntura redes por inferido intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ libre Lleno Texto].
Banda HJ, Abandonar P, Sykes BC, Richards MEGAOCTETO (1995) Mitochondrial retratos de humanismo poblaciones usando medio redes. Genética 141743–753: [PubMed] [ libre Lleno Texto].
Belleza HW (1979) El carreras de Afganistán. Cantado-e-Meel Publicaciones, Lahore, Paquistán.
Belleza HW (1998) Un investigación a el etnografía de Afganistán Vanguardia Libros mayor, Lahore, Paquistán.
Bergen AW, Wang C-Y, Tsai J, Jefferson K, Dey C, Herrero KD, Parque S-C, Tsai S-J, Oro D (1999) Un Asian–Native Americano paterno abolengo identificable por RPS4Y resequencing y por microsatellite haplotyping. Ann Hum Genético 6363–80: [PubMed] [lleno Texto].
Bianchi No, Bailliet G, Bravata CM, Carnicería RF, Rothhammer F, Tirano- Caléndulas VL, Penal SD (1997) Origen de Amerindian Y- cromosoma como inferido por el análisis de six polimorfo marcadores. Estoy J Físico Antropoide 10279–89: [PubMed] [ lleno Texto].
Biddulph J (1977) Tribus de la Cierva Koosh. Indus Publicaciones, Quilate, Paquistán.
Burton RF (1851) Sindh y el carreras aquel habitar el valle de la Indus. WH Allen y Co Ltd, Londres.
Algarrobo O (1958) El Paso. Oxford Universidad Prensa, Quilate, Paquistán.
Casanova M, Leroy P, Boucekkine C, Weissenbach J, Obispo C, Compañero M, Purrello M, Fiori G, Siniscalco M (1985) UN humanismo Y- eslabonado DNA polimorfismo y su potencial por estimando genético y evolucionaria distancia Ciencia 2301403–1406: [PubMed].
Cabalgata-Sforza LL, Menozzi P, Pórtico UN (1994) El historia y geografía de humanismo génesis. Príncipe Universidad Prensa, Príncipe.
Valles GF (1991) El fenómeno de la Indus civilización. en Jansen M, Mulla M, Urbano G (eds) Olvidado ciudades en la Indus: temprano civilización en Paquistán del 8th al 2nd milenario BC. Verlag Filipinas von Zabern, Principal, Alemania, pp 129–144.
Cubierta KD (1992) Sociolinguistic examen de Del norte Paquistán. Vol 5, Lenguajes de Chitral. Nacional Instituto de Paquistán Estudios, Islamabad.
Ewens WJ (1972) El muestra teoría de selectivamente neutral alleles. Teorema Plebe Biol 387–112: [PubMed].
Mugre BF (1992) Etnología: lenguajes de la mundo. Verano Instituto de Lingüística, Dallas.
Martillo MF (1994) UN reciente inserción de un Alu elemento en la Y cromosoma es un útil marcador por humanismo población estudios. Mol Biol Evol 11749–761: [PubMed] [libre Lleno Texto].
Martillo MF, Horai S (1995) Y cromosoma DNA variación y el personas de Japón. Estoy J Hum Genético 56951–962: [PubMed].
Martillo MF, Quilate Marca de fábrica, Enrojecer AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Jerárquico modelos de global humanismo Y- cromosoma diversión Mol Biol Evol 181189–1203: [PubMed] [ libre Lleno Texto].
Martillo MF, Enrojecer AJ, Madera ET, Gorra MR, Jarjanazi H, Quilate T, Santachiara-Benerecetti S, Oppenheim Un, Sin empleo MA, Jenkins T, Ostrer H, Gorra- Domando B (2000) Judía y Entero Oriental no- Judía poblaciones parte un común charco de Y- cromosoma biallelic haplotypes. Proc Natl Académico Sci EUA 976769–6774: [ libre Lleno texto en PMC].
Helgason Un, Sigurdardottir S, Nicolás J, Sykes B, Cerro EW, Clavito DG, Bosnia V, Quebradas JR, Barrio R, Stefansson K (2000) Estimando Escandinavo y Gaelic abolengo en el varón pobladores de Islandia. Estoy J Hum Genético 67697–717: [PubMed] [ libre Lleno Texto].
Hughes- Viñeta R (1991) Imperial gaceta de India: provinciana serie, Baluchistan. Cantado-e-Meel, Lahore, Paquistán.
Húsar J (1997) UN historia de la personas de Paquistán hacia independencia. Oxford Universidad Prensa, Quilate, Paquistán.
Ibbetson D (1883) Panjab castas Cantado-e-Meel, Lahore, Paquistán.
Discordante JF (1991) Mehrgarh: su local en el desenvolvimiento de antiguo culturas en Paquistán. en Jansen M, Mulla M, Urbano G (eds) Olvidado ciudades en la Indus: temprano civilización en Paquistán del 8th al 2nd milenario BC. Verlag Filipinas von Zabern, Principal, Alemania, pp 34–50.
Sin empleo MA, Tyler- Herrero C (2000) Nuevo usos por nuevo haplotypes: el humanismo Y cromosoma, enfermedad y selección Tendencias Genético 16356–362: [PubMed] [ lleno Texto].
Quilate Marca de fábrica, Zegura SL, Posukh O, Osipova L, Bergen Un, Largo J, Oro D, Klitz W, Harihara S, de Knijff P, Wiebe V, Grifo RC, Templo AR, Martillo MF (1999) Ancestral Asiático orígenes() de nuevo mundo Y- cromosoma fundador haplotypes. Estoy J Hum Genético 64817–831: [PubMed] [libre Lleno Texto].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila UN (2000) Características y frecuencia de germline mutaciones a microsatellite loci del humanismo Y cromosoma, como revelar por directo observación en padre/ hijo parejas. Estoy J Hum Genético 661580–1588: [PubMed] [ libre Lleno Texto].
Kwok C, Tyler- Herrero C, Mendonca BB, Hughes Yo, Berkovitz GD, Goodfellow PN, Cetrería JR (1996) Mutación análisis de la 2 kb 5' a SRY en XY hembras y XY cortar materias J Med Genético 33465–468: [PubMed].
Largo JC (1991) El genético estructura de mezclado poblaciones. Genética 127417–428: [PubMed] [libre Lleno Texto].
Mathias N, Bayes M, Tyler- Herrero C (1994) Altamente informativo compuesto haplotypes por el humanismo Y cromosoma. Hum Mol Genético 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansoor Un, Ismail M, Martillo MF, Secreto Papá, Cabalgata-Sforza LL (1999) El orígenes de Paquistán poblaciones evidencia desde Y cromosoma marcadores. en Papista SS, Deka R, Chakraborty R (eds) Genocidio diversión: aplicaciones en humanismo población genética Kluwer Académico/ Plenario Editores, Nueva York, pp 83–90.
Mohyuddin Un, Ayub Q, Qamar R, Zerjal T, Helgason Un, Mehdi SQ, Tyler- Herrero C (2001) Y- cromosoma STR haplotypes en Paquistán poblaciones Forense Sci Int 118141–146: [PubMed] [lleno Texto].
Nanavutty P (1997) El Analizar sintácticamente. Nacional Libro Confianza, Nuevo Delhi, India.
Panda Un, Rey TE, Santos FR, Taylor PG, Thangaraj K, Cantar L, Sin empleo MA, Tyler- Herrero C (1998) UN polimorfo humanismo Y- cromosoma G a UN transición fundar en India. Ind J Hum Genético 452–61:.
Qamar R, Ayub Q, Khaliq S, Mansoor Un, Quilate T, Mehdi SQ, Martillo MF (1999) Africano y Levantine orígenes de Paquistán YAP+ Y cromosoma. Hum Biol 71745–755: [PubMed].
Quddus SA (1990) El tribal Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Paquistán.
Quintana-Murci L, Krausz C, Zerjal T, Sayar SH, Martillo MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin Un, Radhakrishna U, Sin empleo MA, Tyler- Herrero C, McElreavey K (2001) Y- cromosoma abolengos rastro difusión de personas y lenguajes en del sudoeste Asia. Estoy J Hum Genético 68537–542: [PubMed] [libre Lleno Texto].
Manto DF, Hiorns R (1965) Métodos de análisis de la genético composición de un híbrido población. Hum Biol 3738–43:.
Robertson GS (1896) El Kafirs de la Hindú-Kush. Oxford Universidad Prensa, Quilate, Paquistán.
Rosser ZH, Zerjal T, Hurles Mí, Adojaan M, Alavantic D, Amor Un, Amos W, et al (2000) Y- cromosoma diversión en Europa es remachar y influencia fundamentalmente por geografía, en vez de por lengua. Estoy J Hum Genético 671526–1543: [PubMed] [ libre Lleno Texto].
Santos FR, Carvalho- Plata DR, Penal SDJ (1999a) PCR- con base en DNA perfil de humanismo Y cromosoma en Epplen JT, Lubjuhn T (eds) Métodos y herramientas en biosciences y medicina. Birkhauser Verlag, Infundado, Suiza, pp 133–152.
Santos FR, Panda Un, Kayser M, Mitchell RJ, Liu Un, Cantar L, Destruir- Bisonte G, Novelletto Un, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Herrero C (2000) UN polimorfo L1 retroposon inserción en el centromere de la humanismo Y cromosoma. Hum Mol Genético 9421–430: [PubMed] [ libre Lleno Texto].
Santos FR, Panda Un, Tyler- Herrero C, Penal SD, Schanfield M, Leonard WR, Osipova L, Langostín MH, Mitchell RJ (1999b) El central Siberiano origen por nativo Americano Y cromosoma. Estoy J Hum Genético 64619–628: [PubMed] [ libre Lleno Texto].
Schneider S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: un software por población genético datos análisis Genética y Biometry Laboratorio, Universidad de Ginebra, Suiza.
Seielstad MT, Hebert JM, Lin AA, Secreto Papá, Ibrahim M, Vollrath D, Cabalgata-Sforza LL (1994) Construcción de humanismo Y- cromosoma haplotypes usando un nuevo polimorfo UN a G transición. Hum Mol Genético 32159–1261: [PubMed].
Espinilla T, Tomita K, Hoy T, Kotliarova SE, Abrigo J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genético variaciones en la Y cromosoma en el Japonés población y implicaciones por moderno humanismo Y cromosoma abolengo. J Hum Genético 44240–245: [PubMed].
Thomas MG, Clavito N, Tiro HM (1999) Alto volumen global de consumo análisis de 10 microsatellite y 11 diallelic polimorfismo en la humanismo Y- cromosoma. Hum Genético 105577–581: [PubMed] [lleno Texto].
Tyler- Herrero C (1999) Y- cromosoma DNA marcadores. en Papista SS, Deka R, Chakraborty R (eds) Genocidio diversión: aplicaciones en humanismo población genética Kluwer Académico/ Plenario Editores, Nueva York, pp 65–73.
Secreto Papá, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, Pescante RW, Cabalgata-Sforza LL, Oefner PJ (1997) Detective de numeroso Y cromosoma biallelic polimorfismo por desnaturalizar alto- ejecución líquido chromatography. Genocidio Res 7996–1005: [PubMed] [libre Lleno Texto].
Pozos RS, Yuldasheva N, Ruzibakiev R, Secreto Papá, Evseeva Yo, Azul- Herrero J, Jin L, et al (2001) El Eurasian despiadado: un continental perspectiva en Y- cromosoma diversión Proc Natl Académico Sci EUA 9810244–10249: [ libre Lleno texto en PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Secuencia variación de la humanismo Y cromosoma Índole 378379–380: [PubMed] [ lleno Texto].
Wilson IJ, Calvo DJ (1998) Genealógico inferencia desde microsatellite datos. Genética 150499–510: [PubMed] [ libre Lleno Texto].
Wolpert S (2000) UN nuevo historia de India. Oxford Universidad Prensa, Nueva York.
Joven FW, Prohibido CM (1996) UN visual estadísticas sistema. en Picadura RA, Zorro J (eds) Estadístico informática medios ambientes por baile social investigador. Salvia Publicaciones, Nueva York, pp 207–236.
Zerjal T, Hacer señas L, Hacer señas G, Mikelsaar AV, Krumina Un, Kucinskas V, Hurles Mí, Tyler- Herrero C (2001) Geográfico, lingüístico, y cultural influencias en genético diversión: Y- cromosoma distribución en Del norte Europea poblaciones. Mol Biol Evol 181077–1087: [PubMed] [ libre Lleno Texto].
Zerjal T, Dashnyam B, Panda Un, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Fretwell N, Sin empleo MA, Harihara S, Brillo K, Semjidmaa D, Sajantila Un, Salón P, Langostín MH, Ginter EK, Evgrafov OV, Tyler- Herrero C (1997) Genético parentescos de Asiáticos y Del norte Europeas, revelar por Y- cromosoma DNA análisis. Estoy J Hum Genético 601174–1183: [PubMed].

 

Último de la página puesto al día: Friday, November 25, 2005 22:32:57 -0500