Genetik

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی

 

Chromosom DNA Variation in Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Agnar Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Christus Tyler- Befallen also. Qasim Mehdi1

1Biomedical und Genetisch Entwicklung Abteilung, Dr. ein Q. Khan Forschung Laboratorien, Islamabad; 2Cancer Forschung Feldzug, Chromosom Molekular Biologie Gruppe, Abteilung über Biochemie, und 3Institute über Biologisch Anthropologie, Universität über Halbschuhe, Halbschuhe, Vereint Königreich; und decodieren Genetik, Reykjavik.


Abstrahieren

Achtzehn binär polymorphisms und 16 multiallelic, kurz- Tandem- wiederholen (STR) Örter vom nonrecombining Stück des menschlich Y Chromosom wart maschinegeschrieben in 718 Mann Untertanen angehörend 12 ethnisch Gruppen über Pakistan. Dieser erkannt 11 Stall haplogroups und 503 Kombination binär Anzeiger/STR haplotypes. Haplogroup Häufigkeiten wart allgemein ähnlich zu derjenige in neighboring geographisch Flächen, und die Pakistani Bürgerschaften sprechend ein Programmiersprache abgrenzen ( die Burushos), ein Dravidian Programmiersprache ( die Brahui), oder auch ein Sino- Tibetanisch Programmiersprache ( die Baltisch) glicht die Indo-European–speaking Mündigkeit Dennoch, Mittellinie- beitritt Sendergruppen über haplotypes deckte auf ansehnlich Grundlage über Y Variation innerhalb Pakistan, mit manche Bürgerschaften weisend ausgeprägt Anhäufungen über haplotypes. Dieser Vorlagen könnt sein begründete als beim ein allgemein Tümpel über Y Abkunft, mit wesentlich Isolierung zwischen Bürgerschaften und Ablenkung am kleiner einige Einige komparativ genetisch oder auch historisch Datei bist erhältlich als höchst Bürgerschaften, aber die Resultate könnt sein verglich mit mündlich Überlieferungen bei Ursprünge Die Y Datei Unterstützung die wohlauf- eingeführt erwiesen Ursprung des Bestimmen grammatisch in Persisch, die angeregt Abkunft des Gefahr ab Genghis Khan’s Armee, und die Ursprung über die Neger Makrani in Afrika, aber ausführen nicht Unterstützung Überlieferungen über Tibetanisch, Syrier, Grieche, oder auch Jüdisch Ursprünge als sonstig Bürgerschaften.


Einführung

Die früheste Aussage über Paleolithic menschlich Vorhandensein am Süden Asien bestehen über steinigen führt aus gefunden gestreut herum die Soan Strom Tal in nördlich Pakistan ( Husar 1997). Trotz die Atemnot fossil Aussage, dieser Rüstzeug anmuten zu andeuten die Vorhandensein über heimkehrend am Süden Asien als baldig als 200,000–400,000 Jahren her (Wolpert 2000) und so bist wahrscheinlich zu bekommen gewesen angeschlossen mit altertümlich Homo Geschlecht. Pakistan liegt an die forderte südlich Küsten Weg folgte beim anatomisch modern Homo Weisheit außer Afrika, und so darf sind worden bewohnte beim modern Menschen als baldig als 60,000–70,000 Jahren her. Es ist Aussage über Höhle Bewohner in Pakistan’s nordwesten Grenze, aber fossil Aussage vom Paleolithic hat gewesen bruchstückhaft ( Husar 1997). Aussage ist gewesen ungedeckt am Mehrghar, in südwestlich Pakistan, hindeutend Neolithic Siedlungen ab als vor lange Zeit als 7,000 b.c. (kreischend 1991), welches wart folgte beim die Indus Tal civilizations ( eingeschlossen die Städte über Ansprache und Mohenjodaro) jene blühte am 3d und 2d Jahrtausende b.c. (Täler 1991). Herum 1500 vor unserer Zeitrechnung, die Indo-European–speaking nomadisch Pastoral- Stämme ab fördern north—often aufgerufen die Aryans—crossed die Karakorum Berge hinein die Süden Asien. Nachträglich historisch Ereignisse aufnehmen die Angriff über Alexander die Groß (327–325 vor unserer Zeitrechnung) und die Araber und Moslem Eroberung ab 711 a.d. vorwärts (Wolpert 2000).

Die überreichen Einwohnerschaft über Pakistan bestehen über mehr denn 160 Million Einzelfälle ( entsprechend zu 2005 WER Figuren) wer angehören mindestens 18 ethnisch Gruppen und sprichst mehr denn 60 Sprachen ( Schmutz 1992). Meist dieser Sprachen bist Indo- Europäer, aber Sie auch aufnehmen ein abgrenzen, Burushaski; ein Dravidian Programmiersprache, Brahui; und ein Sino- Tibetanisch Programmiersprache, Baltisch. Punjabi- sprechend Einzelfälle ausbilden die Mündigkeit Einwohnerschaft über Pakistan, aber Sie vorstellen ein komplex Beimischung über ethnisch Gruppen (Ibbetson 1883) und bist nicht analysiere hier; 12 ethnisch Gruppen bist einbegriffen am überreichen Übersicht. Aufschluß erhältlich bei Sie ist Zusammenfassungen in Tisch 1, samt Hypothesen bei ihre Ursprünge (Mehdi et al. 1999). Obgleich welche über dieser Hypothesen bist wohlauf- unterstützte ( z.B., die Ursprung des Bestimmen grammatisch in Persisch), höchst bist basierend fort mündlich Überlieferungen und bekommen nicht gewesen getestet gegen sonstig Ursprünge über Aussage.

Spärlich genetisch Datei bist erhältlich als dieser Pakistani ethnisch Gruppen Baldig Studium über die ABO Blutgruppen und klassisch Protein Anzeiger tat nicht aufnehmen alle Gruppen und zumeist geordnet Sie gemäß ihre unterbringen über Residenz. EIN Einwohnerschaft Baum basierend fort 54 klassisch Enzym Anzeiger Örter die Gefahr und Weg am Abendland Asiat anhäufen beinhalten die nördlich Caucasoids (Kavalkade-Sforza et al. 1994). In andere Einwohnerschaft Baum, basierend fort 47 klassisch Protein polymorphisms, die Pakistani Warenproben ausbilden ein klein subcluster innerhalb die Indo- Europäer Sprecherinnen ab Indien ( Kavalkade-Sforza et al. 1994).

Die Y Chromosom vorausgesetzt ein einzigartig Ursprung über genetisch Aussage (Tyler- Befallen 1999; Arbeitslos und Tyler- Befallen 2000). Es trägt die größte nonrecombining Abschnitt in die Völkermord und beinhaltet zahlreich Stall binär Anzeiger, eingeschlossen Bezugsgröße Ersetzungen (übersehen, z.B., Hinterhältig et al. 1997) und retroposon Einfügungen ( Anschlaghammer 1994; Santos et al. 2000), welches könnt sein gebraucht in Kombination mit mehr- schnell entwickelnd Anzeiger, zum beispiel microsatellites (übersehen, z.B., Ayub et al. 2000). Demzufolge, sehr ausführlich Y Stammesgeschichte könnt sein baute jene einräumen Mann- spezifisch Aspekte über genetisch Geschichte zu sein untersuchte. Dieser bist stark beeinflußte beim die klein wirksam Einwohnerschaft Umfang des Y Chromosom, führend zu sprunghaft genetisch Ablenkung, und beim die Übung über patrilocality in manche Verbände, führend zu gehoben Ebenen über geographisch Differenzierung über Y haplotypes. Nichtsdestoweniger die Kunstwerk Qamar et al. (1999) an die Analyse über Bellen+ Chromosomen ( umfassend ~2.6% des total) und Analysen über STR Variation (Ayub et al. 2000; Mohyuddin et al. 2001), klein wirken ist gewesen trug raus fort Pakistani Y Chromosomen. Somit, wir haben nun jetzt ausführte ein ausgiebig Analyse über Pakistani Y Abkunft, zu ausmachen welches anstecken Sie könnt Verschlag an die Ursprünge und genetisch Kunstgeschichte die Untergruppen jene aufholen die Pakistani Einwohnerschaft.


Körperlich und Methoden

Warenproben
Die Y Chromosomen über 718 ohne beziehung Mann Untertanen, angehörend 12 ethnisch Gruppen über Pakistan, wart analysiere (Tische 1 und 2; Feige. 1). Informiert einwilligen war erhielt ab alle Teilnehmer in dieses studiert. Ein Epstein Baracke virus–transformed lymphoblastoid Speicherelement Zeile war eingeführt erwiesen ab jeden einzeln, und DNA war ausgeblendet ab dieser Speicherelement Linien als Analyse.


Binär Polymorphism Abtippend
Wir maschinegeschrieben 15 SNPs, ein Alu Einfügung ( Anschlaghammer 1994; Anschlaghammer und Horai 1995), ein Zeile Einfügung (Santos et al. 2000), und die 12f2 Löschung ( Schwerenöter et al. 1985). Die Bezugsgröße Ersetzungen wart 92R7 C?T (Mathias et al. 1994); M9 C?G ( hinterhältig et al. 1997); SRY-2627 C?T (Bianchi et al. 1997); SRY-1532 einG?EIN (Whitfield et al. 1995; Kwok et al. 1996; Santos et al. 1999b); sY81 (DYS271) Ein?G (Seielstad et al. 1994); SRY-8299 G?Ein (Santos et al. 1999a); Passend G?EIN ( Panda et al. 1998); SRY +465 C?T ( Schienbein et al. 1999); LLY22g C?EIN und Tat T?C Übergang (Zerjal et al. 1997). Darüber hinaus, die M17 Anzeiger ( hinterhältig et al. 1997) war maschinegeschrieben, beim Verwendung des Fibeln GTGGTTGCTGGTTGTTACGT und AGCTGACCACAAACTGATGTAGA folgte beim AflIII Verdauung des PCR Produkt; die angestammt Loblied war nicht verdaute Die M20 Anzeiger (hinterhältig et al. 1997) war Erbmasse, beim Verwendung über die Fibeln CACACAACAAGGCACCATC und GATTGGGTGTCTTCAGTGCT folgte beim SspI Verdauung; die Ein?G Mutation vernichtet die Seite am Stellung 118 am 413-bp Produkt. M11 (hinterhältig et al. 1997) war maschinegeschrieben, benutze die Fibeln TTCATCACAAGGAGCATAAACAA und CCCTCCCTCTCTCCTTGTATTCTACC folgte beim Verdauung mit MspI. Die 215-bp Produkt war verdaute zu 193-bp und 22-bp Bruchstücke am leitete her Loblied Die RPS4Y C?T Mutation (Bergen et al. 1999) war entdeckte beim BslI Einschränkung Verdauung einer 528-bp PCR Produkt erhielt beim Verwendung des Fibeln CCACAGAGATGGTGTGGGTA und GAGTGGGAGGGACTGTGAGA. Die angestammt C Loblied beinhaltet zwei lagen, und die leitete her T Loblied beinhaltet man. M48 (hinterhältig et al. 1997), einG, war maschinegeschrieben beim Loblied- spezifisch PCR benutze die Benachteiligung Fibeln TGACAATTAGGATTAAGAATATTATA und TGACAATTAGGATTAAGAATATTATG und die allgemein Fibel AAAATTCCAAGTTTCAGTGTCACATA zu entwickeln spezifisch 145-bp Produkte Die verlegen über Y binär Anzeiger Loblied trug beim ein ledig einzeln Wille sein verwiesen zu als “the Y haplogroup.”
Des 718 Warenproben, 717 abschlagen hinein haplogroups erwartete unter Berücksichtigung die bekannt Stammesgeschichte, aber man Weg Warenprobe (PKH134) fehlgeschlagen zu erweitern am SRY –1532 und M17 Örter. Er war teilte zu zu haplogroup 3 auf der Grundlage über alternativ SRY –1532 Fibeln ( Einzelheiten fort ersuchen) und sein STR Profil.


Y-STR Abtippend
Fünf trinucleotide- wiederholen polymorphisms (DYS388, DYS392, DYS425, DYS426, und DYS436), zehn tetranucleotide- wiederholen polymorphisms (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, und DYS439) und man pentanucleotide microsatellite (DYS438) wart maschinegeschrieben zusammen Y Chromosomen. Drei Mehrfach PCR Rückwirkungen wart ausführte als alle Y-STRs, in a10-µl abschließend Rückwirkung Volumen beinhalten 20 ng Völkermord DNA, als beschrieb anderswo (Thomas et al. 1999; Ayub et al. 2000). PCR Produkte wart verkehren fort ein ABI 377 Ablaufsteuerung. ABIGS350 TAMRA war gebraucht als die inner- Fahrbahn Standard. Die GENEN und ERBMASSE Software Packe wart gewohnt an kassieren die Datei und zu analysiere Bruchstück Umfänge Y-STR Loblied wart benannt gemäß die Zahl über wiederholen Verbände Sie contain.The Zahl über wiederholen Verbände war eingeführt erwiesen hindurch die Verwendung über aufeinanderfolgend Verweisung DNA Warenproben. Loblied Längen als DYS389b wart erhielt beim Abzug des DYS389II Loblied Dauer ab DYS389I.
Y-STR Vervielfältigungen wart gefunden am mehrere einzelne Örter. DYS393 war vervielfältigte in PKH165 (13 und 15) und DYS437 war vervielfältigte in SDH181 (8 und 9). EIN mehr komplex Vorlage war gefunden in DYS425, wohin zwei zu vier Loblied wart gefunden in 36 Einzelfälle ab haplogroups 8, 9, 13, und 21.


Datei Analyse
Fürstentum- Bauteile Analyse war trug raus fort haplogroup Häufigkeiten beim Verwendung des Aussicht ( visuell Statistik) System Software, Fassung 5.0.2 (Junges und Verbot 1996). Als anschaulich Vertretung, die beste und zweite Fürstentum Bauteile wart ausgeheckt beim die Mikroskop Stelle Flucht Auszeichnen Verpacken fort Fenster 2000. Biallelic polymorphism Datei als verschiedenartig Welt Bürgerschaften gebraucht am Analyse wart erhielt ab Anschlaghammer et al. (2001). Beimischung war pauschal beim Verwendung über drei unterschiedlich Maßnahmen: Lang beschwert geringste- Quadrate (WLS) abmessen ( lang 1991); mR, ein geringste- Quadrate Abbild (Robert und Hiorns 1965); und m? (Helgason et al. 2000).

Analyse über molekular Streuung (AMOVA) war trug raus beim Verwendung des Arlequin verpacken (schneiden et al. 1997). AMOVA Maßnahmen die Verhältnisse über veränderlich Divergenz gefunden innerhalb und zwischen Bürgerschaften, jeweils beziehungsweise. Obgleich menge des Variation am schnell verändernd microsatellite Örter ist erwartete zu sind worden vorzeigen in die unterschiedlich Pakistani subpopulations, die einzigartig Mutation Ereignisse am binär Örter bist menge alter und bekommen nicht kam vor am Zusammenhang des Unterabteilung des Pakistani Einwohnerschaft. Wir austüfteln die das Folgende Strategie zu ausbeuten die Höchstwert Betrag über zweckdienlich veränderlich Aufschluß ab die Y- Chromosom haplotypes. STR Variation innerhalb haplogroups war gewohnt an ausrechnen Einwohnerschaft pairwise FST Werte als jeden einzeln haplogroup. Als jeden Einwohnerschaft Paar, ein beschwert armselig FST war kalkuliert, wohin die Wert erhielt als jeden haplogroup war beschwert gemäß die Verhältnis über pairwise Vergleichungen einbeziehen bedingen jene haplogroup. Am Abwesenheit einer wählerisch haplogroup ab man Einwohnerschaft, Ein, des Paar EIN und B, FST war verlegen zu 1, und die Zahl über pairwise Vergleichungen war sich befassen mit als die Zahl über Chromosomen tragend jene haplogroup in B. Werte über FST basierend fort STRs allein oder auch fort STRs zuzüglich binär Anzeiger, mit binär Anzeiger gegeben ein 10- Bruch höher Bewertung, wart kalkuliert als Vergleichung. Zusammen über dieser Analysen, die Abstand Matrize gebraucht bestand aus des Zahl über Trittbretter wobei jeden Paar über haplotypes wich ab. Hülle Proben fürs Bedeutung über Wechselbeziehungen zwischen FST Werte wart trug einwerfen Arlequin, und multidimensional einteilend (MDS) Verschwörungen wart baute beim Verwendung des SPSS Fassung 7.0 Software verpacken.

Mittellinie- beitritt Sendergruppen wart baute beim Geflecht 2.0b ( Stirnband et al. 1999). EIN Bewertung Schema mit ein fünf- Bruch Umfang war gebraucht am Bau des Sendergruppen. Die Schweren teilte zu wart spezifisch als jeden haplogroup und nahmt hinein abrechnen die Y-STR Variation quer auf dem Bett haplogroup in im Bausch und Bogen Pakistani Einwohnerschaft. Die das Folgende Schweren wart gebraucht Streuung 0-0.09, Schwere 5; Streuung 0.1-0.19, Schwere 4; Streuung 0.2-0.49, Schwere 3; Streuung 0.5-0.99, Schwere über 2; und Streuung 1.00, Schwere 1. Trotz dieses, die Geflecht als haplogroup 1 beinhaltete manche gehoben Abmessung Würfel und war nahm vor beim auflegen die baute ab Mittellinie und Mittellinie beitritt Geflecht Methoden folgend. baute ab Mittellinie Algorithmus (Stirnband et al. 1995) war gewohnt an entwickeln ein *.rmf Akte und die Mittellinie beitritt Geflecht Methode war angewandt hierzu Akte.

BATWING (Wilson und Kahl werdend 1998), Bayesian Analyse über Bäume Mit Inner- Knoten Erzeugung, war gewohnt an Abbild die Zeitrechnung zur höchst vor kurzem allgemein Ahn (TMRCA) einer verlegen über Chromosomen. Dieses program Verwendungen ein Anmerken anketten Montage Wagenladung Verfahren zu entwickeln phylogenetic Bäume und angeschlossen Parameter Werte vereinbar mit Aufnahme Datei ( ein verlegen über Y haplotypes) und genetisch und demographic Modelle Die genetisch formen nimmt an ledig- trittst Mutationen des STRs und die demographic formen gewählt war exponentiell Anwachsen ab ein anfänglich beständig- maß aus Einwohnerschaft, mit oder auch von außen Unterabteilung in unterschiedlich rennt des program. Alle 16 STR Örter wart gebraucht; Ort- spezifisch Mutation werten früher Wahrscheinlichkeiten basierend an die Datei über Kayser et al. (Kayser et al. 2000) wart baute fürs Örter erhältlich als Gamma Verteilungen des ausbilden Gamma(, b) wohin ein = (1 + Zahl über Mutationen beobachtete beim Kayser et al.), und b = (1 + Zahl über meioses). Als Örter nicht untersuchte beim Kayser et al., die Verbreitung Gamma (1,416) war gebraucht, welches hat ein armselig über 0.0024. EIN Erzeugung Zeitrechnung über 25 Jahren war angenommen. So die 95% Geheimnis Intervalle gegeben einrechnen Unsicherheit in Mutation werten, Einwohnerschaft Anwachsen und ( wohin aneignen) Unterabteilung, aber nicht Erzeugung Zeitrechnung.

Resultate

Y- Chromosom Binär Polymorphisms
Die 18 binär Anzeiger gebraucht identifizieren 20 haplogroups in worldwide Bürgerschaften Feige 1A), aber nur bloss erst 11 wart gefunden in Pakistan, und 5 begründete als 92% des Warenprobe ( Feige. 1 und Tisch 2). Haplogroups 1 und 9 wart überreichen zusammen Pakistani Bürgerschaften untersuchte, haplogroup 3 war überreichen zusammen ausgenommen die Gefahr, und haplogroup 28 war überreichen zusammen ausgenommen die Gefahr und die Kashmiris. Südwestlich Bürgerschaften äußern höher Häufigkeiten über hg 9 und die Bellen+ haplogroups 21 und 8 denn nordöstlich Bürgerschaften ( Feigen. 1D–E), aber, Kittel, klein geographisch drängend über haplogroup Häufigkeiten ist anscheinend innerhalb die Land.


Fürstentum- Bauteile Analyse
Wir wünschte zu vergleichen die Pakistani Y haplogroup Datei mit Datei ab Bürgerschaften vom ruhen des Welt. Null zweckmäßig Datei war erhältlich fürs ganz verlegen über 18 Anzeiger, aber die Datei über Anschlaghammer et al. (2001) erlauben alle aber 5 zu sein gebraucht, weil dieselbe oder auch phylogenetically gleichwertig Anzeiger wart gemeldeten. Fürstentum- Bauteile Analyse Feige 2A) weist welche Differenzen vom ursprünglich Analyse über Anschlaghammer et al., die hauptsächlich man dasein die Leasingnehmer Trennung des Afrikaner Bürgerschaften. Dieses ist fällig, zu ein erklecklich Ausdehnung, zur Teilmenge über Anzeiger gebraucht, welches tut nicht aufnehmen manche des Afrika- spezifisch einige. Höchst Pakistani Bürgerschaften anhäufen mit Süden Asiat und Mitte Östlich Bürgerschaften, und bist nah Nördlich Afrikaner, Vordergründig Asiat und Europäer Bürgerschaften, so weisend ein allgemein Ähnlichkeit mit geographisch zusammenklappen Bürgerschaften. Derjenige Ausnahme ist die Gefahr, wer bist recht ausgeprägt. EIN ähnlich Analyse des Pakistani Bürgerschaften allein, benutze alle des binär Anzeiger ( Feige. 2B), bestätigt die Mißhelligkeit dazwischen Gefahr und Anderen Bürgerschaften und auch mehr deutlich weist die Verschiedenheit des Kalash und die Bestimmen grammatisch. Es ist markant jene die Programmiersprache isolate–speaking Burusho und die Dravidian- sprechend Brahuis ausführen verbitten raus in dieser Analysen.


Beimischung Ansätze
Hypothesen bei Einwohnerschaft Ursprünge ( Tisch 1) könnt sein gelten als quantitativ Rückfragen bei Beimischung. Zum beispiel, zu testen die Möglichkeit jene die Geländersäule Y Chromosomen bekommen ein Syrier Ursprung, wir könnt auffordern welches Verhältnis des Geländersäule Ys bist leitete her ab Syrier und welches Verhältnis bist ab Pakistan ( besonnen zu sein die Pakistani Warenprobe minus die Geländersäule). Datei fort angeregt Ursprung Bürgerschaften wart sich befassen mit vom Literatur und drei Maßnahmen über Beimischung wart kalkuliert. Die drei Ansätze gab breit vereinbar Resultate, mit klein systematisch Differenzen typischerweise m? > mR > Lang WLS fürs pauschal Beitrag vom auswärtig Ursprung Einwohnerschaft ( Tisch 3). Dieser Resultate versorgen Aussage als ein auswärtig Beitrag zur Gefahr, Kalash, Neger Makrani, und Bestimmen grammatisch aber nicht zur sonstig Bürgerschaften.


Y- Chromosom STR Polymorphisms
Y-STR polymorphisms wart studiertet zu herausschlagen ein mehr ausführlich Überblick über Y Variation, inmitten die unterschiedlich Pakistani ethnisch Gruppen, jene würden sein geringer voreingenommen beim die Anzeiger- Ermittlung Verfahren Die Mannigfaltigkeit über Y-STR haplotypes ( Tisch 4) war unterste fürs Gefahr (0.893) als angeregt beim vorig Analysen (Ayub et al. 2000).
Die 16 Y-STRs definiert 502 Y haplotypes, die riesig Mündigkeit dasein beobachtete in ledig Einzelfälle Die übrig haplotypes wart gemeinsam benutzt beim 2–18 Einzelfälle ( Einzelheiten bist gegeben am online- nur bloss erst zusätzlich Tisch). In alle Auswahl aber man, die Chromosomen gemeinsame Benutzung ein haplotype angehörte zur gleich haplogroup ( also, 503 Kombination haplotypes) und, in höchst Auswahl, die Einzelfälle gemeinsame Benutzung ein haplotype angehörte zur gleich Einwohnerschaft (Tisch 5).

Die GST und modal Umfang des wiederholen Verband, als alle 16 Y-STRs untersuchte am Pakistani Einwohnerschaft, bist gegeben in Tisch 6. Die Wechselbeziehung zwischen Anzeiger heterozygosity und GST war gefunden nicht zu sein wesentlich (r0.329=; P=.213). Die modal Umfang und Streuung des 16 Y-STRs innerhalb haplogroups 1, 2, 3, 8, 9, 10, 21, 26, und 28 ist auch gegeben in Tisch 6. Bestimmt haplogroups bekommen ein unterschiedlich modal Loblied Umfang, und welche Beispiele über dieses bist gewiesen in frech Kursivschriften in Tisch 6. Als Beispiel, DYS388 hat 15 wiederholt in haplogroup 9, gegenüber 12 wiederholt in meist Anderen haplogroups in Pakistan. Ähnlich, die modal Loblied als DYS438 ist 9 in haplogroup 9, aber 10 oder auch 11 am sonstig haplogroups. Die modal Loblied als DYS434 als haplogroup 10 ist 11, welches ist auffallend unterschiedlich vom Loblied Umfang über dieses Ort in sonstig haplogroups. Die absolvieren Atemnot Veränderlichkeit als DYS436 am 233 Mann Untertanen angehörend haplogroup 3 ist werklich. Haplogroup 10 erscheint zu bekommen die geringste Veränderlichkeit dwars höchst Örter ausgenommen DYS390 ( Tisch 6). Dieser Tatbestand beweisen die stark aufbauend über Y-STR Veränderlichkeit beim haplogroup.

Wir wolltet zu ausrechnen ein Y- basierend abmessen über genetisch Abstand zwischen Bürgerschaften jene würden widerspiegeln die Differenzierung jene hatte kam vor innerhalb Pakistan und jene würden nicht sein widerlegbar dominierte beim alt Differenzen jene hatte früher ansammeln zwischen haplogroups. Standard Weise zu ausführen dieses würdet sein zu Verwendung STR Variation, und Tisch 7 Zusammenfassungen Einwohnerschaft pairwise Werte über FST fort die Anhaltspunkt über STR Variation allein ( ein) oder auch über binär- Anzeiger zuzüglich STR Variation (B), mit binär- Anzeiger Differenzen beschwert 10 Male höher denn STR Differenzen. Dieser Grundsubstanzen bist hoch entsprach (r0.95=; P.001<), als könnte sein erwartete vom aufbauend über STR Variation beim haplogroup. Doch, dieser Maßnahmen bist bedeutend beeinflußte beim alt Differenzen, und wir haben somit ausgeprägt ein modifiziert abmessen. Wir argumentierte jene menge des STR Variation innerhalb haplogroups würden bekommen entstand vor kürzem und kann sein gebraucht hierfür Zweck Wir somit kalkuliert Einwohnerschaft pairwise Werte über FST, unter Berücksichtigung STR Variation innerhalb haplogroups, und gebraucht ein beschwert Durchschnitt über dieser zu vorzeigen ein ledig FST Abstand Matrize ( Tisch 7C; Feige. 3). Dieser Entfernungen bist auch hoch entsprach mit Entfernungen basierend fort STRs allein (r0.76=; P.001<) oder auch fort STRs zuzüglich binär Anzeiger (r0.70=; P.001<), aber ein großartiger Verhältnis über die Variation ist gesehen zwischen Bürgerschaften (22%, verglich mit 6% und 7%, jeweils beziehungsweise). EIN Vergleichung über Figur 3 mit Figur 2B ( welches war basierend fort binär Anzeiger Häufigkeiten allein) deckt auf ein markant Kittel Ähnlichkeit, mit die Gefahr dasein ausgeprägt ab alle des sonstig Bürgerschaften. Anderen außerhalb Bürgerschaften bist die Kalash und Bestimmen grammatisch (als bevor), die Kashmiris (vielleicht aufgrund die klein Warenprobe), und die Brahuis, wer bist so mehr ausgeprägt in ihre STR Profile denn haplogroup Häufigkeiten. MDS Verschwörungen des Entfernungen in Tische 7A und 7B ( nicht gewiesen) anleiten ähnlich Abschlüsse, aber ähneln Figur 2B mehr dicht am Weise jene die Brahuis ausführen verbitten raus soviel.


Mittellinie- Beitritt Sendergruppen
Die genetisch Verhältnisse inmitten die unterschiedlich Pakistani ethnisch Gruppen wart untersuchte fördern beim zeichnend Mittellinie- beitritt Sendergruppen ( Stirnband et al. 1995), und Beispiele bist gewiesen in Figuren 4, 5, und 6. Die haplogroup 1 Geflecht Feige 4) deckt auf ansehnlich Variation, aber auch ein gehoben Härte Einwohnerschaft- spezifisch Grundlage Zum beispiel, die 24 Bestimmen grammatisch haplogroup 1 Chromosomen alle zerfallen in man über drei Anhäufungen ( Feige. 4, grün), 19 über 26 Burusho haplogroup 1 Chromosomen zerfallen in zwei Anhäufungen ( blau), und 12 über 14 Gefahr haplogroup 1 Chromosomen zerfallen in ein ledig anhäufen, und alle über dieser Anhäufungen bist spezifisch zu ihre jeweilig Bürgerschaften. Die haplogroup 10 Geflecht Feige 5) ist menge simpel, aufgrund die kleiner Zahl über Chromosomen, aber wieder deckt auf Einwohnerschaft- spezifisch drängend als Burusho und Gefahr haplotypes. Die haplogroup 28 Geflecht ( Feige. 6) weist ein markant isoliert Bestimmen grammatisch- spezifisch anhäufen, am Schluß einer lang Ast, beinhalten 15 über 16 Bestimmen grammatisch haplogroup 28 Chromosomen. Anhäufungen über Kalash, Burusho, and—to ein Leasingnehmer degree—Baluch Chromosomen bist auch ersichtlich, obgleich man Geländersäule haplotype ist gemeinsam benutzt mit Sindhi und Makrani Geländersäule Einzelfälle ab nahe südlich Bürgerschaften.
BATWING TMRCAs wart kalkuliert fürs haplogroup 28 Geflecht und als ausgewählt Abkunft innerhalb manche haplogroups. Die Resultate bist Zusammenfassungen in Tisch 8.

Besprechung

Wir haben trug da draußen beste ausgiebig Analyse über Y Mannigfaltigkeit innerhalb Pakistan, untersuchend 34 Anzeiger in 718 Mann Untertanen ab 12 Bürgerschaften Dieses erlauben uns zu vergleichen Pakistani Y Mannigfaltigkeit damit früher gemeldeten in Welt Bürgerschaften, zu besichtigen Differenzen innerhalb Pakistan, und zu auswerten welche des angeregt Einwohnerschaft Geschichten ab ein Y Perspektive.


Vergleichungen mit Worldwide Datei
In ein worldwide Vergleichung, Pakistani Bürgerschaften zumeist anhäufen herum ein konzentriert Süden Asiat Warenprobe und Lage nah ein Mitte Östlich Warenprobe ( Feige. 2A). Dieses Befund ist unsurprising, teilweise weil die Süden Asiat Warenprobe einbegriffen 62 Pakistani Einzelfälle (i.e., 32% über 196 total) und teilweise weil Y Variation in manche Flächen des Welt ist vorherrschend baute auf beim Erdkunde, nicht beim Programmiersprache oder auch ethnisch Angliederung (Rosser et al. 2000; Zerjal et al. 2001). Die großartiger genetisch Ähnlichkeit über Pakistani Bürgerschaften zu derjenige am Abendland denn zu östlich Bürgerschaften ist veranschaulichte beim die Gegebenheit jene vier des fünf häufig haplogroups in Pakistan (haplogroups 1, 2, 3, und 9, welches zusammen aufholen 79% des total Einwohnerschaft) bist auch häufig in westlich Asien und Europa aber nicht in Porzellan oder auch Nipon; umgekehrt, die haplogroups jene bist häufig in Ost Asien ( z.B., 4, 5, 10, 13, und 20) bist selten oder auch abwesend in Pakistan, Prägung nur bloss erst 2.5% des total Falls, als in welche Darstellungen, ein baldig Auszug ab Afrika einher die südlich Küste über Asien führte zur beste anatomisch modern menschlich Bürgerschaften in Pakistan, und dieser Volk trug die östlich haplogroups oder auch ihre Vorboten, ihre Y Chromosomen bekommen nun jetzt gewesen groß ersetzte beim nachträglich Völkerwanderungen oder auch Gen fließen; allerdings, die Repräsentanten des östlich haplogroups in Pakistan darf abstammen ab modern Rücken- Systemumstellung, nicht ab alt Überlebenden.

Die fünft- haplogroup jene ist allgemein in Pakistan, haplogroup 28, verschieden ab sämtlich Anderen in sein Verbreitung. Innerhalb Pakistan, es gemacht rauf 14% unseres Warenprobe und war überreichen zusammen aber zwei Bürgerschaften ( beide über welches hatte sehr klein Warenprobe Umfänge), so es ist beide allgemein und weitverbreitet Heraus Pakistan und die nahe Staaten, doch, es ist selten. Es ist gewesen gemeldeten in Indien (30%; überreichen in 3/3 Bürgerschaften), Tajikistan (10%; überreichen in 5/6 Bürgerschaften), und Uzbekistan (3%; überreichen in 10/13 Bürgerschaften), aber es ist selten in Rußland (0.4%; überreichen in 1/6 Bürgerschaften) und die Kaukasier (1.4%; überreichen in 1/6 Bürgerschaften (Brunnen et al. 2001) und hat nicht gewesen gefunden überhaupt in Porzellan oder auch Mongolen ( unveröffentlicht Beobachtungen BATWING Ansätze des TMRCA des Pakistani haplogroup 28 Chromosomen wart ~7,000 (4,000–14,000) Jahren ( Tisch 8). So, innerhalb diesmal Zeitraum, die Pakistani Bürgerschaften bekommen divergierte ab ein allgemein angestammt Einwohnerschaft oder auch bekommen erfahren ansehnlich Mann Gen fließen zwischen sie selbst oder auch ab ein allgemein Ursprung. Seither pauschal Alter entspricht zur baldig Neolithic Zeitraum, die verteilen über dieses Abkunft könnte sein angeschlossen mit die einheimische Ausdehnung über Landwirte.


Vergleichungen innerhalb Pakistan
Haplogroup Verteilungen in Pakistani Bürgerschaften, mit die Ausnahme des Gefahr ( beraten am folgend Referat), bist auffallend ähnlich aneinander ( Feigen. 1 und 2), trotz welche werklich linguistisch Differenzen. Allerdings, die Programmiersprache abgrenzen- sprechend Burusho, die Dravidian- sprechend Brahuis, und die Sino-Tibetan–speaking Baltisch tat verbitten raus vom sonstig Bürgerschaften überhaupt am haplogroup Analysen ( Tisch 2 und Feige. 2), deuten nahelegend einer von beiden jene die linguistisch Differenzen entsprang hinter die allgemein Y Vorlage war eingeführt erwiesen oder auch jene hin ist gewesen genügend Y Gen fließen zwischen Bürgerschaften zu ausmerzen beliebig abzeichnen Differenzen Noch ein mehr ausführlich Analyse des Y haplotypes ( z.B., Feigen. 3–6) deckt auf welche ausgeprägt Gesichtszüge des Brahui und ansehnlich Einwohnerschaft Genauigkeit; Einwohnerschaft- spezifisch Anhäufungen über verwandt haplotypes bist häufig gefunden in dieser Sendergruppen Solch Anhäufungen Wille nur bloss erst sein gesehen falls Bürgerschaften bist isoliert ab einander. Es darf sein jene ein mißraten Grad über Gen fließen zwischen Bürgerschaften über lange ist genügend zu ergeben ähnlich haplogroup Häufigkeiten von außen herstellend manche gemeinsam benutzt Anhäufungen.

Einwohnerschaft- spezifisch Anhäufungen über haplotypes bist zumal ersichtlich in welche Bürgerschaften. Am Gefahr, wohin die ausgeprägt haplogroup Häufigkeiten bekannt oben bist gefunden, höchst Chromosomen (19/23; 83%) zerfallen in man über eben zwei wohlauf- isoliert Anhäufungen ( Feigen. 4 und 5), während die Bestimmen grammatisch, die Kalash, und die Burusho auch äußern prominent Anhäufungen. Die Gefahr, Bestimmen grammatisch, und Kalash wart die drei Bürgerschaften weisend die höchst bedeutend unterschiedlich Einwohnerschaft pairwise FST Werte. Die gehoben Werte des Gefahr und Bestimmen grammatisch könnt zum teil sein begründete als beim Systemumstellung zu Pakistan ab sonstig Örter, aber ein beitragend Faktor ist wahrscheinlich zu sein Ablenkung, einer von beiden fällig zu ein eingetragen Zahl über Stifter Abkunft oder auch sich ereignend nachträglich innerhalb klein Bürgerschaften. Tk Werte (Ewens 1972) versorgen ein Weise über vergleichend wirksam Einwohnerschaft Umfänge. Werte basierend an die STRs fürs Gefahr, Bestimmen grammatisch, Kalash, und Burushos wart 8.9, 77.5, 25.8, und 74.2, jeweils beziehungsweise, gegenüber ein armselig über 181.8 fürs sonstig Bürgerschaften mit Warenprobe Umfänge >20. Wirksam Einwohnerschaft Umfang als Y Chromosomen könnt abweichen außerordentlich ab Volkszählung Einwohnerschaft Umfang, aber es ist werklich jene die Bestimmen grammatisch und Kalash ausführen bekommen die kleiner Volkszählung Umfänge, man- hundertst- oder auch man- tausendst- über meist derjenige des sonstig Bürgerschaften (Tisch 1), so dieser klein Volkszählung Umfänge darf sind worden aufrechterhielt anerkennen. In Zusammenfassung, manche Gesichtszüge des überreichen Pakistani Y haplotype Verteilungen könnt sein begründete als beim ein gemeinsam benutzt angestammt Gen Tümpel, mit eingetragen Gen fließen zwischen Bürgerschaften und Ablenkung am kleiner einige.


Einblicke hinein Einwohnerschaft Ursprünge
Die angeregt Einwohnerschaft Ursprünge ( Tisch 1) könnt nun jetzt sein besonnen am anstecken über dieser Y Resultate. Aufschluß ist vorausgesetzt beim haplogroup Häufigkeiten, welches könnt sein gewohnt an vorzeigen Beimischung Ansätze, und dieser bist bequem zu auffassen falls Bürgerschaften bist erklecklich und isoliert und die Ursprung Bürgerschaften bekommen unterschiedlich Häufigkeiten. Wenn dieser Bedingungen bist nicht getroffen, die Vorhandensein über ausgeprägt Y Abkunft könnt still sein aufschlußreich Die Ursprünge des Bestimmen grammatisch bist wohlauf- dokumentierte (Nanavutty 1997) und so versorgen ein von Nützen testen Bezug. Sie sind Anhänger des Persisch Prophet Zoroaster, wer wanderte zu Indien hinter die Einfall des Sassanian Kaiserreich am 7th Jahrhundert a.d. Sie seßhaft in 900 a.d. in Gujarat, Indien, wohin Sie hießt die “Parsi” ( Bedeutung “from Persisch). Schließlich Sie bewegt zu Murmeln in Indien und Karate in Pakistan, woher die überreichen Einwohnerschaft war probierte aus ( Feige. 7). Ihre Häufigkeiten als haplogroups 3 (8%) und 9 (39%) ausführen allerdings ähneln derjenige in Persisch mehr als der über ihre aktuell Nachbar in Pakistan. Sie äußern die unterste Frequenz als haplogroup 3 in Pakistan (nächst die Gefahr; Feige 1C). Die armselig als acht Persisch Bürgerschaften war 14% (n401=) (Doppelzentner-Murci et al. 2001), während jene als Pakistan, ausgenommen die Bestimmen grammatisch, war 36%. entsprechend Figuren als haplogroup 9 wart 39% in die Bestimmen grammatisch, 40% in Persisch, und 15% in Pakistan ausgenommen die Bestimmen grammatisch. Dieser Figuren anleiten ein Beimischung Abbild über 100% ab Persisch ( Tisch 3). Gegeben die klein wirksam Einwohnerschaft Umfang des Bestimmen grammatisch, die Nähe über ihre anpassen zur Persisch Datei darf sein fortuitous, und die Vorhandensein über haplogroup 28 Chromosomen am 18% (4% in Persisch; Brunnen et al. 2001) anbieten vorbringen welche Gen fließen vom umliegend Bürgerschaften Die TMRCA als die Bestimmen grammatisch- spezifisch anhäufen am haplogroup 28 Sendergruppen war 1,800 (600–4,500) Jahren (Tisch 8), vereinbar mit die Systemumstellung einer klein Zahl über Abkunft ab persisch Kittel, dieser Resultate beweisen ein zusammenklappen anpassen zwischen die historisch Rekorde und die Y Datei, und so vorschlagen jene die Y Datei wirst sein von Nützen wenn geringer historisch Aufschluß ist erhältlich.

Die Einwohnerschaft das heißt genetisch höchst ausgeprägt, die Gefahr, Ansprüche Abkunft ab Genghis Khan’s Armee; ihre angebracht ist leitete her vom Persisch Wort “hazar,” Bedeutung “thousand,” weil Truppen wart link- dahinter in Abteilungen über tausend. In richtung auf die Ausgang des 19th Jahrhundert, welche Gefahr bewegt ab Afghanistan zur Khurram Tal in Pakistan, die Ursprung über die Warenproben untersuchte hier So, ihre mündlich Geschichte identifiziert ein Ursprung in Mongolen und Einwohnerschaft Engpässe ~800 und ~100 Jahren her. Des zwei überwiegend Y haplogroups überreichen in dieses Einwohnerschaft, haplogroup 1 ist weitverbreitet in Pakistan, menge über Asien, Europa, und die Amerika, also vorausgesetzt klein Aufschluß bei die unterbringen über Ursprung. Haplogroup 10, in entgegensetzen, ist selten in höchst Pakistani Bürgerschaften (1.4%, wenn die Gefahr bist ausgeschlossen worden) aber ist allgemein in Ost Asien, eingeschlossen Mongolen, wohin es herstellen rauf über halb des Einwohnerschaft (unveröffentlicht Resultate). Beimischung Ansätze ( Tisch 3) bist vereinbar mit ein wesentlich Beitrag ab Mongolen. BATWING Analyse des Gefahr- spezifisch haplotype Anhäufungen in haplogroups 1 und 10 angeregt TMRCAs über 400 (120–1,200) und 100 (6–600) Jahren ( Tisch 8), jeweils beziehungsweise So, die genetisch Aussage ist vereinbar mit die mündlich Überlieferung und, in Hinblick auf sein selbständig Beschaffenheit, vorausgesetzt stark Unterstützung dafür ( Feige. 7).

Welche sonstig angeregt Ursprünge in Empfang nehmen mehr eingetragen Unterstützung vom Y Datei. Die Neger Makrani, mit ein forderte Ursprung in Afrika, bringen die höchst Frequenz über haplogroup 8 Chromosomen gefunden in beliebig Pakistani Einwohnerschaft, als bekannt anderswo (Qamar et al. 1999). Dieses haplogroup ist groß begrenzte zu sub-Saharan Afrika, wohin es setzt ein bei halb des Einwohnerschaft (Anschlaghammer et al. 2001) und könnt so sein betrachtete als ein Anzeiger über Afrikaner Y Chromosomen. Dennoch, es herstellen rauf nur bloss erst 9% des Neger Makrani Warenprobe, und haplogroup 28 (samt sonstig wie es im Buche steht Pakistani haplogroups) ist überreichen in dieses Einwohnerschaft. Falls die Y Chromosomen wart anfänglich Afrikaner ( Feige. 7), höchst bekommen nachträglich gewesen ersetzte: die Kittel Abbild des Afrikaner Beitrag ist ~12% ( Tisch 3).

Die Baltisch bist Vorstellung zu bekommen entstand in Tibetanisch, wohin die überwiegend haplogroups bist 4 und 26. Keiner war überreichen am Warenprobe ab dieses studiert, vorsorglich null Unterstützung als ein Tibetanisch Ursprung des Y Chromosom Abkunft und ein Beimischung Abbild über Nullpunkt ( Tisch 3). Doch, dieses Resultat muß sein erklärt mit Achtung, aufgrund die klein Warenprobe Umfang. Drei Bürgerschaften bekommen möglich Ursprünge vom Armeen über Alexander die Groß: die Burusho, die Kalash, und die Weg. Modern Griechen äußern ein gemäßigt Hochfrequenz über haplogroup 21 (28%; Rosser et al. 2000), aber dieses haplogroup war nicht gesehen in einer von beiden die Burusho oder auch die Kalash Warenprobe und war gefunden in nur bloss erst 2% über die Weg, während die einheimische haplogroup 28 war überreichen am 17%, 25%, und 13%, jeweils beziehungsweise. Grieche- Beimischung Ansätze über 0% wart erhielt fürs Burusho und die Weg, aber Figuren über 20–40%% wart beobachtete als die Kalash ( Tisch 3). In Überblick des Abwesenheit über haplogroup 21, wir beimessen dieses Resultat einer von beiden zu Ablenkung am Häufigkeiten des sonstig haplogroups, zumal haplogroups 2 und 1, oder auch zur ärmlich Resolution über Abkunft innerhalb dieser haplogroups, ergebend in ausgeprägt Abkunft dasein geordnet hinein dieselbe paraphyletic haplogroups. Kittel, null Unterstützung als ein Grieche Ursprung über ihre Y Chromosomen war gefunden, aber dieses Abschluß tut erfordern die Annahme jene modern Griechen bist Vertreter über Alexander’s Armeen. Zwei Bürgerschaften, die Kashmiris und die Weg, auch aufsetzen anfordern zu ein möglich Jüdisch Ursprung Jüdisch Bürgerschaften häufig bekommen ein bescheiden Frequenz über haplogroup 21 (z.B., 20%) und ein gehoben Frequenz über haplogroup 9 (z.B., 36%; ( Anschlaghammer et al. 2000). Die Häufigkeiten beiderlei über dieser haplogroups bist mißraten am Kashmiris und Weg, und haplogroup 28 ist überreichen am 13% in die Weg, so null Unterstützung als ein Jüdisch Ursprung ist gefunden, und die Beimischung Abbild war 0% ( Tisch 3), obgleich, wieder, dieses Abschluß ist eingetragen beide beim die klein Warenprobe Umfang erhältlich ab Kashmir und beim die Annahme jene die modern Warenproben bist Vertreter über alt Bürgerschaften.

Die angeregt Ursprung des Geländersäule ist in Syrier. Syrier, gefällt Persisch, bist characterized beim ein Niederfrequenz über haplogroup 3 und ein Hochfrequenz über haplogroup 9 (9% und 57%, jeweils beziehungsweise; Anschlaghammer et al. 2000), während die entsprechend Häufigkeiten am Geländersäule bist 29% und 12%. Dieses Mißhelligkeit und die Hochfrequenz über haplogroup 28 am Geländersäule (29%) anfertigen ein vorherrschend Syrier Ursprung als ihre Y Chromosom unwahrscheinlich, und die Beimischung Abbild war 0% (Tisch 3), obgleich die 8% Frequenz als haplogroup 21, die höchst erkannt in Pakistan so entfernt, tut andeuten welche westlich Beitrag zu ihre Y Abkunft. Brahuis bekommen ein möglich Ursprung in Abendland Asien (Hughes- Geschoß 1991) und es ist worden angeregt jene ein verteilen über haplogroup 9 Y Chromosomen war angeschlossen mit die Ausdehnung über Dravidian- sprechend Landwirte ( Doppelzentner-Murci et al. 2001). Brahuis bekommen die höchst Frequenz über haplogroup 9 Chromosomen in Pakistan (28%) hinter die Bestimmen grammatisch, vorsorglich welche Unterstützung hierfür Hypothese, aber ihre höher Frequenz über haplogroup 3 (39%) ist nicht wie es im Buche steht des Erfinderisch Halbmond ( Doppelzentner-Murci et al. 2001) und anbieten vorbringen ein mehr komplex Ursprung, unter Umständen mit Beimischung ab später Völkerwanderungen, zum beispiel derjenige über Indo- Persisch Sprecherinnen vom Steppen über Vordergründig Asien und Anderen ab fördern Ost Dieses Möglichkeit ist unterstützte beim die Entdeckung über mißraten Häufigkeiten über haplogroups 10, 12, und 13 am Brahuis, alle selten in Pakistan und wie es im Buche steht über Ost Asien, Ost und nördlich Asien, und Südosten Asien, jeweils beziehungsweise.

Die Ausfall zu unterkommen Y anbinden mit ein angeregt Einwohnerschaft über Ursprung tut nicht widerlegen ein historisch Genossenschaft, aber es tut beweisen jene die Y Chromosomen leitete her ab solch historisch Ereignisse sind worden abgängige Hitze oder auch ersetzte. Analysen über mitochondrial DNA und sonstig Örter würden abhelfen zu erläutern die Einwohnerschaft Geschichten und würdet sein zumal interessant in Bürgerschaften gefällt die Neger Makrani und die Baltisch, worin es ist ein entgegensetzen zwischen die Erscheinungsbild und die wie es im Buche steht Pakistani Y haplotypes.

Acknowledgments


Dieses wirken war unterstützte beim ein Wellcome Vertrauen Behilflich Forschung Anregung Bewilligen zu S.Q.M. T.Z. war auch unterstützte beim Die Wellcome Vertrauen, und C.T.-S. beim die Krebs Forschung Feldzug. Wir ausdrücken unserer Einschätzung zur ursprünglich DNA Stifter wer gemacht dieses studiert möglich. Die Abteilung über Gesundheit des Obrigkeit über Baluchistan und die Geländersäule Studentisch Bund, Quetta, Pakistan, assistieren am Ansammlung des Brahui und Geländersäule Warenproben. Weg Warenproben wart gefaßt mit die Beistand des Abteilung über Kinderheilkunde, Dame Lesung Stelle Abstufen Medizinisch Klinik, Peshawar, Pakistan. Wir sind auch dankbar zu Dr. ich Kazmi und die Aga Khan Unterbau Ländlich Gesundheit Unterstützung Program als ihre Beistand am Ansammlung über Burusho Warenproben. Dr. F. Sethna vorausgesetzt wertvoll Beistand am Ansammlung des Bestimmen grammatisch Warenproben. Wir danken Luis Doppelzentner-Murci als sein Bemerkungen an die Druckvorlage.


Elektronik- Datei Aufschluß

URLs als Datei in dieses Artikel bist folgendermaßen:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Geflecht 2.0, http:/www.fluxus-engineering.com/.
/ Aussicht, http:/forrest.psych.unc.edu/.

Verweisungen

Ahmad AKN (1952) Jesuiten in Himmel fort Erde. Die Bürgerlich und Militär Amtsblatt Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin Ein, Qamar R, Mazhar K, Zerjal T, Mehdi SQ, Tyler- Befallen C (2000) Ausweis und Charakterisierung über Roman menschlich Y- Chromosom microsatellites ab Reihenfolge Datei Aufschluß. Keimzellen Säuren Res 28e8: [ umsonst Ausführlich Text in PMC].
Rücken schwimmen PC (1992) Baltisch. in Rücken schwimmen PC, Radloff CF (eds) Sociolinguistic Übersicht über nördlich Pakistan. Vol 2, Sprachen über nördlich Flächen National Einführen über Pakistan Studium, Islamabad, pp 3–27.
Stirnband HJ, Forster P, Rohl EIN (1999) Mittellinie- beitritt Sendergruppen als folgernd intraspecific Stammesgeschichte Mol Biol Evol 1637–48: [PubMed] [ umsonst Ausführlich Text].
Stirnband HJ, Forster P, Sykes BC, Richards MB (1995) Mitochondrial Porträts über menschlich Bürgerschaften benutze Mittellinie Sendergruppen. Genetik 141743–753: [PubMed] [ umsonst Ausführlich Text].
Schönen HW (1979) Die Rassen über Afghanistan. Sangt-e-Meel Veröffentlichungen, Lahore, Pakistan.
Schönen HW (1998) Ein Anfrage hinein die ethnography über Afghanistan. Vorhut Bücher, Lahore, Pakistan.
Bergen AW, Deichseln C-Y, Tsai J, Jefferson K, Dey C, Befallen KD, Unterstellen S-C, Tsai S-J, Goldgrube D (1999) Ein Asian–Native Amerikaner väterlich Abkunft erkannt beim RPS4Y resequencing und beim microsatellite haplotyping. Anna Brummen Genetisch 6363–80: [PubMed] [ausführlich Text].
Bianchi Null, Bailliet G, Trotzend CM, Blutbad RF, Rothhammer F, Martini- Ringelblume VL, Strafrechtlich SD (1997) Ursprung über Amerindian Y- Chromosomen als folgerte beim die Analyse über sechs polymorphic Anzeiger. Bin J Abführmittel Menschenähnlich 10279–89: [PubMed] [ ausführlich Text].
Biddulph J (1977) Stämme des Hinterbein Koosh. Indus Veröffentlichungen, Karate, Pakistan.
Burton RF (1851) Sindh und die Rassen jene bewohnen die Tal des Indus. WH Allen und Co Ltd, London.
Weihnachtslied O (1958) Die Weg. Halbschuhe Universität Stemmen, Karate, Pakistan.
Schwerenöter M, Leroy P, Boucekkine C, Weissenbach J, Bischof C, Felge M, Purrello M, Fiori G, Siniscalco M (1985) EIN menschlich Y- verbunden DNA polymorphism und sein potentiell als veranschlagend genetisch und Entwicklung Abstand Wissenschaft 2301403–1406: [PubMed].
Kavalkade-Sforza LL, Menozzi P, Piazza EIN (1994) Die Geschichte und Erdkunde über menschlich Genen. Prinz Universität Stemmen, Prinz.
Täler GF (1991) Die Phänomen des Indus civilization. in Jansen M, Verpatzen M, Städtisch G (eds) Vergessen Städte an die Indus: baldig civilization in Pakistan vom 8th zur 2nd Jahrtausende BC. Verlag Philipper von Zabern, Hauptsächlich, Deutschland, pp 129–144.
Staffierte aus KD (1992) Sociolinguistic Übersicht über Nördlich Pakistan. Vol 5, Sprachen über Keim. National Einführen über Pakistan Studium, Islamabad.
Ewens WJ (1972) Die abtasten Theorie über selektiv Leerlauf Loblied Satz Pöbel Biol 387–112: [PubMed].
Schmutz BF (1992) Völkerkunde: Sprachen des Welt. Sommerlich Einführen über Linguistik, Dallas.
Anschlaghammer MF (1994) EIN vor kurzem Einfügung über ein Alu Bauteil an die Y Chromosom ist ein von Nützen Anzeiger als menschlich Einwohnerschaft Studium. Mol Biol Evol 11749–761: [PubMed] [umsonst Ausführlich Text].
Anschlaghammer MF, Horai S (1995) Y Chromosom DNA Variation und die bevölkernd über Nipon. Bin J Brummen Genetisch 56951–962: [PubMed].
Anschlaghammer MF, Karate TM, Röten AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hierarchisch Vorlagen über global menschlich Y- Chromosom Mannigfaltigkeit Mol Biol Evol 181189–1203: [PubMed] [ umsonst Ausführlich Text].
Anschlaghammer MF, Röten AJ, Wald ET, Lärmschutzhaube MR, Jarjanazi H, Karate T, Santachiara-Benerecetti S, Oppenheim Ein, Arbeitslos MA, Jenkins T, Ostrer H, Lärmschutzhaube- Zähmend B (2000) Jüdisch und Mitte Östlich nicht- Jüdisch Bürgerschaften teilen ein allgemein Tümpel über Y- Chromosom biallelic haplotypes. Proc Natl Akademie Sci VSA 976769–6774: [ umsonst Ausführlich Text in PMC].
Helgason Ein, Sigurdardottir S, Nikolaus J, Sykes B, Berg EW, Zwecke DG, Bosnes V, Gulcher JR, Mündel R, Stefansson K (2000) Veranschlagend Skandinavier und Gaelic Abstammung am Mann Siedler über Island. Bin J Brummen Genetisch 67697–717: [PubMed] [ umsonst Ausführlich Text].
Hughes- Geschoß R (1991) Kaiserlich geographisches Lexikon über Indien: provinziell Serie, Baluchistan. Sangt-e-Meel, Lahore, Pakistan.
Husar J (1997) EIN Geschichte des Leute über Pakistan zu Selbständigkeit. Halbschuhe Universität Stemmen, Karate, Pakistan.
Ibbetson D (1883) Panjab Kasten Sangt-e-Meel, Lahore, Pakistan.
Kreischend JF (1991) Mehrgarh: sein unterbringen am Ablauf über alt Kultur in Pakistan. in Jansen M, Verpatzen M, Städtisch G (eds) Vergessen Städte an die Indus: baldig civilization in Pakistan vom 8th zur 2nd Jahrtausende BC. Verlag Philipper von Zabern, Hauptsächlich, Deutschland, pp 34–50.
Arbeitslos MA, Tyler- Befallen C (2000) Neu Verwendungen als neu haplotypes: die menschlich Y Chromosom, Übel und Auswahl Trends Genetisch 16356–362: [PubMed] [ ausführlich Text].
Karate TM, Zegura SL, Posukh O, Osipova L, Bergen Ein, Lang J, Goldgrube D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffiths RC, Tempel AR, Anschlaghammer MF (1999) Angestammt Asiat Ursprünge() neuer Welt Y- Chromosom Stifter haplotypes. Bin J Brummen Genetisch 64817–831: [PubMed] [umsonst Ausführlich Text].
Kayser M, Roewer L, Hedman M, Henke L, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz T, Szibor R, de Knijff P, Stoneking M, Sajantila EIN (2000) Kenndaten und Frequenz über germline Mutationen am microsatellite Örter vom menschlich Y Chromosom, als deckte auf beim anweisen Beobachtung in Patres/ Sohn Paare. Bin J Brummen Genetisch 661580–1588: [PubMed] [ umsonst Ausführlich Text].
Kwok C, Tyler- Befallen C, Mendonca BB, Hughes Ich, Berkovitz GD, Goodfellow PN, Jagend JR (1996) Mutation Analyse des 2 kb 5' zu SRY in XY Frauen und XY durchkreuzen Untertanen J Med Genetisch 33465–468: [PubMed].
Lang JC (1991) Die genetisch Struktur über mengte bei Bürgerschaften. Genetik 127417–428: [PubMed] [umsonst Ausführlich Text].
Mathias Beklungen, Bellte M, Tyler- Befallen C (1994) Hoch aufschlußreich Gehege haplotypes als die menschlich Y Chromosom. Brummen Mol Genetisch 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansarde Ein, Ismail M, Anschlaghammer MF, Hinterhältig PA, Kavalkade-Sforza LL (1999) Die Ursprünge über Pakistani Bürgerschaften Aussage ab Y Chromosom Anzeiger. in Papiha SS, Deka R, Chakraborty R (eds) Völkermord Mannigfaltigkeit: Bewerbungen in menschlich Einwohnerschaft Genetik Kluwer Akademisch/ Plenum Verleger, Neu York, pp 83–90.
Mohyuddin Ein, Ayub Q, Qamar R, Zerjal T, Helgason Ein, Mehdi SQ, Tyler- Befallen C (2001) Y- Chromosom STR haplotypes in Pakistani Bürgerschaften Gerichtlich Sci Int 118141–146: [PubMed] [ausführlich Text].
Nanavutty P (1997) Die Bestimmen grammatisch. National Belegen Vertrauen, Neu Delhi, Indien.
Panda Ein, König TE, Santos FR, Taylor PG, Thangaraj K, Trällern L, Arbeitslos MA, Tyler- Befallen C (1998) EIN polymorphic menschlich Y- Chromosom G zu EIN Übergang gefunden in Indien. Ind J Brummen Genetisch 452–61:.
Qamar R, Ayub Q, Khaliq S, Mansarde Ein, Karate T, Mehdi SQ, Anschlaghammer MF (1999) Afrikaner und Levantine Ursprünge über Pakistani Bellen+ Y Chromosomen. Brummen Biol 71745–755: [PubMed].
Quddus SA (1990) Die Stammes- Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Doppelzentner-Murci L, Krausz C, Zerjal T, Sayar SH, Anschlaghammer MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin Ein, Radhakrishna U, Arbeitslos MA, Tyler- Befallen C, McElreavey K (2001) Y- Chromosom Abkunft Spur Diffusion über Volk und Sprachen in südwestlich Asien. Bin J Brummen Genetisch 68537–542: [PubMed] [umsonst Ausführlich Text].
Robert DF, Hiorns R (1965) Methoden über Analyse des genetisch Abfassung einer zwitter Einwohnerschaft. Brummen Biol 3738–43:.
Robert GS (1896) Die Kafirs des Hindu-Kush. Halbschuhe Universität Stemmen, Karate, Pakistan.
Rosser ZH, Zerjal T, Schleuderte Mich, Adojaan M, Alavantic D, Liebschaft Ein, Amos W, et al (2000) Y- Chromosom Mannigfaltigkeit in Europa ist entscheiden und beeinflußte hauptsächlich beim Erdkunde, vielmehr denn beim Programmiersprache. Bin J Brummen Genetisch 671526–1543: [PubMed] [ umsonst Ausführlich Text].
Santos FR, Carvalho- Silbern DR, Strafrechtlich SDJ (1999a) PCR- basierend DNA Profil über menschlich Y Chromosomen in Epplen JT, Lubjuhn T (eds) Methoden und Rüstzeug in biosciences und Medizin. Birkhauser Verlag, Grundlos, Schweiz, pp 133–152.
Santos FR, Panda Ein, Kayser M, Mitchell RJ, Liu Ein, Trällern L, Vernichten-Bisol G, Novelletto Ein, Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Befallen C (2000) EIN polymorphic L1 retroposon Einfügung in die centromere des menschlich Y Chromosom. Brummen Mol Genetisch 9421–430: [PubMed] [ umsonst Ausführlich Text].
Santos FR, Panda Ein, Tyler- Befallen C, Strafrechtlich SD, Schanfield M, Löwen WR, Osipova L, Flußkrebs MH, Mitchell RJ (1999b) Die vordergründig Sibirien Ursprung als angeboren Amerikaner Y Chromosomen. Bin J Brummen Genetisch 64619–628: [PubMed] [ umsonst Ausführlich Text].
Schneiden S, Kueffer J-M, Roessli D, Excoffier L (1997) Arlequin ver 1.1: ein Software als Einwohnerschaft genetisch Datei Analyse Genetik und Biometry Forschungsstätte, Universität über Genf, Schweiz.
Seielstad MT, Hebert JM, Lin AA, Hinterhältig PA, Ibrahim M, Vollrath D, Kavalkade-Sforza LL (1994) Bau über menschlich Y- Chromosom haplotypes benutze ein neu polymorphic EIN zu G Übergang. Brummen Mol Genetisch 32159–1261: [PubMed].
Schienbein T, Tomita K, Noch heute T, Kotliarova SE, Leeseite J, Kuroki Y, Jin DK, Tokunaga K, Nakamura H, Nakahori Y (1999) Genetisch Variationen an die Y Chromosom am Japaner Einwohnerschaft und Verwicklungen als modern menschlich Y Chromosom Abkunft. J Brummen Genetisch 44240–245: [PubMed].
Thomas MG, Zwecke Beklungen, Verreißen HM (1999) Gehoben Durchsatz Analyse über 10 microsatellite und 11 diallelic polymorphisms an die menschlich Y- Chromosom. Brummen Genetisch 105577–581: [PubMed] [ausführlich Text].
Tyler- Befallen C (1999) Y- Chromosom DNA Anzeiger. in Papiha SS, Deka R, Chakraborty R (eds) Völkermord Mannigfaltigkeit: Bewerbungen in menschlich Einwohnerschaft Genetik Kluwer Akademisch/ Plenum Verleger, Neu York, pp 65–73.
Hinterhältig PA, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, David RW, Kavalkade-Sforza LL, Oefner PJ (1997) Entdeckung über zahlreich Y Chromosom biallelic polymorphisms beim vergällend gehoben- Vorstellung flüssig chromatography. Völkermord Res 7996–1005: [PubMed] [umsonst Ausführlich Text].
Brunnen RS, Yuldasheva Beklungen, Ruzibakiev R, Hinterhältig PA, Evseeva Ich, Blau- Befallen J, Jin L, et al (2001) Die Eurasian herzlos: ein kontinental Perspektive fort Y- Chromosom Mannigfaltigkeit Proc Natl Akademie Sci VSA 9810244–10249: [ umsonst Ausführlich Text in PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Reihenfolge Variation des menschlich Y Chromosom Beschaffenheit 378379–380: [PubMed] [ ausführlich Text].
Wilson IJ, Kahl werdend DJ (1998) Genealogisch Folgerung ab microsatellite Datei. Genetik 150499–510: [PubMed] [ umsonst Ausführlich Text].
Wolpert S (2000) EIN neu Geschichte über Indien. Halbschuhe Universität Stemmen, Neu York.
Junges FW, Verbot CM (1996) EIN visuell Statistik System. in Stichst RA, Fuchs J (eds) Statistisch berechnend Umgebungen als sozial forscht. Weise Veröffentlichungen, Neu York, pp 207–236.
Zerjal T, Winken L, Winken G, Mikelsaar AV, Krumina Ein, Kucinskas V, Schleuderte Mich, Tyler- Befallen C (2001) Geographisch, linguistisch, und kulturell beeinflußt fort genetisch Mannigfaltigkeit: Y- Chromosom Verbreitung in Nördlich Europäer Bürgerschaften. Mol Biol Evol 181077–1087: [PubMed] [ umsonst Ausführlich Text].
Zerjal T, Dashnyam B, Panda Ein, Kayser M, Roewer L, Santos FR, Schiefenhovel W, Fretwell Beklungen, Arbeitslos MA, Harihara S, Klemmstück K, Semjidmaa D, Sajantila Ein, Salon P, Flußkrebs MH, Ginter EK, Evgrafov OV, Tyler- Befallen C (1997) Genetisch Verhältnisse über Asiaten und Nördlich Europäer, deckte auf beim Y- Chromosom DNA Analyse. Bin J Brummen Genetisch 601174–1183: [PubMed].

 

 

Seite letzter Update: Friday, November 25, 2005 22:32:12 -0500