Gentetski

English

Deutsche

Italiana

Polska

Svensk

ελληνικά

汉语

اردو 

Française

Eesti

Nederlands

Português

Türkçe

Русский

日本語

العربية

Bosanskom

Española

Norsk

Suomi

 

 

 

فارسی


Kromosomski DNA Promjena in Pakistan
Raheel Qamar,1,2 Qasim Ayub,1,2 Aisha Mohyuddin,1,2 Iskljucivo muško rodoslovlje Helgason,3 Kehkashan Mazhar,1 Atika Mansoor,1 Tatiana Zerjal,2 Chris Tyler- Kovac i S. Qasim Mehdi1

1Biomedical i Gentetski Strojarstvo Razdioba, Dr. Q. Mongolski kan Istraživanje Laboratorij, Islamabad; 2Cancer Istraživanje Kampanja, Kromosom Molekularni Biologija Grupa, Odjel od Biokemija, i 3Institute od Biološki Antropologija, Sveucilište od Oxford, Oxford, Sjedinjen Kraljevina; i dešifrirati Gentetski, Reykjavik.


Uzeti

Osamnaest dvostruki polimorfizam i 16 multiallelic, kratak- kola u koja su upregnuti konji jedan iza drugoga- ponavljanje (STR) loci from nonrecombining porcija dana covjecji IPSILON kromosom preterit od be tip in 718 muška osoba subjekt prinadležnost to 12 etnicki grupa od Pakistan. Te identificiran 11 staja haplogroups i 503 kombinacija dvostruki tržište/STR haplotypes. Haplogroup frekvencije preterit od be ponajcešce slican to oni in susjeda geografski podrucje, i Pakistan populacija govorenje jezik odvojiti ( Burushos), Dravidian jezik ( Otmjena osoba), ili Sino- Tibet jezik ( Balti) nalikovati Indo-European–speaking vecina Ipak, srednji- spajanje mreža od haplotypes objaviti znatan podgradnja od IPSILON promjena sa Pakistan, sa mnogobrojan populacija pokazivanje razlicit skupina od haplotypes. Te uzor može biti opsjedati za mimo rutinski lokva od IPSILON loza, sa stvaran odvajanje izmedu populacija i poticaj in komparativ od SMALL sam sebe Malo poredben gentetski ili povijesni podaci jesu raspoloživ za vecina populacija, ali rezultat može biti naprema sa koji se uzima kroz usta tradicija o porijeklo IPSILON podaci podrška kvalitetno- postojeci porijeklo dana Parsiranje in Iran, predložen silazak dana Riskirati from Genghis Mongolski kan vojska, i porijeklo od Pripadnik negroidne rase Makrani in Afrika, ali ne podrška tradicija od Tibet, Uštrcati, Grk, ili Židovski porijeklo za ostali populacija.


Uvod

Ranije jasnoca od Paleolithic covjecji prisutnost in Jug Azija biti nacinjen od od kamen uredaji postaviti rasijan okolo Soan Rijeka Dolina in sjevernjak Pakistan ( husar 1997). Usprkos manjkanje od star jasnoca, te alat pojaviti se to naznaciti prisutnost od hominids in jugozapad Azija kao ranije kao 200,000–400,000 godina prije (Wolpert 2000) i kako slijedi jesu poput to imati bio kolega sa starinski Homo kovani novac. Pakistan laži na tvrdnja južnoevropski obalni cesta slijeden mimo anatomically moderan Homo Mudrost vanjska strana od Afrika, i na taj nacin svibanj su nastanjen mimo moderan covjecji kao izrana kao 60,000–70,000 godina prije. Ima je jasnoca od istupanje iz stranke žitelj in Pakistan sjeverozapad granica, ali star jasnoca from Paleolithic je bio fragmentiran ( husar 1997). Jasnoca je otkrit at Mehrghar, in jugozapad Pakistan, pokazan Neolitik utvrdenje from kao davno kao 7,000 b.c. (neskladan 1991), što preterit od be slijeden mimo Indus Dolina civilizacija ( ukljucujuci gradovi od Harappa i Mohenjodaro) taj cvjetati in 3d i 2d tisucljece b.c. (prodol 1991). Okolo 1500 b.c., Indo-European–speaking nomadski pastirski pleme from povrh toga north—often opozvao je Aryans—crossed Karakorum Gorje u Jug Azija. Kasniji povijesni dogadaj ukljuciti upad od Alexandria ognjevit (327–325 b.c.) i Arapski i Musliman osvajanje from 711 a.d. koji ide prema naprijed (Wolpert 2000).

Prisutan populacija od Pakistan biti nacinjen od od više od 160 milijun osobni ( koji se slaže to 2005 TKO podoba) tko pripadati barem 18 etnicki grupa i govoriti više od 60 jezik ( strašan 1992). Najviše od svega te jezik jesu Indo- Europski, ali oni isto tako ukljuciti odvojiti, Burushaski; Dravidian jezik, Otmjena osoba; i Sino- Tibet jezik, Balti. Punjabi- govorenje osobni formalan vecina populacija od Pakistan, ali oni predstaviti kompliciran miješanje od etnicki grupa (Ibbetson 1883) i nisu u analizirati ovdje; 12 etnicki grupa jesu sadržano in prisutan razgledavanje. obavijest raspoloživ o njima je izražen ukratko in stol 1, zajedno sa hipoteze o njihov porijeklo (Mehdi et Al. 1999). Mada neki od te hipoteze jesu kvalitetno- podržanih od (e.g., porijeklo dana Parsiranje in Iran), vecina jesu na osnovi koji se uzima kroz usta tradicija i imati ne bio test prema ostali listinzi od jasnoca.

Oskudan gentetski podaci jesu raspoloživ za te Pakistan etnicki grupa Ranije izucavanje od ABO krv grupa i klasican bjelancevina tržište je ne ukljuciti svi grupa i najviše koji se da klasificirati njima prema njihov mjesto od rezidencija. populacija stablo na osnovi 54 klasican encim tržište mjesto Riskirati i Staza in Zapad Azijski skupina mrsan sjeveroistok Caucasoids (grupa jahaca-Sforza et Al. 1994). In drugi populacija stablo, na osnovi 47 klasican bjelancevina polimorfizam, Pakistan uzorak formalan malolitražan subcluster sa Indoevropski govornik from Indija ( grupa jahaca-Sforza et Al. 1994).

IPSILON kromosom osigurati jedinstven izvor od gentetski jasnoca (Tyler- Kovac 1999; Jobling i Tyler- Kovac 2000). Internet Carrie velik nonrecombining odsjecak in genocid i sadržati brojan staja dvostruki tržište, ukljucujuci temeljiti zamjena (vidjeti, e.g., Potajan et Al 1997) i retroposon umetanje ( cekic 1994; Santa et Al. 2000), što može biti korišten in kombinacija sa više- brz evoluirati tržište, kao što je microsatellites (vidjeti, e.g., Ayub et Al. 2000). Otuda, vrlo detaljan IPSILON phylogenies može biti izgraden taj dopustiti muška osoba- specifican aspekt od gentetski povijest biti istraživati. Te jesu jako utjecati mimo malen djelotvoran populacija odredena mjera dana IPSILON kromosom, pocevši to brz gentetski poticaj, i mimo obavljanje od patrilocality in mnogobrojan društvo, pocevši to povisok nivo od geografski razlikovati od IPSILON haplotypes. Usprkos umjetnicko djelo Qamar et Al. (1999) na analiza od Lajati+ kromosom ( obuhvatiti ~2.6% dana ukupan) i analizirati od STR promjena (Ayub et Al. 2000; Mohyuddin et Al. 2001), malen funkcionirati je Carrie vanjska strana na Pakistan IPSILON kromosom. Stoga, moramo zatim predstavljen raširen analiza od Pakistan IPSILON loza, to svojeglav što stanje oni može štagalj na porijeklo i gentetski povijest dana podskupina taj popuniti Pakistan populacija.


Materijalan i Metodije

Uzorak
IPSILON kromosom od 718 nepovezan muška osoba subjekt, prinadležnost to 12 etnicki grupa od Pakistan, preterit od be analizirati (žlica za juhu 1 i 2; smokva. 1). Obavješten privola je dobiveno from svi sudionik in ovaj studirati. Epstein Vojarna virus–transformed lymphoblastoid stanica crta je postojeci from svaki osobni, i DNA je iznuden from te stanica linije za analiza.


Dvostruki Polimorfizam Tipican
Mi tip 15 SNPs, Alu umetanje ( cekic 1994; Cekic i Horacije 1995), Crta umetanje ( Santa et Al. 2000), i 12f2 brisanje ( Kazanova et Al. 1985). temeljiti zamjena preterit od be 92R7 C?TERA ( Matilda et Al. 1994); M9 C?G ( potajan et Al. 1997); SRY-2627 C?Tera (Bianca et Al. 1997); SRY-1532 G (Whitfield et Al. 1995; Kwok et Al. 1996; Santa et Al. 1999b); sY81 (DYS271) ?G (Seielstad et Al. 1994); SRY-8299 G? (Santa et Al. 1999a); Pogodan G ( koji se odnosi na Pana et Al. 1998); SRY +465 C?TERA ( golijen et Al 1999); LLY22g C? i Tat Tera?C prijelaz (Zerjal et Al. 1997). Dodatno, M17 tržište ( potajan et Al. 1997) je tip, mimo iskoristiti dana Primakov GTGGTTGCTGGTTGTTACGT i AGCTGACCACAAACTGATGTAGA slijeden mimo AflIII probava dana PCR stvarajuci; prošli aleluja je ne pravni zbornik M20 oznacivac (potajan et Al. 1997) je genotip, mimo iskoristiti od Primakov CACACAACAAGGCACCATC i GATTGGGTGTCTTCAGTGCT slijeden mimo SspI probava; gore navedeni?G mutacija razoriti položaj at mjesto 118 in 413-bp stvarajuci. M11 (potajan et Al. 1997) je tip, koristeci Primakov TTCATCACAAGGAGCATAAACAA i CCCTCCCTCTCTCCTTGTATTCTACC slijeden mimo probava sa MspI. 215-bp proizvod je pravni zbornik to 193-bp i 22-bp fragmenti in derivirati aleluja RPS4Y C?TERA mutacija (Berger et Al. 1999) je otkriti mimo BslI ogranicenje probava od 528-bp PCR stvarajuci dobiveno mimo iskoristiti dana Primakov CCACAGAGATGGTGTGGGTA i GAGTGGGAGGGACTGTGAGA. prošli C aleluja sadržati dva položaj, i derivirati TERA aleluja sadržati neki. M48 (potajan et Al. 1997), G, je tip mimo aleluja- specifican PCR koristeci koji luci Primakov TGACAATTAGGATTAAGAATATTATA i TGACAATTAGGATTAAGAATATTATG i rutinski Primakov AAAATTCCAAGTTTCAGTGTCACATA to roditi specifican 145-bp stvarajuci zalazak od IPSILON dvostruki tržište aleluja Carrie mimo sam osobni htijenje biti koji se odnosi na koga to kao “the Ipsilon haplogroup.”
Od 718 uzorak, 717 koža u haplogroups u išcekivanju na bazi znati phylogeny, ali neki Staza uzorak (PKH134) nije ispunilo prorocanstvo to širok at SRY –1532 i M17 loci. On je doznacen to haplogroup 3 na bazi od izbor SRY –1532 Primakov ( detalj na molba) i njegov STR profil.


Ipsilon-STR Tipican
Pet trinucleotide- ponavljanje polimorfizam (DYS388, DYS392, DYS425, DYS426, i DYS436), deset tetranucleotide- ponavljanje polimorfizam (DYS19, DYS389I, DYS389b, DYS390, DYS391, DYS393, DYS434, DYS435, DYS437, i DYS439) i neki pentanucleotide microsatellite (DYS438) preterit od be tip u svim IPSILON kromosom. Tri multipleksor PCR otpor preterit od be predstavljen za svi IPSILON-STRs, in a10-µ gradska nadzemna željeznica konacan otpor svezak mrsan 20 ng genocid DNA, kao opisan drugdje ( Thomas et Al. 1999; Ayub et Al. 2000). PCR stvarajuci preterit od be trcanje na ABI 377 slijed. ABIGS350 TAMRA je iskorišten kao i telefaks unutarnji prometna traka standardan. GENEZA i GENOTIP softver paket preterit od be naviknut sakupiti podaci i to analizirati fragment odredena mjera IPSILON-STR aleluja preterit od be naimenovan prema broj je od ponavljanje jedinica oni contain.The broj od ponavljanje jedinica je postojeci preko iskoristiti od slijed upucivanje DNA uzorak. Aleluja trajanje za DYS389b preterit od be dobiveno mimo oduzimanje dana DYS389II aleluja trajanje from DYS389I.
IPSILON-STR udvostrucenje preterit od be postaviti at pojedini loci. DYS393 je duplicirati in PKH165 (13 i 15) i DYS437 je duplicirati in SDH181 (8 i 9). više kompliciran uzor je postaviti in DYS425, gdje svi dva to cetiri aleluja preterit od be postaviti in 36 osobni from haplogroups 8, 9, 13, i 21.


Podaci Analiza
Prvi- sastavni dio analiza je Carrie vanjska strana na haplogroup frekvencije mimo iskoristiti dana Vidik ( vidni Statistika) sistemski softver, inacici 5.0.2 (neiskusan i Zabranjen pristup 1996). Za graficko prikazivanje, najprije i onaj koji je u cemu drugi prvi sastavni dio preterit od be ploter mimo Microsoft Usluga Svita Excel Paket na Windows 2000. Biallelic polimorfizam podaci za razlicit svjetski dan populacija iskorišten in analiza preterit od be dobiveno from Cekic et Al (2001). Miješanje je procijenjen mimo iskoristiti od tri razlicit omjeravati: Ceznuti ponderiran najmanji- cetverokut (WLS) omjeravati ( ceznuti 1991); gospodin, najmanji- cetverokut odrediti (duga gornja odjeca i Hiorns 1965); i m? (Helgason et Al. 2000).

Analiza od molekularni nesloga (AMOVA) je Carrie vanjska strana mimo iskoristiti dana Arlequin paket (Schneider et Al. 1997). AMOVA omjeravati omjer od mutacijski divergencija postaviti sa i izmedu populacija, koji se odnosi na svakog pojedinog. Mada velik dio dana promjena at brz mutacija microsatellite loci je u išcekivanju to su stvarajuci in razlicit Pakistan subpopulations, jedinstven mutacija dogadaj at dvostruki loci jesu velik dio stariji i imati ne se pojavljuju in kontekst dana podvrsta dana Pakistan populacija. Mi izumljen slijedece strategija to iskorištavati maksimum iznos od koji se tice mutacijski obavijest from IPSILON- kromosom haplotypes. STR promjena sa haplogroups je naviknut izracunati populacija pairwise FST vrijednost za svaki osobni haplogroup. Za svaki populacija pariti, ponderiran podao FST je izracunat, gdje svi vrijednost dobiveno za svaki haplogroup je ponderiran prema omjer od pairwise poredba ukljucuci taj haplogroup. In odsutnost od poseban haplogroup from neki populacija, , dana pariti i B, FST je podešene na 1, i broj je od pairwise poredba je uzeti kao i telefaks broj od kromosom nošenje taj haplogroup in B. Vrijednost od FST na osnovi STRs sam ili na STRs više dvostruki tržište, sa dvostruki tržište odreden 10- tor viši ponderiranje, preterit od be izracunat za poredba. U svim od te analizirati, daljina matrica iskorišten dosljednost dana broj od skaline mimo što svaki pariti od haplotypes razlika. Okvir kamina testovi za jedan dan izražajnost od korelacija izmedu FST vrijednost preterit od be Carrie vanjska strana in Arlequin, i multidimensional dimenzioniranje (MDS) cestica preterit od be izgraden mimo iskoristiti dana SPSS inacici 7.0 softver paket.

Srednji- spajanje mreža preterit od be izgraden mimo Mreža 2.0b ( zastavica et Al. 1999). ponderiranje raspored sa pet- tor lanac je iskorišten in sastav dana mreža. povecati težinu primjesama doznacen preterit od be specifican za svaki haplogroup i je uzeo u racun IPSILON-STR promjena preko haplogroup in cio Pakistan populacija. Slijedece povecati težinu primjesama preterit od be iskorišten nesloga 0-0.09, povecati težinu primjesama 5; nesloga 0.1-0.19, povecati težinu primjesama 4; nesloga 0.2-0.49, povecati težinu primjesama 3; nesloga 0.5-0.99, povecati težinu primjesama od 2; i nesloga 1.00, povecati težinu primjesama 1. Usprkos ovaj, mreža za haplogroup 1 posuda mnogobrojan povisok koji se tice dimenzija kubirati i je cvrst mimo primijeniti na vratiti srednji i srednji spajanje mreža Metodije sequentially. vratiti srednji algoritam (zastavica et Al. 1995) je naviknut roditi *.rmf varalica i srednji spajanje mreža Metodije je je zatražio to ovaj varalica.

BATWING (Wilson i Celav 1998), Bayesian Analiza od Stablo Sa Unutarnji Cvor Stvaranje, je naviknut odrediti vrijeme to preko u zadnje vrijeme rutinski predak (TMRCA) od zalazak od kromosom. Ovaj plan uses Oznaka predsjednik Mjesec Teret jednih kola procedura to roditi phylogenetic stablo i kolega mjerilo vrijednost dosljedan sa ono što se umece podaci ( zalazak od IPSILON haplotypes) i gentetski i demographic uzorak gentetski uzorak pretpostaviti sam- korak mutacija dana STRs i demographic uzorak izabran je eksponencijalni rastenje sa parafirano konstantan- odredena mjera populacija, sa ili bez podvrsta in razlicit runs dana plan Svi 16 STR loci preterit od be iskorišten; položaj- specifican mutacija mjera nadstojnik samostana vjerojatnost na osnovi podaci od Kayser et Al. (Kayser et Al. 2000) preterit od be izgraden za jedan dan loci raspoloživ kao trece slovo grcje abecede distribucija dana formalan trece slovo grcje abecede(, b) gdje svi = (1 + broj od mutacija primjecen mimo Kayser et al.), i b = (1 + broj od meioses). Za loci ne istraživati mimo Kayser et al., distribucija trece slovo grcje abecede (1,416) je iskorišten, što ima podao od 0.0024. stvaranje vrijeme od 25 godina je pretpostavljen. Kako slijedi 95% povjerenje meduprostor odreden uvesti racun neizvjesnost in mutacija mjera, populacija rastenje i ( gdje svi prigodan) podvrsta, ali ne stvaranje vrijeme.

Rezultat

Ipsilon- Kromosom Dvostruki Polimorfizam
18 dvostruki tržište iskorišten prepoznati 20 haplogroups in širom svijeta populacija smokva 1A), ali jedini 11 preterit od be postaviti in Pakistan, i 5 opsjedati za 92% dana uzorak ( smokva. 1 i stol 2). Haplogroups 1 i 9 preterit od be prisutan u svim Pakistan populacija pregledan, haplogroup 3 je prisutan u svim izuzeti Riskirati, i haplogroup 28 je prisutan u svim izuzeti Riskirati i Kašmirski jezik. Jugozapad populacija pokazivanje viši frekvencije od hg 9 i Lajati+ haplogroups 21 i 8 nego sjeveroistocni populacija (figs. 1D–E), ali, ukupni, malen geografski skupina od haplogroup frekvencije je ocit sa odbrojavanje.


Prvi- Sastavni dio Analiza
Mi onaj koji želi to usporediti Pakistan IPSILON haplogroup podaci sa podaci from populacija from i sve ostalo svjetski dan. Nijedan prikladan podatkovni skup je raspoloživ za jedan dan cio zalazak od 18 tržište, ali oni podaci od Cekic et Al. (2001) dopustiti svi ali 5 biti iskorišten, jer jednak ili phylogenetically ekvivalentan tržište preterit od be koji prijavi. prvi- sastavni dio analiza smokva 2A) pokazivanje neki razlika from izvorni analiza od Cekic et al., poglavit neki bitak manji odjeljivanje od Africki populacija. Ovaj je zbog, velik velicina, to podskup od tržište iskorišten, što se ne ukljuciti mnogobrojan dana Afrika- specifican sam sebe. Vecina Pakistan populacija skupina sa Jug Azijski i Srednji Istok populacija, i jesu do Sjeveroistok Africki, Centralni Azijski i Europski populacija, kako slijedi pokazivanje sveopci istovrsnost sa geografski Zatvori populacija. Onu izuzimanje je Riskirati, tko jesu sasvim razlicit. slican analiza dana Pakistan populacija sam, koristeci svi dana dvostruki tržište ( smokva. 2B), konfiguracijski razlika izmedu Riskirati i neki dan populacija i isto tako više jasno pokazivanje razlicitost dana Kalash i Parsiranje. Internet je naocit taj jezik isolate–speaking Burusho i Dravidian- govorenje Otmjena osoba ne protiviti se in te analizirati.


Miješanje Odrediti
Hipoteze o populacija porijeklo ( stol 1) može biti uzeti u obzir kao kvantitativan pitanje o miješanje. Na primjer, isprobati mogucnost taj Balustrada IPSILON kromosom imati Uštrcati porijeklo, mi može pitati što omjer dana Balustrada Ys jesu derivirati from Uštrcati i što omjer jesu from Pakistan ( uzeti u obzir biti Pakistan uzorak minus Balustrada). Podaci na predložen izvor populacija preterit od be uzeti from književnost i tri omjeravati od miješanje preterit od be izracunat. tri odrediti je dao široko dosljedan rezultat, sa malen sistematican razlika tipican m? > gospodin > Ceznuti WLS za jedan dan procijenjen doprinos from vanjski izvor populacija ( stol 3). Te rezultat osigurati jasnoca za godinu vanjski doprinos to Riskirati, Kalash, Pripadnik negroidne rase Makrani, i Parsiranje ali ne to neki dan populacija.


IPSILON- Kromosom STR Polimorfizam
IPSILON-STR polimorfizam preterit od be izucen to dobiti više detaljan pogled od IPSILON promjena, izmedu razlicit Pakistan etnicki grupa, taj ce biti manji neobjektivan mimo tržište- otkrice procedura razlicitost od IPSILON-STR haplotypes ( stol 4) je najdonji za jedan dan Riskirati (0.893) kao predložen mimo prije analizirati (Ayub et Al. 2000).
16 IPSILON-STRs odrediti 502 IPSILON haplotypes, golem vecina bitak primjecen in sam osobni ostatak haplotypes preterit od be udio mimo 2–18 osobni ( detalj su dane u na vezi- jedini naknadan stol). In svi slucaj ali neki, kromosom šerif haplotype pripadati to jednak haplogroup ( stoga, 503 kombinacija haplotypes) i, in vecina slucaj, osobni šerif haplotype pripadati to jednak populacija (stol 5).

GST i modalan odredena mjera dana ponavljanje jedinica, za svi 16 IPSILON-STRs pregledan in Pakistan populacija, su dane u stol 6. korelacija izmedu tržište heterozygosity i GST je postaviti ne to biti važan (r0.329=; P=.213). modalan odredena mjera i nesloga od 16 IPSILON-STRs sa haplogroups 1, 2, 3, 8, 9, 10, 21, 26, i 28 je isto tako odreden in stol 6. Siguran haplogroups imati razlicit modalan aleluja odredena mjera, i neki primjer od ovaj jesu predocen masnim slovima kurziv in stol 6. Za primjer, DYS388 je 15 ponavljanje in haplogroup 9, u poredbi sa 12 ponavljanje in najviše od svega neki dan haplogroups in Pakistan. Isto tako, modalan aleluja za DYS438 je 9 in haplogroup 9, ali 10 ili 11 in neki dan haplogroups. modalan aleluja za DYS434 za haplogroup 10 je 11, što je eklatantno razlicit from aleluja odredena mjera od ovaj položaj in ostali haplogroups. kompletan manjkanje od varijabilnost za DYS436 in 233 muška osoba subjekt prinadležnost to haplogroup 3 je ugledna osoba. Haplogroup 10 pojaviti se to imati najmanji varijabilnost preko vecina loci izuzevši DYS390 ( stol 6). Te nalaz dokazati jak strukturni od IPSILON-STR varijabilnost mimo haplogroup.

Mi ištanje to izracunati IPSILON- temeljen omjeravati od gentetski daljina izmedu populacija taj ce saviti razlikovati taj je se pojavljuju sa Pakistan i taj ce ne biti neproporcionalan vladati mimo prastar razlika taj je prije toga nakupljen izmedu haplogroups. standardan put to obaviti ovaj bi bilo to iskoristiti STR promjena, i stol 7 sažeti populacija pairwise vrijednost od FST na baza od STR promjena sam () ili od dvostruki- oznacivac više STR promjena (B), sa dvostruki- oznacivac razlika ponderiran 10 vrijeme viši nego STR razlika. Te materoubilacki jesu visoko stajati u uzajamnoj vezi (r0.95=; P.001<), kao moc biti u išcekivanju from strukturni od STR promjena mimo haplogroup. Pa ipak, te omjeravati jesu važan utjecati mimo prastar razlika, i mi imati stoga razvijen od strane izmijenjeni omjeravati. Mi mislilac toliko dana STR promjena sa haplogroups ce imati uzrokovati u zadnje vrijeme i mogao biti iskorišten za ovaj purpose.Nous avons calculé donc jednakost pariti des dolina de populacija de FST, sur la temeljiti du STR promjena dans des haplogroups, et korisni programié une moyenne peseé de ces derniers pljusak stvarajuci une materoubilacki jednostavan de daljina de FST ( stol 7C ; figue. 3) Te daljina jesu isto tako visoko stajati u uzajamnoj vezi sa daljina temeljen na STRs sam (r0.76=; P.001<) ili na STRs više dvostruki tržište (r0.70=; P.001<), ali velik omjer dana promjena je pp od SEE izmedu populacija (22%, u poredbi sa 6% i 7%, koji se odnosi na svakog pojedinog). poredba od podoba 3 sa podoba 2B ( što je na osnovi dvostruki tržište frekvencije sam) objaviti naocit ukupni slicnost, sa Riskirati bitak razlicit from svi dana ostali populacija. Neki dan koji iskace populacija jesu Kalash i Parsiranje (kao prije nego), Kašmirski jezik (možda zbog malen uzorak), i Otmjena osoba, tko jesu kako slijedi više razlicit in njihov STR profili nego haplogroup frekvencije. MDS cestica dana daljina in žlica za juhu 7A i 7B (ne predocen) privesti slican zakljucak, ali nalikovati podoba 2B više pažljivo in put taj Otmjena osoba ne protiviti se na taj nacin velik dio.


Srednji- Spajanje Mreža
Gentetski srodstvo izmedu razlicit Pakistan etnicki grupa preterit od be istraživati povrh toga mimo izvlacenje srednji- spajanje mreža ( zastavica et Al. 1995), i primjer jesu predocen in podoba 4, 5, i 6. haplogroup 1 mreža smokva 4) objaviti znatan promjena, ali isto tako povisok stupanj od populacija- specifican podgradnja Na primjer, 24 Parsiranje haplogroup 1 kromosom svi upasti neki od tri skupina ( smokva. 4, zelen), 19 od 26 Burusho haplogroup 1 kromosom upasti dva skupina ( plava boja), i 12 od 14 Riskirati haplogroup 1 kromosom upasti sam skupina, i svi od te skupina jesu specifican za njihovo koji se odnosi na svakog pojedinog populacija. haplogroup 10 mreža smokva 5) je velik dio jednostavan, zbog malen broj od kromosom, ali opet objaviti populacija- specifican skupina za Burusho i Riskirati haplotypes. haplogroup 28 mreža ( smokva. 6) pokazivanje naocit izoliran Parsiranje- specifican skupina, na kraju ceznuti granati se, mrsan 15 od 16 Parsiranje haplogroup 28 kromosom. Skupina od Kalash, Burusho, and—to manji degree—Baluch kromosom jesu isto tako ocit, mada neki Balustrada haplotype je udio sa Sindhi i Makrani Balustrada osobni from obližnji jugoistok populacija.
BATWING TMRCAs preterit od be izracunat za jedan dan haplogroup 28 mreža i za prebran loza sa izvjestan broj haplogroups. rezultat jesu izražen ukratko in stol 8.

Rasprava

Moramo Carrie vanjska strana najprije raširen analiza od IPSILON razlicitost sa Pakistan, ispitivajuci 34 tržište in 718 muška osoba subjekt from 12 populacija Ovaj dopustiti nas to usporediti Pakistan IPSILON razlicitost sa taj prije toga koji prijavi in svjetski dan populacija, to istraživati razlika sa Pakistan, i to procijeniti neki dana predložen populacija povjesnicar from IPSILON perspektiva.


Poredba sa Širom svijeta Podaci
In širom svijeta poredba, Pakistan populacija najviše skupina okolo lokva Jug Azijski uzorak i laž do Srednji Istocni uzorak ( smokva. 2A). Ovaj nalaz je unsurprising, djelomicno jer Jug Azijski uzorak sadržano 62 Pakistan osobni ( tj., 32% od 196 ukupan) i djelomicno jer IPSILON promjena in mnogobrojan podrucje dana svjetski dan je pretežno struktura mimo zemljopis, ne mimo jezik ili etnicki podružnica ( Ross et Al. 2000; Zerjal et Al. 2001). velik gentetski istovrsnost od Pakistan populacija to oni in zapad nego to istok populacija je ilustrirati mimo tvornica taj cetiri dana pet ucestao haplogroups in Pakistan (haplogroups 1, 2, 3, i 9, što zajedno popuniti 79% dana ukupan populacija) jesu isto tako ucestao in zapadni Azija i Euro ali ne in Porculan ili Japanski; obrnuto, haplogroups koji su ucestao in Istok Azija (e.g., 4, 5, 10, 13, i 20) jesu rijedak ili odsutan in Pakistan, formalan jedini 2.5% dana ukupan Ako, kao u neki tumacenje, ranije egzodus from Afrika uzduž jugoistok primorje od Azija je vodio to najprije anatomically moderan covjecji populacija in Pakistan, i te narod Carrie istok haplogroups ili njihov preteca, njihov IPSILON kromosom imati zatim bio velik naknaden mimo kasniji seoba ili gene pritjecanje; nije moguce, koji predstavlja dana istok haplogroups in Pakistan može biti derivirati from moderan leda- seoba, ne from prastar preživjeli.

Kvinta haplogroup taj je rutinski in Pakistan, haplogroup 28, razlikovati se from svi ostali in svoj distribucija. Sa Pakistan, Internet je napravio gore 14% naš uzorak i je prisutan u svim ali dva populacija ( oba od što je mišji uzorak odredena mjera), na taj nacin posrijedi je oba rutinski i rasprostranjen Vanjština Pakistan i obližnji države, pa ipak, posrijedi je rijedak. Internet je koji prijavi in Indija (30%; prisutan in 3/3 populacija), Tajikistan (10%; prisutan in 5/6 populacija), i Uzbekistan (3%; prisutan in 10/13 populacija), ali posrijedi je rijedak in Ruski (0.4%; prisutan in 1/6 populacija) i Kavkaz (1.4%; prisutan in 1/6 populacija (kvalitetno et Al. 2001) i je ne bio postaviti at svi in Porculan ili Mongolija ( neobjavljen opažanje BATWING odrediti dana TMRCA dana Pakistan haplogroup 28 kromosom preterit od be ~7,000 (4,000–14,000) godina ( stol 8). Kako slijedi, iznutra ovaj vrijeme razdoblje, Pakistan populacija imati otici u suprotnim pravcima from rutinski prošli populacija ili imati iskusan znatan muška osoba gene pritjecanje izmedu oni sami ili from rutinski izvor. Otada procijenjen dob podudarati se to ranije Neolitik razdoblje, protezati od ovaj loza moc biti kolega sa lokalni ekspanzija od farmer.


Poredba sa Pakistan
Haplogroup distribucija in Pakistan populacija, sa izuzimanje dana Riskirati ( raspravljati in sljedeci Sekcija 1), jesu eklatantno slican to neki drugi (figs. 1 i 2), usprkos neki ugledna osoba jezicni razlika. Nije moguce, jezik odvojiti- govorenje Burusho, Dravidian- govorenje Otmjena osoba, i Sino-Tibetan–speaking Baltis je ne protiviti se from neki dan populacija at sve u haplogroup analizirati ( stol 2 i smokva. 2), predlaganje oba taj jezicni razlika se podigao nakon rutinski Ipsilon uzor je postojeci ili koji su je dovoljan IPSILON gene pritjecanje izmedu populacija to iskljuciti bilo koji parafirano razlika Još više detaljan analiza dana IPSILON haplotypes (e.g., figs. 3–6) objaviti neki razlicit mogucnosti dana Otmjena osoba i znatan populacija specifican; populacija- specifican skupina od povezivati se haplotypes jesu obicno postaviti in te mreža Kao što je skupina htijenje jedini biti pp od SEE ako populacija jesu izoliran from neki drugi. Internet može biti taj nisko stupanj od gene pritjecanje izmedu populacija na jednom davno je dovoljan to rezultat in slican haplogroup frekvencije sa stvarajuci mnogobrojan udio skupina.

Populacija- specifican skupina od haplotypes jesu osobito ocit in neki populacija. In Riskirati, gdje svi razlicit haplogroup frekvencije bilješka iznad jesu postaviti, vecina kromosom (19/23; 83%) upasti neki od pravedan dva kvalitetno- izoliran skupina (figs. 4 i 5), gdje svi Parsiranje, Kalash, i Burusho isto tako pokazivanje istaknut skupina. Riskirati, Parsiranje, i Kalash preterit od be tri populacija pokazivanje preko važan razlicit populacija pairwise FST vrijednost. povisok vrijednost dana Riskirati i Parsiranje može dio biti opsjedati za mimo seoba to Pakistan from ostali mjesto, ali koji doprinosi tvornica je vjerojatan biti poticaj, oba zbog to ogranicen broj od osnivac loza ili dvokratan kasniji sa malen populacija. Tk vrijednost (Ewens 1972) osigurati put od prispodabljanje djelotvoran populacija odredena mjera. Vrijednost na osnovi STRs za jedan dan Riskirati, Parsiranje, Kalash, i Burushos preterit od be 8.9, 77.5, 25.8, i 74.2, koji se odnosi na svakog pojedinog, u poredbi sa podao od 181.8 za jedan dan ostali populacija sa uzorak odredena mjera >20. Djelotvoran populacija odredena mjera za IPSILON kromosom može razlikovati se mnogo from cenzus populacija odredena mjera, ali posrijedi je ugledna osoba taj Parsiranje i Kalash obaviti imati malen cenzus odredena mjera, neki- stoti ili neki- tisuca od najviše od svega oni dana ostali populacija (stol 1), na taj nacin te malen cenzus odredena mjera svibanj su održavati dug. Zakljucno, mnogobrojan mogucnosti dana prisutan Pakistan IPSILON haplotype distribucija može biti opsjedati za mimo udio prošli gene lokva, sa ogranicen gene pritjecanje izmedu populacija i poticaj in komparativ od SMALL sam sebe.


Uvid u Populacija Porijeklo
predložen populacija porijeklo ( stol 1) može zatim biti uzeti u obzir in stanje od te IPSILON rezultat. Obavijest je pružena mimo haplogroup frekvencije, što može biti naviknut stvarajuci miješanje odrediti, i te jesu lahak to protumaciti ako populacija jesu velik i izoliran i izvor populacija imati razlicit frekvencije. Našto te stanje nisu u Metropolitan, prisutan od razlicit IPSILON loza može pa ipak biti informativan porijeklo dana Parsiranje jesu kvalitetno- dokument (Nanavutty 1997) i kako slijedi osigurati koristan ogledni slucaj. Oni su sljedbeništvo dana Iranski jezik prijedlog Zoroaster, tko migrirati to Indija nakon sažeti dana Sassanian vladavina in 7th stoljece a.d. Oni biti u sigurno smješten 900 a.d. in Gudžarati, Indija, gdje svi oni preterit od be opozvao je “Parsi” ( znacenje “from Iran). Konacno oni ganut to Mrmljati in Indija i Karaci in Pakistan, iz kojeg mjesta prisutan populacija je uzorak ( smokva. 7). Njihov frekvencije za haplogroups 3 (8%) i 9 (39%) obaviti nije moguce nalikovati oni in Iran više nego oni od njihov tekuci susjedi in Pakistan. Oni pokazivanje najdonji frekvencija za haplogroup 3 in Pakistan (razdijeljen from Riskirati; smokva 1C). podao za osam Iranski jezik populacija je 14% (n401=) (stup kao meta za vježbu u gadanju kopljem u trku-Murci et Al. 2001), gdje svi taj za Pakistan, iskljucujuci Parsiranje, je 36%. prikladan podoba za haplogroup 9 preterit od be 39% in Parsiranje, 40% in Iran, i 15% in Pakistan iskljucujuci Parsiranje. Te podoba olovo to miješanje odrediti od 100% from Iran ( stol 3). Odreden malen djelotvoran populacija odredena mjera dana Parsiranje, bliskost od njihov uskladiti to Iranski jezik podaci svibanj biti slucajan, i prisutnost od haplogroup 28 kromosom at 18% (4% in Iran; Kvalitetno et Al. 2001) predlagati neki gene pritjecanje from okruživanje populacija TMRCA za Parsiranje- specifican skupina in haplogroup 28 mreža je 1,800 (600–4,500) godina (stol 8), dosljedan sa seoba od malolitražan broj od loza from Iran Ukupni, te rezultat ogledni prikaz Zatvori uskladiti izmedu povijesni dokumentacija i IPSILON podaci, i kako slijedi predlagati taj IPSILON podaci htijenje koristiti našto manji povijesni obavijest je raspoloživ.

Populacija taj je genetsko vecina razlicit, Riskirati, prisvajati silazak from Genghis Mongolski kan vojska; njihov ugled je derivirati from Perzijski rijec “hazar,” znacenje “thousand,” jer trupe preterit od be slijeva straga in odvajanje od tisuca. Naizmak od 19th stoljece, neki Riskirati ganut from Afghanistan to Khurram Dolina in Pakistan, izvor od uzorci istraživati ovdje Kako slijedi, njihov koji se uzima kroz usta povijest identificiran porijeklo in Mongolija i populacija grlo boce ~800 i ~100 godina prije. Dana dva nadmocan IPSILON haplogroups prisutan in ovaj populacija, haplogroup 1 je rasprostranjen in Pakistan, velik dio od Azija, Euro, i Amerika, i tako dalje osigurati malen obavijest o mjesto postanka. Haplogroup 10, in ugovor, je rijedak in vecina Pakistan populacija (1.4%, našto Riskirati jesu vanjski) ali je rutinski in Istok Azija, ukljucujuci Mongolija, gdje svi Internet pomoc za nuždu gore na pola dana populacija (neobjavljen rezultat). Miješanje odrediti ( stol 3) jesu dosljedan sa stvaran doprinos from Mongolija. BATWING analiza dana Riskirati- specifican haplotype skupina in haplogroups 1 i 10 predložen TMRCAs od 400 (120–1,200) i 100 (6–600) godina ( stol 8), koji se odnosi na svakog pojedinog Kako slijedi, gentetski jasnoca je dosljedan sa koji se uzima kroz usta tradicija i, na vidiku od svoj nezavisan narav, osigurati jak podrška za Internet ( smokva. 7).

Neki ostali predložen porijeklo primiti više ogranicen podrška from IPSILON podaci. Pripadnik negroidne rase Makrani, sa tvrdnja porijeklo in Afrika, prijenos najviši frekvencija od haplogroup 8 kromosom postaviti in bilo koji Pakistan populacija, kao bilješka drugdje (Qamar et Al. 1999). Ovaj haplogroup je velik konfiguracijski to pod-Saharan Afrika, gdje svi Internet osnovati o pola dana populacija (cekic et Al. 2001) i može kako slijedi biti ticati se kao tržište od Africki IPSILON kromosom. Ipak, Internet pomoc za nuždu gore jedini 9% dana Pripadnik negroidne rase Makrani uzorak, i haplogroup 28 (zajedno sa ostali tipican Pakistan haplogroups) je prisutan in ovaj populacija. Ako IPSILON kromosom preterit od be parafirano Africki ( smokva. 7), vecina imati kasniji bio naknaden: ukupni odrediti od Africki doprinos je ~12% ( stol 3).

Balti jesu misao to imati uzrokovati in Tibet, gdje svi nadmocan haplogroups jesu 4 i 26. Niti je prisutan in uzorak from ovaj studirati, pod uvijetom da nijedan podrška za Tibet porijeklo dana IPSILON kromosom loza i miješanje odrediti od nula ( stol 3). Pa ipak, ovaj rezultat mora biti protumaciti sa opomena, zbog malen uzorak odredena mjera. Tri populacija imati moguc porijeklo from vojske od Alexandria ognjevit: Burusho, Kalash, i Staza. Moderan Grk pokazivanje moderirati povisok frekvencija od haplogroup 21 (28%; Ross et Al. 2000), ali ovaj haplogroup je ne pp od SEE u jednom od Burusho ili Kalash uzorak i je postaviti in jedini 2% od Staza, gdje svi lokalni haplogroup 28 je prisutan at 17%, 25%, i 13%, koji se odnosi na svakog pojedinog. Grk- miješanje odrediti od 0% preterit od be dobiveno za Burusho i Staza, ali podoba od 20–40%% preterit od be primjecen za Kalash ( stol 3). In pogled od odsutnost od haplogroup 21, mi pripisati ovaj rezultat oba to poticaj in frekvencije dana ostali haplogroups, osobito haplogroups 2 i 1, ili to siromašan rješenje od loza iznutra te haplogroups, rezultat in razlicit loza bitak koji se da klasificirati u jednak paraphyletic haplogroups. Ukupni, nijedan podrška za Grk porijeklo od njihov IPSILON kromosom je postaviti, ali ovaj zakljucak se zahtijeva pretpostavka taj moderan Grk jesu koji predstavlja od Alexander’s vojske. Dva populacija, Kašmirski jezik i Staza, isto tako proizvod prisvajati to moguc Židovski porijeklo Židovski populacija obicno imati moderirati frekvencija od haplogroup 21 (e.g., 20%) i povisok frekvencija od haplogroup 9 (e.g., 36%; (cekic et Al 2000). frekvencije od oba od te haplogroups jesu nisko in Kašmirski jezik i Staza, i haplogroup 28 je prisutan at 13% in Staza, na taj nacin nijedan podrška za Židovski porijeklo je postaviti, i miješanje odrediti je 0% ( stol 3), mada, opet, ovaj zakljucak je ogranicen oba mimo malen uzorak odredena mjera raspoloživ from Kašmirski i mimo pretpostavka taj moderan uzorak jesu koji predstavlja od prastar populacija.

predložen porijeklo dana Balustrada je in Uštrcati. Uštrcati, poput Iranski jezik, jesu karakterizirati mimo niska frekvencija od haplogroup 3 i povisok frekvencija od haplogroup 9 (9% i 57%, koji se odnosi na svakog pojedinog; Cekic et Al 2000), gdje svi prikladan frekvencije in Balustrada jesu 29% i 12%. Ovaj razlika i povisok frekvencija od haplogroup 28 in Balustrada (29%) naklanjati pretežno Uštrcati porijeklo za njihov IPSILON kromosom nevjerojatan, i miješanje odrediti je 0% (stol 3), mada 8% frekvencija za haplogroup 21, najviši identificiran in Pakistan kako slijedi daleko, se naznaciti neki zapad doprinos za njihovo IPSILON loza. Otmjena osoba imati moguc porijeklo in Zapad Azija ( hu- Metak 1991) i Internet je predložen taj protezati od haplogroup 9 IPSILON kromosom je povezan sa ekspanzija od Dravidian- govorenje farmer ( stup kao meta za vježbu u gadanju kopljem u trku-Murci et Al. 2001). Otmjena osoba imati najviši frekvencija od haplogroup 9 kromosom in Pakistan (28%) nakon Parsiranje, pod uvijetom da neki podrška za ovaj pretpostavka, ali njihov viši frekvencija od haplogroup 3 (39%) je ne tipican dana Plodan Mlad mjesec ( stup kao meta za vježbu u gadanju kopljem u trku-Murci et Al. 2001) i predlagati više kompliciran porijeklo, moguce sa miješanje from kasniji seoba, kao što je oni od Indo- Iranski jezik govornik from stepa od Centralni Azija i drugi from povrh toga istok Ovaj mogucnost je podržanih od otkrivanje od nisko frekvencije od haplogroups 10, 12, i 13 in Otmjena osoba, svi rijedak in Pakistan i tipican od Istok Azija, Istok i sjeveroistok Azija, i Jugoistok Azija, koji se odnosi na svakog pojedinog.

neuspjeh pronaci IPSILON povezati sa predložen populacija od porijeklo ne pobiti povijesni asocijacija, ali Internet se dokazati taj IPSILON kromosom derivirati from kao što je povijesni dogadaj su izgubljen ili naknaden. Analizirati od mitochondrial DNA i ostali loci ce ponuditi osvijetliti populacija povjesnicar i bi bilo osobito zanimljiv in populacija poput Pripadnik negroidne rase Makrani i Balti, na koje ima je ugovor izmedu phenotype i tipican Pakistan IPSILON haplotypes.

Potvrda


Ovaj funkcionirati je podržanih od mimo Docek Pouzdanje Kolaborativan Istraživanje Inicijativa Odobrenje to S.Q.M. T.Z. je isto tako podržanih od Docek Pouzdanje, i C.T.-S. mimo Opozvan Istraživanje Kampanja. Mi tocan naš poštovanje to izvorni DNA donors tko je napravio ovaj studirati moguc. Odjel od Zdravlje dana Vlada od Baluchistan i Balustrada Student Federacija, Kecal, Pakistan, pomoci in skupljanje dana Otmjena osoba i Balustrada uzorak. Staza uzorak preterit od be priseban sa pomoc dana Odjel od Paediatrics, Dama Citanje Pošta Maturirati Medicinski Bolnica, Peshawar, Pakistan Mi jesu isto tako zahvalan to Dr. ja Kazmi i Aga Mongolski kan Polaganje Ladanjski Zdravlje Podrška Plan za njihov pomoc in skupljanje od Burusho uzorak. Dr. farad Sethna opskrbljen dragocjen pomoc in skupljanje dana Parsiranje uzorak. Mi hvala Luis Stup kao meta za vježbu u gadanju kopljem u trku-Murci za njegov komentirajte na rukopis.


Elektronski- Baza podataka Obavijest

URLs za podaci in ovaj clanak jesu kao što slijedi:

Arlequin, http:/anthropologie.unige.ch/arlequin/.
/ BATWING, http:/www.maths.abdn.ac.uk/~ijw/.
/ Mreža 2.0, http:/www.fluxus-engineering.com/.
/ Vidik, http:/forrest.psych.unc.edu/.

Upucivanje

Ahmad AKN (1952) Isus in nebo na Zemlja. Gradanski i Vojnicki Novine Ltd, Lahore, Pakistan.
Ayub Q, Mohyuddin , Qamar R, Mazhar K, Zerjal Tera, Mehdi SQ, Tyler- Kovac C (2000) Prepoznavanje i characterisation od Novell covjecji IPSILON- kromosomski microsatellites from slijed baza podataka obavijest. Nuklearni Kiselina Res 28e8: [ slobodan Pun tekst in PMC].
Iza pozornice PC (1992) Balti. Iza pozornice PC, Radloff CF (eds) Sociolinguistic razgledavanje od sjeveroistok Pakistan. Vol 2, Jezik od sjevernjak podrucje Narodni Institut za od Pakistan Izucavanje, Islamabad, pp 3–27.
Zastavica HJ, Odustati P, Rohl (1999) Srednji- spajanje mreža za inferring intraspecific phylogenies. Mol Biol Evol 1637–48: [PubMed] [ slobodan Pun Tekst].
Zastavica HJ, Odustati P, Sykes BC, Rikard MB (1995) Mitochondrial portret od covjecji populacija koristeci srednji mreža. Gentetski 141743–753: [PubMed] [ slobodan Pun Tekst].
Zvono HW (1979) trk od Afghanistan. Pret od SING-e-Meel Objava, Lahore, Pakistan.
Zvono HW (1998) istražni u narodoznanstvo od Afghanistan Prethodnica Knjiga, Lahore, Pakistan.
Berger AW, Sklopiti ugovor lukavštinom C- Ipsilon, Tsai J, Jefferson K, Dey C, Kovac KD, Parkirajte na S-C, Tsai S-J, Zlato D (1999) Asian–Native Amerikanac ocinski loza identificiran mimo RPS4Y resequencing i mimo microsatellite haplotyping. Ann Grgotati Gentetski 6363–80: [PubMed] [pun Tekst].
Bianca Nijedan, Bailliet G, Izazovno razmetanje hrabrošcu Cm, Krvoprolice RF, Rothhammer Farad, Onaj koji zahtijeva i provodi najstrožu disciplinu- Kaljužnica VL, Kazneni SD (1997) Porijeklo od Amerindian IPSILON- kromosom kao zakljuciti mimo analiza od šest polimorfizam tržište. Am J Medicina Ljudsko bice 10279–89: [PubMed] [ pun Tekst].
Biddulph J (1977) Pleme dana Indijski Koosh. Indus Objava, Karaci, Pakistan.
Burton RF (1851) Sindh i trk taj nastanjivati dolina dana Indus. WH Allen i Co Ltd, London.
Rogac O (1958) Staza. Oxford Sveucilišta Vreva, Karaci, Pakistan.
Kazanova M, Leroy P, Boucekkine C, Weissenbach J, Biskup C, Naplatak M, Purrello M, Fjord G, Siniscalco M (1985) covjecji IPSILON- povezati DNA polimorfizam i njegovi potencijal za ocjena gentetski i koji se tice razvoja daljina Znanje 2301403–1406: [PubMed].
Grupa jahaca-Sforza LL, Menozzi P, Javni trg (1994) povijest i zemljopis od covjecji Geneza. Vladar Sveucilišta Vreva, Vladar.
Prodol GF (1991) fenomen dana Indus civilizacija. Jansen M, Predgorje M, Gradski G (eds) Past particip od FORGET gradovi na Indus: izrana civilizacija in Pakistan from 8th to 2nd tisucljece BC. Verlag Filipini von Zabern, Poglavit, Njemacka, pp 129–144.
Oplatiti KD (1992) Sociolinguistic razgledavanje od Sjeveroistok Pakistan. Vol 5, Jezik od Izvještaj. Narodni Institut za od Pakistan Izucavanje, Islamabad.
Ewens WJ (1972) kušanje teorija od koji odabire neutralan aleluja Teorem Narodna masa Biol 387–112: [PubMed].
Strašan BF (1992) Narodoznanstvo: jezici sa svjetski dan. Ljeto Institut za od Lingvistika, Dallas.
Cekic MF (1994) u zadnje vrijeme umetanje od Alu element na IPSILON kromosom je koristan tržište za covjecji populacija izucavanje. Mol Biol Evol 11749–761: [PubMed] [slobodan Pun Tekst].
Cekic MF, Horacije S (1995) IPSILON kromosomski DNA promjena i narod od Japanski. Am J Grgotati Gentetski 56951–962: [PubMed].
Cekic MF, Karaci Tm, Pocrveniti AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL (2001) Hijerarhijski uzor od globalno covjecji IPSILON- kromosom razlicitost Mol Biol Evol 181189–1203: [PubMed] [ slobodan Pun Tekst].
Cekic MF, Pocrveniti AJ, Drvo ET, Sluškinja Gospodin, Jarjanazi H, Karaci Tera, Santachiara-Benerecetti S, Oppenheim , Jobling Miliamper, Jenkins Tera, Ostrer H, Sluškinja- Krocenje B (2000) Židovski i Srednji Istok goj populacija udio rutinski lokva od IPSILON- kromosom biallelic haplotypes. Proc Natl Akademski Znanost SAD 976769–6774: [ slobodan Pun tekst in PMC].
Helgason , Sigurdardottir S, Nicholson J, Sykes B, Brežuljak EW, Cavao DG, Bosanski V, Uski klanac JR, Izborni okrug R, Stefansson K (2000) Ocjena Skandinavski jezik i Gelski ocinstvo in muška osoba kolonist od Islandski. Am J Grgotati Gentetski 67697–717: [PubMed] [ slobodan Pun Tekst].
Hu- Metak R (1991) Imperijalan zemljopisni imenik od Indija: provincijalan niz, Baluchistan. Pret od SING-e-Meel, Lahore, Pakistan.
Husar J (1997) povijest dana narod od Pakistan k nezavisnost. Oxford Sveucilišta Prisutan, Karaci, Pakistan.
Ibbetson D (1883) Panjab kasta Pret od SING-e-Meel, Lahore, Pakistan.
Neskladan JF (1991) Mehrgarh: svoj mjesto in razvoj od prastar kultura in Pakistan. Jansen M, Predgorje M, Gradski G (eds) Past particip od FORGET gradovi na Indus: izrana civilizacija in Pakistan from 8th to 2nd tisucljece BC. Verlag Filipini von Zabern, Poglavit, Njemacka, pp 34–50.
Jobling Miliamper, Tyler- Kovac C (2000) Nov uses za nov haplotypes: covjecji Ipsilon kromosom, bolest i izbor Trend Gentetski 16356–362: [PubMed] [ pun Tekst].
Karaci Tm, Zegura SL, Posukh O, Osipova Gradska nadzemna željeznica, Berger , Ceznuti J, Zlato D, Klitz W, Harihara S, de Knijff P, Wiebe V, Griffiths RC, Mjera za odredivanje velicine i oblika nekog predmeta AR, Cekic MF (1999) Prošli Azijski listinzi() od nov svjetski dan IPSILON- kromosom osnivac haplotypes. Am J Grgotati Gentetski 64817–831: [PubMed] [slobodan Pun Tekst].
Kayser M, Roewer Gradska nadzemna željeznica, Hedman M, Henke Gradska nadzemna željeznica, Henke J, Brauer S, Kruger C, Krawczak M, Nagy M, Dobosz Tera, Szibor R, de Knijff P, Stoneking M, Sajantila (2000) Karakteristican i frekvencija od germline mutacija at microsatellite loci from covjecji IPSILON kromosom, kao objaviti mimo usmjeriti opažanje in predak/ sin pariti. Am J Grgotati Gentetski 661580–1588: [PubMed] [ slobodan Pun Tekst].
Kwok C, Tyler- Kovac C, Mendonca BB, Hu Ja, Berkovitz GD, Goodfellow PN, Hrakanje JR (1996) Mutacija analiza od 2 Kb 5' to SRY in XY ženski i XY sjeci subjekt J Srednja vrijednost Gentetski 33465–468: [PubMed].
Ceznuti JC (1991) gentetski struktura od miješanje populacija. Gentetski 127417–428: [PubMed] [slobodan Pun Tekst].
Matilda Nema racuna, Bayes M, Tyler- Kovac C (1994) Visoko informativan složen haplotypes za covjecji IPSILON kromosom. Grgotati Mol Gentetski 3115–123: [PubMed].
Mehdi SQ, Qamar R, Ayub Q, Kaliq S, Mansarda , Ismail M, Cekic MF, Potajan PA, Grupa jahaca-Sforza LL (1999) porijeklo od Pakistan populacija jasnoca from IPSILON kromosom tržište. Papiha SS, Deka R, Chakraborty R (eds) Genocid razlicitost: aplikacija in covjecji populacija gentetski Kluwer Akademski/ Potpun Izdavac, New York, pp 83–90.
Mohyuddin , Ayub Q, Qamar R, Zerjal Tera, Helgason , Mehdi SQ, Tyler- Kovac C (2001) IPSILON- kromosomski STR haplotypes in Pakistan populacija Sudbeni Znanost Int 118141–146: [PubMed] [pun Tekst].
Nanavutty P (1997) Parsiranje. Narodni Knjiga Pouzdanje, Nov Delhi, Indija.
Koji se odnosi na Pana , Kralj TE, Santa FR, Taylor PG, Thangaraj K, Pjevati Gradska nadzemna željeznica, Jobling Miliamper, Tyler- Kovac C (1998) polimorfizam covjecji IPSILON- kromosomski G to prijelaz postaviti in Indija. Ind J Grgotati Gentetski 452–61:.
Qamar R, Ayub Q, Khaliq S, Mansarda , Karaci Tera, Mehdi SQ, Cekic MF (1999) Africki i Levantinski porijeklo od Pakistan Lajati+ IPSILON kromosom. Grgotati Biol 71745–755: [PubMed].
Quddus SA (1990) plemenski Baluchistan. Ferozsons (Pvt) Ltd, Lahore, Pakistan.
Stup kao meta za vježbu u gadanju kopljem u trku-Murci Gradska nadzemna željeznica, Nijemac C, Zerjal Tera, Sayar SH, Cekic MF, Mehdi SQ, Ayub Q, Qamar R, Mohyuddin , Radhakrishna U, Jobling Miliamper, Tyler- Kovac C, McElreavey K (2001) IPSILON- kromosom loza pracenje difuzija od narod i jezik in jugozapad Azija. Am J Grgotati Gentetski 68537–542: [PubMed] [slobodan Pun Tekst].
Duga gornja odjeca DF, Hiorns R (1965) Metodije od analiza dana gentetski sastavljanje od rijec sastavljena od dijelova koji pripadaju razlicitim jezicima populacija. Grgotati Biol 3738–43:.
Robertson GS (1896) Kafirs dana Hindi-Kush. Oxford Sveucilišta Vreva, Karaci, Pakistan.
Ross ZH, Zerjal Tera, Snažno baciti Mene, Adojaan M, Alavantic D, Amorim , Amos W, et Al (2000) IPSILON- kromosomski razlicitost in Euro je Clinton i utjecati primarno mimo zemljopis, radije nego mimo jezik. Am J Grgotati Gentetski 671526–1543: [PubMed] [ slobodan Pun Tekst].
Santa FR, Carvalho- Šumski DR, Kazneni SDJ (1999a) PCR- temeljen DNA profil od covjecji Ipsilon kromosom Epplen JT, Lubjuhn TERA (eds) Metodije i alat in biosciences i medikament. Birkhauser Verlag, Osnovica, Švicarska, pp 133–152.
Santa FR, Koji se odnosi na Pana , Kayser M, Mitch RJ, Liu , Pjevati Gradska nadzemna željeznica, Razoriti- Bizon G, Novelletto , Qamar R, Mehdi SQ, Adhikari R, Knijff P, Tyler- Kovac C (2000) polimorfizam L1 retroposon umetanje in centromere dana covjecji IPSILON kromosom. Grgotati Mol Gentetski 9421–430: [PubMed] [ slobodan Pun Tekst].
Santa FR, Koji se odnosi na Pana , Tyler- Kovac C, Kazneni SD, Schanfield M, Koji se odnosi na osobe imena Leo WR, Osipova Gradska nadzemna željeznica, Crawford MH, Mitch RJ (1999b) centralni Hladan porijeklo za urodenik Amerikanac IPSILON kromosom. Am J Grgotati Gentetski 64619–628: [PubMed] [ slobodan Pun Tekst].
Schneider S, Kueffer J-M, Roessli D, Excoffier GRADSKA NADZEMNA ŽELJEZNICA (1997) Arlequin ver 1.1: softver za populacija gentetski podaci analiza Gentetski i Biometry Laboratorij, Sveucilišta od Pristalica kalvinizma, Švicarska.
Seielstad MT, Heba, grcka boginja mladosti i proljeca JM, Zaljev AA, Potajan PA, Ibrahim M, Vollrath D, Grupa jahaca-Sforza LL (1994) Sastav od covjecji IPSILON- kromosomski haplotypes koristeci nov polimorfizam to G prijelaz. Grgotati Mol Gentetski 32159–1261: [PubMed].
Golijen Tera, Tomita K, Danas Tera, Kotliarova SE, Lee J, Kuroki Ipsilon, Jin DK, Tokunaga K, Nakamura H, Nakahori IPSILON (1999) Gentetski promjena na IPSILON kromosom in Japanski populacija i implikacija za moderan covjecji IPSILON kromosom loza. J Grgotati Gentetski 44240–245: [PubMed].
Thomas MG, Cavao Nema racuna, Odustati HM (1999) Povisok propusnost analiza od 10 microsatellite i 11 diallelic polimorfizam na covjecji IPSILON- kromosom. Grgotati Gentetski 105577–581: [PubMed] [pun Tekst].
Tyler- Kovac C (1999) IPSILON- kromosomski DNA tržište. Papiha SS, Deka R, Chakraborty R (eds) Genocid razlicitost: aplikacija in covjecji populacija gentetski Kluwer Akademski/ Potpun Izdavac, New York, pp 65–73.
Potajan PA, Jin Gradska nadzemna željeznica, Zaljev AA, Mehdi SQ, Jenkins Tera, Vollrath D, David RW, Grupa jahaca-Sforza LL, Oefner PJ (1997) Otkrivanje od brojan IPSILON kromosom biallelic polimorfizam mimo denaturing povisok- izvodenje tekucina chromatography. Genocid Res 7996–1005: [PubMed] [slobodan Pun Tekst].
Kvalitetno RS, Yuldasheva Nema racuna, Ruzibakiev R, Potajan PA, Evseeva Ja, Plava boja- Kovac J, Jin Gradska nadzemna željeznica, et Al (2001) Koji se odnosi na evropsko-azijske mješance bez srca: koji se odnosi na kontinentalnu Evropu perspektiva na IPSILON- kromosom razlicitost Proc Natl Akademski Znanost SAD 9810244–10249: [ slobodan Pun tekst in PMC].
Whitfield LS, Sulston JE, Goodfellow PN (1995) Slijed promjena dana covjecji Ipsilon kromosom Narav 378379–380: [PubMed] [ pun Tekst].
Wilson IJ, Celav DJ (1998) Genealoški zakljucak from microsatellite podaci. Gentetski 150499–510: [PubMed] [ slobodan Pun Tekst].
Wolpert S (2000) nov povijest od Indija. Oxford Sveucilište Prisutan, New York.
Neiskusan FW, Zabranjen pristup CM (1996) vidni statistika sistem. Žaoka RA, Lisica J (eds) Statistical izbrojiv okolina za društven izucavatelj. Kadulja Objava, New York, pp 207–236.
Zerjal Tera, Beckmann Gradska nadzemna željeznica, Beckmann G, Mikelsaar AV, Krumina , Kucinskas V, Snažno baciti Mene, Tyler- Kovac C (2001) Geografski, jezicni, i kulturni utjecati na gentetski razlicitost: IPSILON- kromosomski distribucija in Sjeveroistok Europski populacija. Mol Biol Evol 181077–1087: [PubMed] [ slobodan Pun Tekst].
Zerjal Tera, Dashnyam B, Koji se odnosi na Pana , Kayser M, Roewer Gradska nadzemna željeznica, Santa FR, Schiefenhovel W, Rešetke Nema racuna, Jobling Miliamper, Harihara S, Metalni klin K, Semjidmaa D, Sajantila , Salon P, Crawford MH, Ginter EK, Evgrafov OV, Tyler- Kovac C (1997) Gentetski srodstvo od Azijski i Sjeveroistok Europski, objaviti mimo IPSILON- kromosomski DNA analiza. Am J Grgotati Gentetski 601174–1183: [PubMed].

 

 

 

Stranica posljednje ažuriranje : Friday, November 25, 2005 22:31:07 -0500